Mapoly0001s0192



Description

Dof domain, zinc finger

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0006355 Regulation of transcription, DNA-dependent
OrthoMCL OG5_150317
PFAM PF02701 Dof domain, zinc finger
PANTHER PTHR31089 FAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpCDF transcription factor, Dof Mapoly0001s0192.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0001s0192.1 scaffold_1:1980505..1983029  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0001s0192.1  

Gene structure:

mRNA scaffold_1:1980505..1983029  ( + strand )
CDS scaffold_1:1980505..1980654  ( + strand )
CDS scaffold_1:1981048..1982009  ( + strand )
CDS scaffold_1:1982087..1983029  ( + strand )

Sequences:

Gene

>Mapoly0001s0192.1
ATGATGGATTCACCGATCAAGTTGTTCGGGAAAACAATTGCTAAAGCTGCCGCTTCCGCATTCACAACATCATCAGGTGAAGCAGACGACGCTGAAGCAGTCCCGACTACGAGCAGTGGGGGCTGGGTTGATTTGCCATCGTCGTCGCAGGTGTGTACTTCCCTTCCAGCTCTTTGAATGTATGCAAGCTGATCTTGCCTACCTGACGAGCATTCGAGCAGCCCTTCGTCGCTCGTCACAGATGCGTTTCCGTGTCTTTTGCATAGCCACTCCTCAGGAGGGCTCAGGCTCCGCGCCTGCGTGTTTCAATCGATGCCTGCGTGAGTGTTTTGTGCGCTTTATGAATTGGTTCAATCGCCGTATAGGATAGGATAGTATAGGATGCGATATGCTTTCTTTCCATGGAGGGGTGGCTCGCCGAGCACGTCGGCAGCCGGTGGCGAAGTCGCTAGTCCGTCTCAATGTCGCCTGCGCCAGAGCAGAGCATCGCGGGCCGTCGGGACTGACGTGGGCGGGCGTGCAATTTCTGTCTGGGATGTGCAGGATGTGAAGGAAAATGGAGCGGAAAGCAGCAGACTGGGGGAGATCAATGGAGGCGGGGTGACGTTCACGAGGCAGGAGGTGAAACGAGGATCGTCGCCCGACCGGACGTCGTCGGCGTGCAACAGCGCGGAGGAGGAGAAGCTGTGCGCGTCGCCGCGAGGCGGAGGCGGGGCCACGGGGGGAGCAGGAGCAGAGCTGACGCCCTCGGCCTCGGGGGGCGAGGCGGGCGCGGGCGACGACGAGGGCAGCGAGGAGGAGGATGGATCGGGCATGAATGGGCGCAGTAAAAAGGATGGCGGCGACGATGGCGGCAAGGGAGGGGAGAAGATGCCCCGACGGCCCGAGAATGCTGTTGCGTGTCCTCGATGCCATAGTTTTGAGACGAAGTTTTGTTACTACAACAATTACAACGTCAATCAGCCCCGGCACTTCTGCAAGCACTGCCAGCGCTACTGGACCGCGGGCGGCACGCTGCGCAACGTGCCGGTGGGCGCCGGGCGGCGCAAGAACAAGCACGGCAGCACCATCGCGCCGCGCGGCCAGACGCCCGAGGTCGGCACCGTGCGCAGCGACGCGCCCGACATCGCCTCGCCGCTCATCGCGTCCAAGGGCGGCGTCGGGCCCGTGCCCGTGCAGGTCGCGGTCGTGCAGGCCGCGGGCAGCAAGGGCGGGATTGTGCGCATGGCCGTGCCTGCGGCCAGCGGCGACCCCTCGGTTCTGCCGTTTCTGCGAATGCAGCCCTCGCCGATGGACACCGCCTCCATCTTCATGGCCTCGTCCGATGCCGGCACCTCGAGCGACACGGTCACCGTGGCCTGCAAGCGCGGCCGGCTGGCCACTCCCGGGTTCAGCGACGCATCCACAGGTGCCAACGACATGGAGCAGCAGCAGCAGCAGCAGCAGCAGCCGTCTTGGGGGCAGCAGTCGTCGACGAATGATGAATCCGCCTGCTCGCCCCTCACGTCGGCGAATGGCAATGTTGTGGTGCATGAGATTAAGGGCGAACCCGGGTCAGCGTGTCAGATGATGGGTGTGGCAGCGGTATCAGGAGTGGGGGGGCCCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAACAGCAGCAGCAGCAGCAGCAGCATCCTGCGACGAACAACGGCATGGCCGGTCCAGGGGGTTGTTGGTCTGCTGCCGGTCCGCAATCGAGCGTACCTCCGCCCGGGGCCGCGGGAGCCCCTTACGGATTCTATAACGGAGGATGGCCGTATGGGTACAACGTGGGCTGGAGCGGGCCTCCTGCATTCTGCGCCGGGGGAGTTGCCACTGCGGGCACGGGCATGCCGGGCCCTCCCCCGCCGGGCAACATCGCTGCGTGGAATGGAGCCGGGGGCAGCGTCTGGACCGGGGTTCCTTGGCCCATGCCGGGCCTGGCTTGGGGCCCCCCCTGGGCTATGGCGCCGTGGGCCATGAGTGCGGGTCACGGTGGGGCTAGCATGGGGAGCATTACGCAGACGATTTCGATGAGCTCCGGTGCTGCTGCTGGCATGGTCACTGTGCCGGTGCCCTGCAGTACGACTGCCAGTGGTGGTGGTCCTGCGTCCGCTGCGCCCCCGTCATCGCCCTCATCATCACTGGGCAAGCATTCGCGCGGGGGGCCGCCGGTGGGGGCCCCTGCATCGTCTGCCGCAGCAGCTGCTGCTTGCAATGGCGCAGGAGGAGCAGGTGGGGGAGGAGGAGGCGGCGGAGGAGGCCGCATGGAGGGAGGCCTGTGGGCGCCCAAATCGCTGCGAATGGCTGATCCTGAGGAGGCAATGCGAAGTTCGGTTTGGAGGATACTGGGAGTCGGTTCCCGAGCCGACATGACGACGGCCAGCACATTTAAAGCGTTCCAGCCTAGAAACGAGAGTAAGAAGATTTCCGATGATGATCAACAAGCAGTGCAAGCGTCGTTGCATGCGAACCCTGCAGCGATGTCTCGTTCCATGAATTTCCACGAGAGTAACTAG

