Mapoly0002s0106



Description

LEUCINE-RICH REPEAT RECEPTOR-LIKE PROTEIN KINASE

Reference DB

Database ID Description
GO GO:0004672 Protein kinase activity
GO GO:0005515 Protein binding
GO GO:0005524 ATP binding
GO GO:0006468 Protein phosphorylation
KOG KOG1187 Serine/threonine protein kinase
OrthoMCL OG5_127136
PFAM PF00069 Protein kinase domain
PFAM PF00560 Leucine Rich Repeat
PFAM PF08263 Leucine rich repeat N-terminal domain
PANTHER PTHR24420 LEUCINE-RICH REPEAT RECEPTOR-LIKE PROTEIN KINASE
PANTHER PTHR24420:SF584

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpCLV1 leucine rich repeat receptor kinase Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0002s0106.1 scaffold_2:1275745..1282247  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0002s0106.1  

Gene structure:

mRNA scaffold_2:1275745..1282247  ( + strand )
five_prime_UTR scaffold_2:1275745..1276817  ( + strand )
CDS scaffold_2:1276818..1279587  ( + strand )
CDS scaffold_2:1280116..1280513  ( + strand )
three_prime_UTR scaffold_2:1280514..1282247  ( + strand )

Sequences:

Gene

>Mapoly0002s0106.1
TGGTAGGGGGATGTGCACTGCTCGGCCTGTTCGTGCAGCGAGGTGAGGTGTTCTTGCACTGAGTGATGGGAGTGGAGTGGAGCGGAGTGGGGGGACGATGTGGTGAGAATTAATGGCATCAGATCGTTCGTTGGTTACTTTATGCGTGCGTACTCACTCTCTCTCTCTCTCCCTCCCTCCCTCTCCCTCTCCCTCCCTCGCTCCCTTCTTACTCTCCTCTCTCTCTCTCTCACACTAGGCTGAGTCCTGACGGACTGACTCCACTGCACAGCTGCTGCGAGTCTGCAGCAAGGGAAGCGCGCAAAACGCGCGGATGCAATTGAACCGAAGGATCAGAGCATACATGCTGCTGCGTAAAGACGGGTACAGTGCATTAGAGTCCGGAGCGTGTCGGGTGCTCTTGTGTCCGGGGGAGCGAAGAATTGAAAGGAGTGCGCACTGAACTGGACTGAGTGAGTGAGAGCTGAGCTGAGCTTGAGCTGTGAGCTGAGTTGAGCGGAGCTGAACTGAACAAAACTGATCTGATCTGAGCTTCTGAGTTGATGAGGCTGCTGCTGAGCCGATCCTATCCTCCTCTTCCTTTACTGTCAGTCTGGTCCGGTCAGTTGGGCTGGGCGGCTGCTGCTCGCTTGCACTTGCTCGCTGGCGCGGCGGTCGGGCCTGGCTAGTTGCGCCTCTCGCTCCCGCACAGCCTCCGAGTGTTGAAAGGTTGGTTAGACTGGCACTGATCACTGAACGACAGAGCACTCACTCTGCGGCTGCCTTCCTATTATTTTTTATATTCTGCGAGCGTCGGGCGCCGGGGACATGATGCTACTTGCGCGCAAGGATGGGTCGAGGAATGCCTTCATTGAGATCAGGACGAGGAGGCGGAGGGGAATTGCTTCGGGATGAGATGTATGCTCCTGCGGCAGCAACAGCAGCAGCAGTGCGCAACAGAATGCCGGGACGAGCTCGAGCAGGTCGACCTCTGTGGATCGGAATGAGGTCGTTGTCGAGGACGAGTCGGGCGGTCTACGCCCCCAGCTTAAGGCGCAGCAGCAGCAGCAGAAGGAGCAGCAGCTGAAAGCTTCATGGGTGTGAGGTCGAACGATCAATCATTAGCGCATATCGACTCGTGGGTTCAGAAGTTCTCCTTGCTTCGTACTCGAGAGTCGCGGGAGGCGACGGCCCCCTCGTGCCGAGCGAGGAGGCAAATGGAGGGTCTCCGGGGAGGTATGTGGACTTCCATTCTGCTCATGCTCGTGGTGACAGCGTCGCATTGCTTCGAGAGCAACGCAGCCCTTTCGTCGGACGGAGTGGCGCTGCTGGCGCTTAAGTCCTCCATCGTCGACGACGAAGGAGTGCTGCTCGATTGGGTGGAATCGTCGCAGACGCCGTGCAACTGGACCGGCGTGGCGTGCGACGCGCTGGGCAATGTCATCTCGTTGAGCCTGTCGCGGATGAATCTGTCCGGGGCCATCTCGGGGGTCATCGGATCGCTCAAGCATCTGACGACACTCAGCCTCGACGCGAACAATTTCACGGGCCCCATCCCGGACGACATCTCGGAGCTGACGCGCCTGCGCTTCTTCAACATTACCAAAAACCTCTTCTCCGACGGCTTCCCGGCGGGCTTCGCCAACCTCACGAAGCTCGAGGTTCTGGATTGCTACAACAACAACATGTCGGGCAAGCTGCCGCTGCAGATCGTGGGCCTGCGCAACCTCAAGAAGGTCCATCTAGGCGGCAACTCGTTCGACGGCAGCATCCCCGTCGAGTACGGCAGCTTCGGCCAGAACCTGGAGTATCTTTCTCTGTCGGGCAACTCCCTCACGGGCGCCATCCCTCGCGAGCTCGGCAACCTCACGGGCCTCACGCAGCTCTTCCTCGGCTACTTCAATGAGTTCGATGGCTCGATCCCGCCCGAGCTCGGCCAGCTGACCAACCTGCAGCTGCTCGACATCCCATCGTGCGGCCTCACTGGCAGCATTCCCAAGGAGCTCGGCAATTTGCGCAATCTCCAGAGCCTCTTTCTCTACGGCAATTTCTTGTCGGGCTCGCTGCCTCCGGAGCTCGGCTCGCTCTCGAATCTGCTCTCGCTCGATGTGTCGAGCAATCAGCTGAGCGGCCCGATCCCGGCCTCGTTCGGGGGCCTGGCCAATGTGACGCTCATCAGCCTGTTCCGGAATTTCCTCGAGGGCGAGATTCCGGCGGCGCTGGGCGATCTGCCGGCGCTCGAGGTGTTCAACATGTGGGAGAACAATCTGACCGGCCCGATCCCGGCGAGCATGGGCCGGAGCGGGAGGCTGATCTATCTGGACGTGTCGAGCAACCAGCTGACCGGCACGCTGCCGCCGGACCTGTGTCGGGGAGGCAGGCTCACGAACCTGATCGTCATGGACAACCGGCTGATCGGGCCGGTGCCGCCGGGGCTGGCCGCCTGCGCCTCGCTCGAGTACGTCCGGATGCACGACAATTTCCTGAACGGCACCGTGCCGGCGCAGTTCTTCAACCTGCGCAACGTCACGATGCTGCAGCTGAACAACAACTACTTCACCGGGCCGCTTCCGGCGACCATGACGGCGCCCATGCTGCGCGTGCTCATGCTCTCGAGTAACCAGCTGGTCGGCACGGTGCCGGAGGCGGTGGGCGGGCTGGCGGCGCTGCAGACGTTGCAAGCCGCGGACAACCAGCTGACGGGGTACATCCCGTCGACGATTTGTGACATCCCGGCGCTCTCGGTGCTCGACCTGAGCGTGAACTACCTGATGGGCTCCATCCCCGCGACGCTTGCGAATTGCTCGAGCCTGTCGCGGCTGGACCTGAGCAAGAACGACCTGGTGGGCGCGATCCCTCCCGAGCTCGTGCAGCTGTCGGTGATCGCCATTCTCAACCTGTCGCGCAACCATCTGACCGGCTCGATCCCGGAGCGGTTCGGGCTGATCCAGAGCCTGACGCAGGTCGACTTCTCCTACAACAACCTGTCGGGGCCGGTGCCGACGCTGGGCGAGGCCGAGTACTACAGCTACGAGGCCTTCGAAGGCAACCCGCTGCTGTGCGGCGGCGCAGTGCTGGCGCCCTGCAGCGAGCGCGACGCGCCGGCCTCGAACGGGACGGGGCGGGGCGCGGGCGCCGCGAAGGGCAACCCGGACCTGCTGGCGTGGCTTGTGGGCGCGCTGTTCTCGGCGGCGCTGGTGGTGCTGCTGGTCGGGATGTGCTGCTTCGTGAAGAAGTACCGGCACTTCATCGCGAAGGTGCTGCGGAAGGAGGGCAAGATCCGGCCGTGGAAGCTGACGCCGTTCCAGCGGCTGGAGTTCACGGCGAACGAGCTGGTGGAGTGCCTGAGCGACGAGAACATCATCGGGCGCGGCGGCGCGGGGACGGTGTACAAGGGCGAGATGGCGAGCGGGGAGATGGTCGCGGTGAAGAGGCTGGCGTGCGGGCGCGGGACGTCGTCGCACGACCACGGGTTCTCGGCGGAGATCCGGACGCTGGGGAAGATCCGGCACCGGAACATCGTGCGGCTGCTGGGGTTCTGCACGAACAACGAGATGAACCTGCTGGTGTACGAGTACATGCCGAACGGGAGCCTGGGCGAGTTCCTGCACGGCAAGAAGAGCGGCGTGCTGGACTGGAACATGCGCTACAGCATCGCCGTGCAGGCGGCGCACGGGCTCTGCTACCTGCACCACGACTGCTCGCCGCTCATCGTGCACCGCGACGTCAAGTCCAACAACATCCTGCTCGACTCCAACCTCGAGGCCCACGTCGCCGACTTCGGCCTCGCCAAGCTCTTCCAGGACTCCGGCAAGTCCGAGTCCATGTCCTCCATCGCCGGCTCCTACGGCTACATCGCCCCCGGTAATTTCCCTTCGCCGTCGCTCTTTCGTAATTCGAATTCGAATTCCGTTTTTTTCCATGAATTCCCCCCTCACTGCGCTTGCGCTCGCTGGCTGGACGGGGGGGGGGTGCGAATGTCGGGTAGGGGGGAGAAAGGAACGGGGGCTTGAGAATGAATCATTATGACGTTCGTAAATTCCGAATTCGAGTAATTACAAGTTTTTTTCCATGAATTCCCCGTCGCTCGCCCTCGACGCGGGGTGCATTGCGCTCGTGGGGATTGAGGGTGGATTTGTATCGACATTGCGCTGCCGCTCGCCCCTGACGGGGGGCCTGTGCCCTCGTTGGGCTGGACGCGGGCCGGAACGGTCCAGGGGATGGGCTTTTGGGAATGAAATGTCATGACGCTCGTCCCCCCACCCTCGTGATGTGGACGCGCGCCTGAACAGGGCTCAGTCGTCGCGGGGTAACGCGCGCCGGGTCGGGGAGTGGGGGATGGGGAAGGAATGGGGCTGGAGCTATACTGACGTTGGGTGATGGGTGGTGCAGAGTACGCGTACACGCTGAAGGTGAACGAGAAGAGCGACATCTACAGCTTCGGGGTGGTGCTGATGGAGCTGCTAACGGGCAAGCGGCCGATCGAGCCCGAGTTCGGCGACGGCGTGGACATCGTGCAGTGGGTGCGCACCAAGATCCAGACCAAGGAGGGCGTGATGGAGATTCTGGACCCGCGCGTCGGCGGTGTCACGGTGCCGCTGCAGGAGGTCATGCTGGTGCTGCGCGTCGCGCTGCTCTGCTCGGGCGACCACCCCATCGACCGCCCCACCATGCGCGACGTCGTGCAGATGCTCTCCGACGTCCGCCCCACCGTCCGCACCGGCAGCATGGACTCCCGCGAGCTTAAGCCCCAGCAAATCCTCCTCACGGACGATCTCTTGACCTTCTAGCTGAGCCGGCCTTCCCCGTCACCCTTCCTACATGACGTGGTTTATGCCACGTCACTCAATTCGCAGCCGATTGGTCCACTTGTCGATTCTCGTCCATTCTCGTCCACCACCCTGTCTGTTCGATTGTCCCCCAAAGACTTCAGGTCCGCCCTCCCCCTTCCCCTGCCCCCCGCTCTGCCGTCTGTTCCGGTGTCGGACTGGACTCAACCACTCCCACTGGCACTGCCACCACAGCAGCAGCAGCAGCAGCACAGTCACTCTAAGCCGAGTGGCATTCTGTACAGTATGAGTAGCCTTTTGCAATGTACGTATGTATAGATACGAAGCCAGGGACGCTGCCGTAATCGTAGAGGCAGCGAGGGGCAAACGAACGGAGCTCGTCGAACGTCGACGGTGAGATTGTGAGCCGGTCGGACGGAAGGCGAACTAGATCTTCAATGCAGACAGAGGAAGGGGGAAGAGAGAGAGATAGCGGCCGGGATCGTATCGGAGCAGGAGCAGCAGAGCGGATCTGGCTTTTCCCGGGGGAGGTTTAAGGTGGGTAGATAGGGGTTGTAGAGCAGGGCAGACGGACGGTCGGATTTCGATCATCTCCGACATACGTTTGCAGGCGATCCGCGTCGCGTGGAAGGACCAGCGTCCGCCTCGGTTTTAGTGAGAGGACGGACGGGAGCGGATGGACGACCGGGGGCATATTATTAGGTGCTCCGTAACGATTCCTCGTGGGTCACCGTTCATGTCTGACGGGATTAGTGGGTAGTCATCTTACCGGAAGTGACGTTCTCACAGAAAGAGACGGACGGACCGACAAATTTACGGACGGACCGGCCGACGAGACTCGCCGCGCGGGAGCGTCGTCACGGCGGCAACGGCCATACAGCTGCATTGGGGGTTATGATGAGCGTGTTCTACACAAATGTCACGAGAATCAGAAGGCTTCTGTTCTTCTCGAGCTCTCTCGGAGTCTCTGGCTGGAGTCCTTCTTCCCTCCCCCGCCCTGCCCTCGGGGAGTGATTGCCAGCCCTTCACTTTTTGCGGGTTCGCGTCATGATTTGGTGCGCAGTCATGATGCTCCGGACTGCCAGAATTCGACGTCACCCACAATGATTCTGCATCGATCCACCGCTGTCGTAAGTTTTGTCAGTCTTCTCGCGGTCCAAGAAGATCCTCCCTCCCTCCTCACCTAGGCTCCGGTGAGGTACAGTTTCTGTCGCGATTTGCTGCTTCCTAGCGCATCACATGTTTGGCACGGTAGGCCCAAGCTCTGCACTTGAAACGCACTCTGGAATCATCATGTCTTGGGTTCATTCGAGTCAACGGTGTAGTTTAATGCAATGTAGGTTTTTGATCGTAGAAAGAAGAGATGTAGAGATTAGAAGAGATATTTGATCAGCGATGGAATTTATGACTAGGTTAGATCCTCTCTTCAGGAGGGAGGGAGTCCTTGTCACATTCTAACGTGGAAGTATGTTTGTTGCGGAGAGAGAAGAGTCGTTGTGGATCTCAATAAAAGATTACCAAAGCGATATGTTGCAGCGAATATTGAGAAATGCGAGCTCACCAGAGTCTTACCTAGAAAAACTCCACAAAGTTTACAGGAATGTAACCCTAAAATGCGTAACGAGTACCTCCTGCAGGGACTAACCTCTCTATGCTGCAAGGTCTTGGATAATGTTTGCAAATCAGCTCTTGCTTTGTGGTGCAAATTATGACTTGACGTAAAAAGTTGGAAGC

