Mapoly0001s0259



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_150265
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR16223 FAMILY NOT NAMED
PANTHER PTHR16223:SF13

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH27 transcription factor, bHLH Mapoly0001s0259.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0001s0259.1 scaffold_1:2838640..2843288  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0001s0259.1  

Gene structure:

mRNA scaffold_1:2838640..2843288  ( - strand )
three_prime_UTR scaffold_1:2838640..2839273  ( - strand )
CDS scaffold_1:2839274..2839339  ( - strand )
CDS scaffold_1:2839485..2839556  ( - strand )
CDS scaffold_1:2839693..2839758  ( - strand )
CDS scaffold_1:2839920..2840084  ( - strand )
CDS scaffold_1:2840305..2841606  ( - strand )
five_prime_UTR scaffold_1:2841607..2841613  ( - strand )
five_prime_UTR scaffold_1:2842330..2843288  ( - strand )

Sequences:

Gene

>Mapoly0001s0259.1
CTCTCGAGGTTCGGGGGCCCGGATTTAGACACGGAGTCCTTTTCTGAGCTCCCGTTTTGGCTGTTGTTTTTCGCTGGGCAGAAGAAGAAGAAGAAGCAGAAGAAGAAGCAGAAGAGAAGCAGCAGCACAGAGAGAAGCAAGGAAGATCGGGGCGAGCCGGAGGGATGTCAAGACACACGACATAGTGAGAGCGAGAAAGGAGCAAGTCAGATTTTATTTGTCTTGGCCGAAAGCGTGTATAGTAGATTCGGGTCTGAGATAAGTGGAAGGCAGGCAACGCGAGGGCCGAGTGCAGGAGAGAGAGCGCGCGCGAGAGCGAGAGCGCGAGGGAGGGCAGAGGGTTAATTAGCTGGTTGGGCTAGAGTGCTGGGACGGATTTGTATGCTCTGGTCGGTCCCTTCCCCGATATCCGAGACGTGCAGAATTAGAAGATCAAGCCAGAAGCGTGAGATTCATTCCTTCAATTCTCTCAACTGGAGAGAGTCTGCGAGTAATCTTCCGAGGACGAGGATGATCGCGATATAATCACCCGAGTCAGTGGGTTGGGCTGGGCCCTGAAGCATGTGTGCATCTGGGATGACATCTCAGGATGAGGAGCTCACAGCAATTTTGCACACTCAGCAAAACACCGTGGATTCTTCCCTTGCCGGTCTAGTCACATCCTCTACCGCCTCTGCATCGTCTTTCCAAGCCGCCTATTGTGAAACACAGCAGCTTTCTTATTCATCCGAGTAAGTGGTCCGGACCTGTCCTGTCCTGTCCCTTCCTCTGTCTTGAGAGCGAACGCTAGCGGGAGTGAGTGAGCACCATCCATCAGGTAGAAGTCGGAGCCACGCACACGAGGCGACATGTTGGGCAGGACCACTAGCTAGACAATGCCCGCAGTATTGCCAAAAGTGTGTTGAAGTGTGTCGGACGTATCGGGGTGCCACAAGTTCTGAAAGCGAAGGGGTCTCCAGGTACATTTTCGTCCCTACACAAGCATGGGCGGGGTCCAGCCCGAACTCATCACACTCTCATTCTCTCTACGTCCCGAACAGCACCTGAACAGAGCGCTCAGCGGGGAGTTGACGTTAGGAGGTCGTTTGAAGACACATCTAGCCTACCAAACTGTCGAGCTTTGGGTCGCGCAGCTAGTCACACTCTGCCTTTCCTCTGCTTTCCGTCATCTCTTTCTTTTAGTTTTCCTCGTCCCGAGGTCCGCATGAACCAATCGACCACATTTCAAGATTTCTGCTGTGAGATTTGCTCGACCTTGCCAGCTGTAGTCTCTTCCTTTCTGAGCCACTCGATCCACTTACAATCTTTTCCGAGTCTTTAAAAGCGTTGAAATATAAGGGACTGGTCTGAGCTTTCCCCATCTTCCGAGCAGCTTGCGAGGGGGTTCGTTGTCATCTGTAGAGCCTTACAGCCCCGTGTAAGTGGTGTCATTCCCTCTCATAGATCCTAAGTGCATGAAAGATCTCGCAAGGACATTTCAGGAATCGCAATCGGTATTGCCAATCACGTGATATGCCCAGGATTTTGTTGCAGCCGTGTCAGTCCTTAAGAACTGATATGTGAAGGTCAGAGTGTCTTGCACTGGGAAAGGTGAAGGGATTGCATGATATTGGAAAGGACGGCCCAGATTTGTATTGTTGATGATTAATATGGATGGGAAACTTGACTTTGACAGCAGTTCGATGCTCGGCCCAGGCGGCTCCACACGAGGTTATAGCGACCAGTCGGGTGGGAAACCTCTCATGCCCCTTCAGGCTCTGAATCTGCCTGCTCAGGATCAAGGCGGCCCACACCTAACTCCCTGCTCTCCGATGCTACCCAAGAATGGGGCAAGGCGTCCAGGATTGTGGGGTGCGACGTCATCGAATGGCCCCCAAAAGGATTGGATAAATGGAAGAAGTGGTATGATGGAAATGGATTTTCGGCCCATGCCATCCGACTATCCTTCTGCTCTACTGGATCAAACTTCTGCGCCGCTTACAGACCCCTACCGCGTGCCAGGTGGATTGGCGCGATATCACTCTGCTCCGAGCGCTCTTCTACAAAGTCTAGCTGATTTTCAACAAGACGTGGTCCCAAGACCCATGAGCCAACTCGATAATTCGCTGAGTTCATTCTTCACCGATGCCGAGTTGCCGCCATTGAATCCATCTACGGACACGAGCTTGGAGCAGATGGAAACCGAACATTCTTCTAATTCTGTGTACGACAAGTACATGTTGAACACTCGTAAATTTGATCGACTTGGGAAGCCAGGTGGCCACTATGATCAATTGGGACCGGTCAACGGACCCACAAAGCCTCCTATTATCCAGTCGGTTTACAAACATTCCATGGAGGTCTTACACGAGAACTTGGCAGGGAACCCTCAGATGAACTCGCAGCTAAATACAGAGATGAACTCCCAATTGAATGCTCAGATGAACTCTCAGATGAATTCTCAGATGCCCTCGAGTATGGGGTTGAGTTCGAGCATGGGTTTGTCCTCAACAATGGGTTTGCTTGGCCAGCAGGATAACACACATGCTGGACAAATGTCTCTGGGCAATCTTGGTCAGAGCATTGGCAATGACTTTTGTGTTGGGTCCTCGGGCACCTTGGGAGGTCTAACAAGTACCAGACTTGCACACAAGGGTAACAACAACAACAGCCTTCTCCGACAGAGCAGCTCTCCAGCTGGGCTTCTTGCTCAACTATCCATTGACGTTCAAGCGATGGCAGGAGCTGCTAAAAGTGAGAAGCCGAGCTTATCGAGTCCACTTGCCCATTCTCCAGCTGAAAGTCTCTCTGGGGGCACGTCCGAGGAAAATGGAGGTGCAGGTACTGGACCAGGCACTCCCGGAATGATGTCTAGAATGGACGTAGGGTGGGAGGATGCGCAATCGTACCTCAACTCGTGGGATAACACAAACTTTGCTGCTCGGAAGCGCTTTCGGGATATGGAAATAGATCCTCTCGGAGATCCGTTCATGGCGGATCCTTTGGTGAGATACTTCGTCTGTGGCGTTTTCAGTACTCTATTAGGACGTGCTGACACACTGAGGAATACGAAATATAACCAGCTTTGCATGAAAGTTTTGTTGCACATTCTCTAGCGCGAGGTGGCAGAATATCGAAGAGTTGATTTCTTGTGCTCTTACTGAACAATCGATGAAAGATGAACTTCTGACTTCTGCTCGTGAATTGAAATTGTTACGTCTACAGAGGAGTTCTCAGGACCACAATCCACCGCCCTTGACTAGACATATGAGTCTGCCGACTCAAAAGTCGAAGAATTCCACAATGACGGACGAAATTCTTCAGTCTGTCCCTTGCCGCATCAGAGCAAAGCGCGGCTGTGCCACACATCCGCGGAGTATTGCAGAGCGGGTGAGTTGAAAGCTTACGAAGTGTTGAAGTGTTTTCGGTTGTCATGGCGAAGATTGAACTCAGCTGGGGGAGCATTGGACGAGAAGGTAGCTTGTTCTGTGAAAAATCGCGTGTATTTTGGGTGGGGAAGCAACTGAATGTGAAGTCAAATCTCTTGGCAGGTGAGGAGGACTCGCATCAGCGAACGGATGAGGAAGCTTCAGGAGCTTGTTCCTAACATGGATAAAGTAAGTGGAAGTCCACATTGTAAAGATTTATCGCAGAGAGCTCTTTATGAATGTTCGCTCTTTGCTCTCCATGTTGAGGTAATGTGAAGTGAAGTATGCTGACATTGTGTACCTTACGTGGGATAATGAAATGAAGCAGCAAACAAATACAGCTGATATGCTGGACGAGGCAGTGGAATATGTGAAACAGCTCCAACGACAAGTACAGGTAGCAGCTTGGTTACATTCTGATAAGCCTGGGCTGGGTATGTCGGATGTATGTGGTGTTTGGGATGTTTGGGGCTCGTTTAGTGCTTGGCACTCAAGTCTGTTGGTCCTTACGGGTTTTTTTTTTCTTCTGCTTATATTTGCAGGAGCTCACAGAGAGCAAATGTAAAGGCAACTGTCGGGAGCGCAAGGACAACAATCCCCCTTCATAGGGATTTCTCAACTGCTCGATCGTCAGATCGGTAGAGGTTGGGAGTACAATGTGCATATATCCATCGAGATACATACGTCTTAAGGTTTAAAAACATGGGGGAGAAGCTATGAGCTAGATGACGCCTAGTCCTTAAGAGTAAGTAACTGAAAATTCTCTATGCCTTTTGCTTCCGGGAGCTTAACTCTAATCCCTTTTAGAATCTCTCACCTTCTGGGTGGTCATTGTAGTCACTTGTTTTTGAAGTCCACCTTACGACCGTAGTCGGAATGTAAATGTTAACGAACCTCGTCTAGCCTGATGACCACCTGGATGCTCCTTGTATTTGTAAGTATGTACCTCGACGTGCATGGTGGGCAGCCCTTTGGGTGTTGATGAGGCATGACCCAATCAAGGCATAGTTGTCGAAAGAGCTCAACGTTGGTAATAAAATATCTGAATTGTAGACCACTCGATGTAAGCGTTCAATTTAGAGGTTTGGGATGAGCAGTCTTGTAATCCACTGAGCTCGCAGATGTTATCAGTTCTTATTCTAAGCTCCCAGTGTAGAGTTGGAAATGAGTTTATTTGAAATTACTTGCAGCTCTTAAAGATTTTGACCCCTCTCTTTATAGAGAACAAAAGCTCTTCGGGTT

mRNA

>Mapoly0001s0259.1
CTCTCGAGGTTCGGGGGCCCGGATTTAGACACGGAGTCCTTTTCTGAGCTCCCGTTTTGGCTGTTGTTTTTCGCTGGGCAGAAGAAGAAGAAGAAGCAGAAGAAGAAGCAGAAGAGAAGCAGCAGCACAGAGAGAAGCAAGGAAGATCGGGGCGAGCCGGAGGGATGTCAAGACACACGACATAGTGAGAGCGAGAAAGGAGCAAGTCAGATTTTATTTGTCTTGGCCGAAAGCGTGTATAGTAGATTCGGGTCTGAGATAAGTGGAAGGCAGGCAACGCGAGGGCCGAGTGCAGGAGAGAGAGCGCGCGCGAGAGCGAGAGCGCGAGGGAGGGCAGAGGGTTAATTAGCTGGTTGGGCTAGAGTGCTGGGACGGATTTGTATGCTCTGGTCGGTCCCTTCCCCGATATCCGAGACGTGCAGAATTAGAAGATCAAGCCAGAAGCGTGAGATTCATTCCTTCAATTCTCTCAACTGGAGAGAGTCTGCGAGTAATCTTCCGAGGACGAGGATGATCGCGATATAATCACCCGAGTCAGTGGGTTGGGCTGGGCCCTGAAGCATGTGTGCATCTGGGATGACATCTCAGGATGAGGAGCTCACAGCAATTTTGCACACTCAGCAAAACACCGTGGATTCTTCCCTTGCCGGTCTAGTCACATCCTCTACCGCCTCTGCATCGTCTTTCCAAGCCGCCTATTGTGAAACACAGCAGCTTTCTTATTCATCCGAGTAAGTGGTCCGGACCTGTCCTGTCCTGTCCCTTCCTCTGTCTTGAGAGCGAACGCTAGCGGGAGTGAGTGAGCACCATCCATCAGGTAGAAGTCGGAGCCACGCACACGAGGCGACATGTTGGGCAGGACCACTAGCTAGACAATGCCCGCAGTATTGCCAAAAGTGTGTTGAAGTGTGTCGGACGTATCGGGGTGCCACAAGTTCTGAAAGCGAAGGGGTCTCCAGCAGTTCGATGCTCGGCCCAGGCGGCTCCACACGAGGTTATAGCGACCAGTCGGGTGGGAAACCTCTCATGCCCCTTCAGGCTCTGAATCTGCCTGCTCAGGATCAAGGCGGCCCACACCTAACTCCCTGCTCTCCGATGCTACCCAAGAATGGGGCAAGGCGTCCAGGATTGTGGGGTGCGACGTCATCGAATGGCCCCCAAAAGGATTGGATAAATGGAAGAAGTGGTATGATGGAAATGGATTTTCGGCCCATGCCATCCGACTATCCTTCTGCTCTACTGGATCAAACTTCTGCGCCGCTTACAGACCCCTACCGCGTGCCAGGTGGATTGGCGCGATATCACTCTGCTCCGAGCGCTCTTCTACAAAGTCTAGCTGATTTTCAACAAGACGTGGTCCCAAGACCCATGAGCCAACTCGATAATTCGCTGAGTTCATTCTTCACCGATGCCGAGTTGCCGCCATTGAATCCATCTACGGACACGAGCTTGGAGCAGATGGAAACCGAACATTCTTCTAATTCTGTGTACGACAAGTACATGTTGAACACTCGTAAATTTGATCGACTTGGGAAGCCAGGTGGCCACTATGATCAATTGGGACCGGTCAACGGACCCACAAAGCCTCCTATTATCCAGTCGGTTTACAAACATTCCATGGAGGTCTTACACGAGAACTTGGCAGGGAACCCTCAGATGAACTCGCAGCTAAATACAGAGATGAACTCCCAATTGAATGCTCAGATGAACTCTCAGATGAATTCTCAGATGCCCTCGAGTATGGGGTTGAGTTCGAGCATGGGTTTGTCCTCAACAATGGGTTTGCTTGGCCAGCAGGATAACACACATGCTGGACAAATGTCTCTGGGCAATCTTGGTCAGAGCATTGGCAATGACTTTTGTGTTGGGTCCTCGGGCACCTTGGGAGGTCTAACAAGTACCAGACTTGCACACAAGGGTAACAACAACAACAGCCTTCTCCGACAGAGCAGCTCTCCAGCTGGGCTTCTTGCTCAACTATCCATTGACGTTCAAGCGATGGCAGGAGCTGCTAAAAGTGAGAAGCCGAGCTTATCGAGTCCACTTGCCCATTCTCCAGCTGAAAGTCTCTCTGGGGGCACGTCCGAGGAAAATGGAGGTGCAGGTACTGGACCAGGCACTCCCGGAATGATGTCTAGAATGGACGTAGGGTGGGAGGATGCGCAATCGTACCTCAACTCGTGGGATAACACAAACTTTGCTGCTCGGAAGCGCTTTCGGGATATGGAAATAGATCCTCTCGGAGATCCGTTCATGGCGGATCCTTTGAGGAGTTCTCAGGACCACAATCCACCGCCCTTGACTAGACATATGAGTCTGCCGACTCAAAAGTCGAAGAATTCCACAATGACGGACGAAATTCTTCAGTCTGTCCCTTGCCGCATCAGAGCAAAGCGCGGCTGTGCCACACATCCGCGGAGTATTGCAGAGCGGGTGAGGAGGACTCGCATCAGCGAACGGATGAGGAAGCTTCAGGAGCTTGTTCCTAACATGGATAAACAGCAAACAAATACAGCTGATATGCTGGACGAGGCAGTGGAATATGTGAAACAGCTCCAACGACAAGTACAGGAGCTCACAGAGAGCAAATGTAAAGGCAACTGTCGGGAGCGCAAGGACAACAATCCCCCTTCATAGGGATTTCTCAACTGCTCGATCGTCAGATCGGTAGAGGTTGGGAGTACAATGTGCATATATCCATCGAGATACATACGTCTTAAGGTTTAAAAACATGGGGGAGAAGCTATGAGCTAGATGACGCCTAGTCCTTAAGAGTAAGTAACTGAAAATTCTCTATGCCTTTTGCTTCCGGGAGCTTAACTCTAATCCCTTTTAGAATCTCTCACCTTCTGGGTGGTCATTGTAGTCACTTGTTTTTGAAGTCCACCTTACGACCGTAGTCGGAATGTAAATGTTAACGAACCTCGTCTAGCCTGATGACCACCTGGATGCTCCTTGTATTTGTAAGTATGTACCTCGACGTGCATGGTGGGCAGCCCTTTGGGTGTTGATGAGGCATGACCCAATCAAGGCATAGTTGTCGAAAGAGCTCAACGTTGGTAATAAAATATCTGAATTGTAGACCACTCGATGTAAGCGTTCAATTTAGAGGTTTGGGATGAGCAGTCTTGTAATCCACTGAGCTCGCAGATGTTATCAGTTCTTATTCTAAGCTCCCAGTGTAGAGTTGGAAATGAGTTTATTTGAAATTACTTGCAGCTCTTAAAGATTTTGACCCCTCTCTTTATAGAGAACAAAAGCTCTTCGGGTT