mRNA

>Mapoly0001s0192.1
ATGATGGATTCACCGATCAAGTTGTTCGGGAAAACAATTGCTAAAGCTGCCGCTTCCGCATTCACAACATCATCAGGTGAAGCAGACGACGCTGAAGCAGTCCCGACTACGAGCAGTGGGGGCTGGGTTGATTTGCCATCGTCGTCGCAGGATGTGAAGGAAAATGGAGCGGAAAGCAGCAGACTGGGGGAGATCAATGGAGGCGGGGTGACGTTCACGAGGCAGGAGGTGAAACGAGGATCGTCGCCCGACCGGACGTCGTCGGCGTGCAACAGCGCGGAGGAGGAGAAGCTGTGCGCGTCGCCGCGAGGCGGAGGCGGGGCCACGGGGGGAGCAGGAGCAGAGCTGACGCCCTCGGCCTCGGGGGGCGAGGCGGGCGCGGGCGACGACGAGGGCAGCGAGGAGGAGGATGGATCGGGCATGAATGGGCGCAGTAAAAAGGATGGCGGCGACGATGGCGGCAAGGGAGGGGAGAAGATGCCCCGACGGCCCGAGAATGCTGTTGCGTGTCCTCGATGCCATAGTTTTGAGACGAAGTTTTGTTACTACAACAATTACAACGTCAATCAGCCCCGGCACTTCTGCAAGCACTGCCAGCGCTACTGGACCGCGGGCGGCACGCTGCGCAACGTGCCGGTGGGCGCCGGGCGGCGCAAGAACAAGCACGGCAGCACCATCGCGCCGCGCGGCCAGACGCCCGAGGTCGGCACCGTGCGCAGCGACGCGCCCGACATCGCCTCGCCGCTCATCGCGTCCAAGGGCGGCGTCGGGCCCGTGCCCGTGCAGGTCGCGGTCGTGCAGGCCGCGGGCAGCAAGGGCGGGATTGTGCGCATGGCCGTGCCTGCGGCCAGCGGCGACCCCTCGGTTCTGCCGTTTCTGCGAATGCAGCCCTCGCCGATGGACACCGCCTCCATCTTCATGGCCTCGTCCGATGCCGGCACCTCGAGCGACACGGTCACCGTGGCCTGCAAGCGCGGCCGGCTGGCCACTCCCGGGTTCAGCGACGCATCCACAGGTGCCAACGACATGGAGCAGCAGCAGCAGCAGCAGCAGCAGCCGTCTTGGGGGCAGCAGTCGTCGACGAATGATGAATCCGCCTGCTCGCCCCTCACCGGTATCAGGAGTGGGGGGGCCCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAACAGCAGCAGCAGCAGCAGCAGCATCCTGCGACGAACAACGGCATGGCCGGTCCAGGGGGTTGTTGGTCTGCTGCCGGTCCGCAATCGAGCGTACCTCCGCCCGGGGCCGCGGGAGCCCCTTACGGATTCTATAACGGAGGATGGCCGTATGGGTACAACGTGGGCTGGAGCGGGCCTCCTGCATTCTGCGCCGGGGGAGTTGCCACTGCGGGCACGGGCATGCCGGGCCCTCCCCCGCCGGGCAACATCGCTGCGTGGAATGGAGCCGGGGGCAGCGTCTGGACCGGGGTTCCTTGGCCCATGCCGGGCCTGGCTTGGGGCCCCCCCTGGGCTATGGCGCCGTGGGCCATGAGTGCGGGTCACGGTGGGGCTAGCATGGGGAGCATTACGCAGACGATTTCGATGAGCTCCGGTGCTGCTGCTGGCATGGTCACTGTGCCGGTGCCCTGCAGTACGACTGCCAGTGGTGGTGGTCCTGCGTCCGCTGCGCCCCCGTCATCGCCCTCATCATCACTGGGCAAGCATTCGCGCGGGGGGCCGCCGGTGGGGGCCCCTGCATCGTCTGCCGCAGCAGCTGCTGCTTGCAATGGCGCAGGAGGAGCAGGTGGGGGAGGAGGAGGCGGCGGAGGAGGCCGCATGGAGGGAGGCCTGTGGGCGCCCAAATCGCTGCGAATGGCTGATCCTGAGGAGGCAATGCGAAGTTCGGTTTGGAGGATACTGGGAGTCGGTTCCCGAGCCGACATGACGACGGCCAGCACATTTAAAGCGTTCCAGCCTAGAAACGAGAGTAAGAAGATTTCCGATGATGATCAACAAGCAGTGCAAGCGTCGTTGCATGCGAACCCTGCAGCGATGTCTCGTTCCATGAATTTCCACGAGAGTAACTAG

CDS

>Mapoly0001s0192.1
ATGATGGATTCACCGATCAAGTTGTTCGGGAAAACAATTGCTAAAGCTGCCGCTTCCGCATTCACAACATCATCAGGTGAAGCAGACGACGCTGAAGCAGTCCCGACTACGAGCAGTGGGGGCTGGGTTGATTTGCCATCGTCGTCGCAGGATGTGAAGGAAAATGGAGCGGAAAGCAGCAGACTGGGGGAGATCAATGGAGGCGGGGTGACGTTCACGAGGCAGGAGGTGAAACGAGGATCGTCGCCCGACCGGACGTCGTCGGCGTGCAACAGCGCGGAGGAGGAGAAGCTGTGCGCGTCGCCGCGAGGCGGAGGCGGGGCCACGGGGGGAGCAGGAGCAGAGCTGACGCCCTCGGCCTCGGGGGGCGAGGCGGGCGCGGGCGACGACGAGGGCAGCGAGGAGGAGGATGGATCGGGCATGAATGGGCGCAGTAAAAAGGATGGCGGCGACGATGGCGGCAAGGGAGGGGAGAAGATGCCCCGACGGCCCGAGAATGCTGTTGCGTGTCCTCGATGCCATAGTTTTGAGACGAAGTTTTGTTACTACAACAATTACAACGTCAATCAGCCCCGGCACTTCTGCAAGCACTGCCAGCGCTACTGGACCGCGGGCGGCACGCTGCGCAACGTGCCGGTGGGCGCCGGGCGGCGCAAGAACAAGCACGGCAGCACCATCGCGCCGCGCGGCCAGACGCCCGAGGTCGGCACCGTGCGCAGCGACGCGCCCGACATCGCCTCGCCGCTCATCGCGTCCAAGGGCGGCGTCGGGCCCGTGCCCGTGCAGGTCGCGGTCGTGCAGGCCGCGGGCAGCAAGGGCGGGATTGTGCGCATGGCCGTGCCTGCGGCCAGCGGCGACCCCTCGGTTCTGCCGTTTCTGCGAATGCAGCCCTCGCCGATGGACACCGCCTCCATCTTCATGGCCTCGTCCGATGCCGGCACCTCGAGCGACACGGTCACCGTGGCCTGCAAGCGCGGCCGGCTGGCCACTCCCGGGTTCAGCGACGCATCCACAGGTGCCAACGACATGGAGCAGCAGCAGCAGCAGCAGCAGCAGCCGTCTTGGGGGCAGCAGTCGTCGACGAATGATGAATCCGCCTGCTCGCCCCTCACCGGTATCAGGAGTGGGGGGGCCCAGCAGCAGCAGCAGCAGCAGCAACAACAGCAACAGCAGCAGCAGCAGCAGCAGCATCCTGCGACGAACAACGGCATGGCCGGTCCAGGGGGTTGTTGGTCTGCTGCCGGTCCGCAATCGAGCGTACCTCCGCCCGGGGCCGCGGGAGCCCCTTACGGATTCTATAACGGAGGATGGCCGTATGGGTACAACGTGGGCTGGAGCGGGCCTCCTGCATTCTGCGCCGGGGGAGTTGCCACTGCGGGCACGGGCATGCCGGGCCCTCCCCCGCCGGGCAACATCGCTGCGTGGAATGGAGCCGGGGGCAGCGTCTGGACCGGGGTTCCTTGGCCCATGCCGGGCCTGGCTTGGGGCCCCCCCTGGGCTATGGCGCCGTGGGCCATGAGTGCGGGTCACGGTGGGGCTAGCATGGGGAGCATTACGCAGACGATTTCGATGAGCTCCGGTGCTGCTGCTGGCATGGTCACTGTGCCGGTGCCCTGCAGTACGACTGCCAGTGGTGGTGGTCCTGCGTCCGCTGCGCCCCCGTCATCGCCCTCATCATCACTGGGCAAGCATTCGCGCGGGGGGCCGCCGGTGGGGGCCCCTGCATCGTCTGCCGCAGCAGCTGCTGCTTGCAATGGCGCAGGAGGAGCAGGTGGGGGAGGAGGAGGCGGCGGAGGAGGCCGCATGGAGGGAGGCCTGTGGGCGCCCAAATCGCTGCGAATGGCTGATCCTGAGGAGGCAATGCGAAGTTCGGTTTGGAGGATACTGGGAGTCGGTTCCCGAGCCGACATGACGACGGCCAGCACATTTAAAGCGTTCCAGCCTAGAAACGAGAGTAAGAAGATTTCCGATGATGATCAACAAGCAGTGCAAGCGTCGTTGCATGCGAACCCTGCAGCGATGTCTCGTTCCATGAATTTCCACGAGAGTAACTAG

Protein

>Mapoly0001s0192.1
MMDSPIKLFGKTIAKAAASAFTTSSGEADDAEAVPTTSSGGWVDLPSSSQDVKENGAESSRLGEINGGGVTFTRQEVKRGSSPDRTSSACNSAEEEKLCASPRGGGGATGGAGAELTPSASGGEAGAGDDEGSEEEDGSGMNGRSKKDGGDDGGKGGEKMPRRPENAVACPRCHSFETKFCYYNNYNVNQPRHFCKHCQRYWTAGGTLRNVPVGAGRRKNKHGSTIAPRGQTPEVGTVRSDAPDIASPLIASKGGVGPVPVQVAVVQAAGSKGGIVRMAVPAASGDPSVLPFLRMQPSPMDTASIFMASSDAGTSSDTVTVACKRGRLATPGFSDASTGANDMEQQQQQQQQPSWGQQSSTNDESACSPLTGIRSGGAQQQQQQQQQQQQQQQQQQHPATNNGMAGPGGCWSAAGPQSSVPPPGAAGAPYGFYNGGWPYGYNVGWSGPPAFCAGGVATAGTGMPGPPPPGNIAAWNGAGGSVWTGVPWPMPGLAWGPPWAMAPWAMSAGHGGASMGSITQTISMSSGAAAGMVTVPVPCSTTASGGGPASAAPPSSPSSSLGKHSRGGPPVGAPASSAAAAAACNGAGGAGGGGGGGGGGRMEGGLWAPKSLRMADPEEAMRSSVWRILGVGSRADMTTASTFKAFQPRNESKKISDDDQQAVQASLHANPAAMSRSMNFHESN

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>