CDS

>Mapoly0001s0259.1
ATGCTCGGCCCAGGCGGCTCCACACGAGGTTATAGCGACCAGTCGGGTGGGAAACCTCTCATGCCCCTTCAGGCTCTGAATCTGCCTGCTCAGGATCAAGGCGGCCCACACCTAACTCCCTGCTCTCCGATGCTACCCAAGAATGGGGCAAGGCGTCCAGGATTGTGGGGTGCGACGTCATCGAATGGCCCCCAAAAGGATTGGATAAATGGAAGAAGTGGTATGATGGAAATGGATTTTCGGCCCATGCCATCCGACTATCCTTCTGCTCTACTGGATCAAACTTCTGCGCCGCTTACAGACCCCTACCGCGTGCCAGGTGGATTGGCGCGATATCACTCTGCTCCGAGCGCTCTTCTACAAAGTCTAGCTGATTTTCAACAAGACGTGGTCCCAAGACCCATGAGCCAACTCGATAATTCGCTGAGTTCATTCTTCACCGATGCCGAGTTGCCGCCATTGAATCCATCTACGGACACGAGCTTGGAGCAGATGGAAACCGAACATTCTTCTAATTCTGTGTACGACAAGTACATGTTGAACACTCGTAAATTTGATCGACTTGGGAAGCCAGGTGGCCACTATGATCAATTGGGACCGGTCAACGGACCCACAAAGCCTCCTATTATCCAGTCGGTTTACAAACATTCCATGGAGGTCTTACACGAGAACTTGGCAGGGAACCCTCAGATGAACTCGCAGCTAAATACAGAGATGAACTCCCAATTGAATGCTCAGATGAACTCTCAGATGAATTCTCAGATGCCCTCGAGTATGGGGTTGAGTTCGAGCATGGGTTTGTCCTCAACAATGGGTTTGCTTGGCCAGCAGGATAACACACATGCTGGACAAATGTCTCTGGGCAATCTTGGTCAGAGCATTGGCAATGACTTTTGTGTTGGGTCCTCGGGCACCTTGGGAGGTCTAACAAGTACCAGACTTGCACACAAGGGTAACAACAACAACAGCCTTCTCCGACAGAGCAGCTCTCCAGCTGGGCTTCTTGCTCAACTATCCATTGACGTTCAAGCGATGGCAGGAGCTGCTAAAAGTGAGAAGCCGAGCTTATCGAGTCCACTTGCCCATTCTCCAGCTGAAAGTCTCTCTGGGGGCACGTCCGAGGAAAATGGAGGTGCAGGTACTGGACCAGGCACTCCCGGAATGATGTCTAGAATGGACGTAGGGTGGGAGGATGCGCAATCGTACCTCAACTCGTGGGATAACACAAACTTTGCTGCTCGGAAGCGCTTTCGGGATATGGAAATAGATCCTCTCGGAGATCCGTTCATGGCGGATCCTTTGAGGAGTTCTCAGGACCACAATCCACCGCCCTTGACTAGACATATGAGTCTGCCGACTCAAAAGTCGAAGAATTCCACAATGACGGACGAAATTCTTCAGTCTGTCCCTTGCCGCATCAGAGCAAAGCGCGGCTGTGCCACACATCCGCGGAGTATTGCAGAGCGGGTGAGGAGGACTCGCATCAGCGAACGGATGAGGAAGCTTCAGGAGCTTGTTCCTAACATGGATAAACAGCAAACAAATACAGCTGATATGCTGGACGAGGCAGTGGAATATGTGAAACAGCTCCAACGACAAGTACAGGAGCTCACAGAGAGCAAATGTAAAGGCAACTGTCGGGAGCGCAAGGACAACAATCCCCCTTCATAG

Protein

>Mapoly0001s0259.1
MLGPGGSTRGYSDQSGGKPLMPLQALNLPAQDQGGPHLTPCSPMLPKNGARRPGLWGATSSNGPQKDWINGRSGMMEMDFRPMPSDYPSALLDQTSAPLTDPYRVPGGLARYHSAPSALLQSLADFQQDVVPRPMSQLDNSLSSFFTDAELPPLNPSTDTSLEQMETEHSSNSVYDKYMLNTRKFDRLGKPGGHYDQLGPVNGPTKPPIIQSVYKHSMEVLHENLAGNPQMNSQLNTEMNSQLNAQMNSQMNSQMPSSMGLSSSMGLSSTMGLLGQQDNTHAGQMSLGNLGQSIGNDFCVGSSGTLGGLTSTRLAHKGNNNNSLLRQSSSPAGLLAQLSIDVQAMAGAAKSEKPSLSSPLAHSPAESLSGGTSEENGGAGTGPGTPGMMSRMDVGWEDAQSYLNSWDNTNFAARKRFRDMEIDPLGDPFMADPLRSSQDHNPPPLTRHMSLPTQKSKNSTMTDEILQSVPCRIRAKRGCATHPRSIAERVRRTRISERMRKLQELVPNMDKQQTNTADMLDEAVEYVKQLQRQVQELTESKCKGNCRERKDNNPPS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>