mRNA

>Mapoly0002s0106.1
TGGTAGGGGGATGTGCACTGCTCGGCCTGTTCGTGCAGCGAGGTGAGGTGTTCTTGCACTGAGTGATGGGAGTGGAGTGGAGCGGAGTGGGGGGACGATGTGGTGAGAATTAATGGCATCAGATCGTTCGTTGGTTACTTTATGCGTGCGTACTCACTCTCTCTCTCTCTCCCTCCCTCCCTCTCCCTCTCCCTCCCTCGCTCCCTTCTTACTCTCCTCTCTCTCTCTCTCACACTAGGCTGAGTCCTGACGGACTGACTCCACTGCACAGCTGCTGCGAGTCTGCAGCAAGGGAAGCGCGCAAAACGCGCGGATGCAATTGAACCGAAGGATCAGAGCATACATGCTGCTGCGTAAAGACGGGTACAGTGCATTAGAGTCCGGAGCGTGTCGGGTGCTCTTGTGTCCGGGGGAGCGAAGAATTGAAAGGAGTGCGCACTGAACTGGACTGAGTGAGTGAGAGCTGAGCTGAGCTTGAGCTGTGAGCTGAGTTGAGCGGAGCTGAACTGAACAAAACTGATCTGATCTGAGCTTCTGAGTTGATGAGGCTGCTGCTGAGCCGATCCTATCCTCCTCTTCCTTTACTGTCAGTCTGGTCCGGTCAGTTGGGCTGGGCGGCTGCTGCTCGCTTGCACTTGCTCGCTGGCGCGGCGGTCGGGCCTGGCTAGTTGCGCCTCTCGCTCCCGCACAGCCTCCGAGTGTTGAAAGGTTGGTTAGACTGGCACTGATCACTGAACGACAGAGCACTCACTCTGCGGCTGCCTTCCTATTATTTTTTATATTCTGCGAGCGTCGGGCGCCGGGGACATGATGCTACTTGCGCGCAAGGATGGGTCGAGGAATGCCTTCATTGAGATCAGGACGAGGAGGCGGAGGGGAATTGCTTCGGGATGAGATGTATGCTCCTGCGGCAGCAACAGCAGCAGCAGTGCGCAACAGAATGCCGGGACGAGCTCGAGCAGGTCGACCTCTGTGGATCGGAATGAGGTCGTTGTCGAGGACGAGTCGGGCGGTCTACGCCCCCAGCTTAAGGCGCAGCAGCAGCAGCAGAAGGAGCAGCAGCTGAAAGCTTCATGGGTGTGAGGTCGAACGATCAATCATTAGCGCATATCGACTCGTGGGTTCAGAAGTTCTCCTTGCTTCGTACTCGAGAGTCGCGGGAGGCGACGGCCCCCTCGTGCCGAGCGAGGAGGCAAATGGAGGGTCTCCGGGGAGGTATGTGGACTTCCATTCTGCTCATGCTCGTGGTGACAGCGTCGCATTGCTTCGAGAGCAACGCAGCCCTTTCGTCGGACGGAGTGGCGCTGCTGGCGCTTAAGTCCTCCATCGTCGACGACGAAGGAGTGCTGCTCGATTGGGTGGAATCGTCGCAGACGCCGTGCAACTGGACCGGCGTGGCGTGCGACGCGCTGGGCAATGTCATCTCGTTGAGCCTGTCGCGGATGAATCTGTCCGGGGCCATCTCGGGGGTCATCGGATCGCTCAAGCATCTGACGACACTCAGCCTCGACGCGAACAATTTCACGGGCCCCATCCCGGACGACATCTCGGAGCTGACGCGCCTGCGCTTCTTCAACATTACCAAAAACCTCTTCTCCGACGGCTTCCCGGCGGGCTTCGCCAACCTCACGAAGCTCGAGGTTCTGGATTGCTACAACAACAACATGTCGGGCAAGCTGCCGCTGCAGATCGTGGGCCTGCGCAACCTCAAGAAGGTCCATCTAGGCGGCAACTCGTTCGACGGCAGCATCCCCGTCGAGTACGGCAGCTTCGGCCAGAACCTGGAGTATCTTTCTCTGTCGGGCAACTCCCTCACGGGCGCCATCCCTCGCGAGCTCGGCAACCTCACGGGCCTCACGCAGCTCTTCCTCGGCTACTTCAATGAGTTCGATGGCTCGATCCCGCCCGAGCTCGGCCAGCTGACCAACCTGCAGCTGCTCGACATCCCATCGTGCGGCCTCACTGGCAGCATTCCCAAGGAGCTCGGCAATTTGCGCAATCTCCAGAGCCTCTTTCTCTACGGCAATTTCTTGTCGGGCTCGCTGCCTCCGGAGCTCGGCTCGCTCTCGAATCTGCTCTCGCTCGATGTGTCGAGCAATCAGCTGAGCGGCCCGATCCCGGCCTCGTTCGGGGGCCTGGCCAATGTGACGCTCATCAGCCTGTTCCGGAATTTCCTCGAGGGCGAGATTCCGGCGGCGCTGGGCGATCTGCCGGCGCTCGAGGTGTTCAACATGTGGGAGAACAATCTGACCGGCCCGATCCCGGCGAGCATGGGCCGGAGCGGGAGGCTGATCTATCTGGACGTGTCGAGCAACCAGCTGACCGGCACGCTGCCGCCGGACCTGTGTCGGGGAGGCAGGCTCACGAACCTGATCGTCATGGACAACCGGCTGATCGGGCCGGTGCCGCCGGGGCTGGCCGCCTGCGCCTCGCTCGAGTACGTCCGGATGCACGACAATTTCCTGAACGGCACCGTGCCGGCGCAGTTCTTCAACCTGCGCAACGTCACGATGCTGCAGCTGAACAACAACTACTTCACCGGGCCGCTTCCGGCGACCATGACGGCGCCCATGCTGCGCGTGCTCATGCTCTCGAGTAACCAGCTGGTCGGCACGGTGCCGGAGGCGGTGGGCGGGCTGGCGGCGCTGCAGACGTTGCAAGCCGCGGACAACCAGCTGACGGGGTACATCCCGTCGACGATTTGTGACATCCCGGCGCTCTCGGTGCTCGACCTGAGCGTGAACTACCTGATGGGCTCCATCCCCGCGACGCTTGCGAATTGCTCGAGCCTGTCGCGGCTGGACCTGAGCAAGAACGACCTGGTGGGCGCGATCCCTCCCGAGCTCGTGCAGCTGTCGGTGATCGCCATTCTCAACCTGTCGCGCAACCATCTGACCGGCTCGATCCCGGAGCGGTTCGGGCTGATCCAGAGCCTGACGCAGGTCGACTTCTCCTACAACAACCTGTCGGGGCCGGTGCCGACGCTGGGCGAGGCCGAGTACTACAGCTACGAGGCCTTCGAAGGCAACCCGCTGCTGTGCGGCGGCGCAGTGCTGGCGCCCTGCAGCGAGCGCGACGCGCCGGCCTCGAACGGGACGGGGCGGGGCGCGGGCGCCGCGAAGGGCAACCCGGACCTGCTGGCGTGGCTTGTGGGCGCGCTGTTCTCGGCGGCGCTGGTGGTGCTGCTGGTCGGGATGTGCTGCTTCGTGAAGAAGTACCGGCACTTCATCGCGAAGGTGCTGCGGAAGGAGGGCAAGATCCGGCCGTGGAAGCTGACGCCGTTCCAGCGGCTGGAGTTCACGGCGAACGAGCTGGTGGAGTGCCTGAGCGACGAGAACATCATCGGGCGCGGCGGCGCGGGGACGGTGTACAAGGGCGAGATGGCGAGCGGGGAGATGGTCGCGGTGAAGAGGCTGGCGTGCGGGCGCGGGACGTCGTCGCACGACCACGGGTTCTCGGCGGAGATCCGGACGCTGGGGAAGATCCGGCACCGGAACATCGTGCGGCTGCTGGGGTTCTGCACGAACAACGAGATGAACCTGCTGGTGTACGAGTACATGCCGAACGGGAGCCTGGGCGAGTTCCTGCACGGCAAGAAGAGCGGCGTGCTGGACTGGAACATGCGCTACAGCATCGCCGTGCAGGCGGCGCACGGGCTCTGCTACCTGCACCACGACTGCTCGCCGCTCATCGTGCACCGCGACGTCAAGTCCAACAACATCCTGCTCGACTCCAACCTCGAGGCCCACGTCGCCGACTTCGGCCTCGCCAAGCTCTTCCAGGACTCCGGCAAGTCCGAGTCCATGTCCTCCATCGCCGGCTCCTACGGCTACATCGCCCCCGAGTACGCGTACACGCTGAAGGTGAACGAGAAGAGCGACATCTACAGCTTCGGGGTGGTGCTGATGGAGCTGCTAACGGGCAAGCGGCCGATCGAGCCCGAGTTCGGCGACGGCGTGGACATCGTGCAGTGGGTGCGCACCAAGATCCAGACCAAGGAGGGCGTGATGGAGATTCTGGACCCGCGCGTCGGCGGTGTCACGGTGCCGCTGCAGGAGGTCATGCTGGTGCTGCGCGTCGCGCTGCTCTGCTCGGGCGACCACCCCATCGACCGCCCCACCATGCGCGACGTCGTGCAGATGCTCTCCGACGTCCGCCCCACCGTCCGCACCGGCAGCATGGACTCCCGCGAGCTTAAGCCCCAGCAAATCCTCCTCACGGACGATCTCTTGACCTTCTAGCTGAGCCGGCCTTCCCCGTCACCCTTCCTACATGACGTGGTTTATGCCACGTCACTCAATTCGCAGCCGATTGGTCCACTTGTCGATTCTCGTCCATTCTCGTCCACCACCCTGTCTGTTCGATTGTCCCCCAAAGACTTCAGGTCCGCCCTCCCCCTTCCCCTGCCCCCCGCTCTGCCGTCTGTTCCGGTGTCGGACTGGACTCAACCACTCCCACTGGCACTGCCACCACAGCAGCAGCAGCAGCAGCACAGTCACTCTAAGCCGAGTGGCATTCTGTACAGTATGAGTAGCCTTTTGCAATGTACGTATGTATAGATACGAAGCCAGGGACGCTGCCGTAATCGTAGAGGCAGCGAGGGGCAAACGAACGGAGCTCGTCGAACGTCGACGGTGAGATTGTGAGCCGGTCGGACGGAAGGCGAACTAGATCTTCAATGCAGACAGAGGAAGGGGGAAGAGAGAGAGATAGCGGCCGGGATCGTATCGGAGCAGGAGCAGCAGAGCGGATCTGGCTTTTCCCGGGGGAGGTTTAAGGTGGGTAGATAGGGGTTGTAGAGCAGGGCAGACGGACGGTCGGATTTCGATCATCTCCGACATACGTTTGCAGGCGATCCGCGTCGCGTGGAAGGACCAGCGTCCGCCTCGGTTTTAGTGAGAGGACGGACGGGAGCGGATGGACGACCGGGGGCATATTATTAGGTGCTCCGTAACGATTCCTCGTGGGTCACCGTTCATGTCTGACGGGATTAGTGGGTAGTCATCTTACCGGAAGTGACGTTCTCACAGAAAGAGACGGACGGACCGACAAATTTACGGACGGACCGGCCGACGAGACTCGCCGCGCGGGAGCGTCGTCACGGCGGCAACGGCCATACAGCTGCATTGGGGGTTATGATGAGCGTGTTCTACACAAATGTCACGAGAATCAGAAGGCTTCTGTTCTTCTCGAGCTCTCTCGGAGTCTCTGGCTGGAGTCCTTCTTCCCTCCCCCGCCCTGCCCTCGGGGAGTGATTGCCAGCCCTTCACTTTTTGCGGGTTCGCGTCATGATTTGGTGCGCAGTCATGATGCTCCGGACTGCCAGAATTCGACGTCACCCACAATGATTCTGCATCGATCCACCGCTGTCGTAAGTTTTGTCAGTCTTCTCGCGGTCCAAGAAGATCCTCCCTCCCTCCTCACCTAGGCTCCGGTGAGGTACAGTTTCTGTCGCGATTTGCTGCTTCCTAGCGCATCACATGTTTGGCACGGTAGGCCCAAGCTCTGCACTTGAAACGCACTCTGGAATCATCATGTCTTGGGTTCATTCGAGTCAACGGTGTAGTTTAATGCAATGTAGGTTTTTGATCGTAGAAAGAAGAGATGTAGAGATTAGAAGAGATATTTGATCAGCGATGGAATTTATGACTAGGTTAGATCCTCTCTTCAGGAGGGAGGGAGTCCTTGTCACATTCTAACGTGGAAGTATGTTTGTTGCGGAGAGAGAAGAGTCGTTGTGGATCTCAATAAAAGATTACCAAAGCGATATGTTGCAGCGAATATTGAGAAATGCGAGCTCACCAGAGTCTTACCTAGAAAAACTCCACAAAGTTTACAGGAATGTAACCCTAAAATGCGTAACGAGTACCTCCTGCAGGGACTAACCTCTCTATGCTGCAAGGTCTTGGATAATGTTTGCAAATCAGCTCTTGCTTTGTGGTGCAAATTATGACTTGACGTAAAAAGTTGGAAGC

CDS

>Mapoly0002s0106.1
ATGGGTGTGAGGTCGAACGATCAATCATTAGCGCATATCGACTCGTGGGTTCAGAAGTTCTCCTTGCTTCGTACTCGAGAGTCGCGGGAGGCGACGGCCCCCTCGTGCCGAGCGAGGAGGCAAATGGAGGGTCTCCGGGGAGGTATGTGGACTTCCATTCTGCTCATGCTCGTGGTGACAGCGTCGCATTGCTTCGAGAGCAACGCAGCCCTTTCGTCGGACGGAGTGGCGCTGCTGGCGCTTAAGTCCTCCATCGTCGACGACGAAGGAGTGCTGCTCGATTGGGTGGAATCGTCGCAGACGCCGTGCAACTGGACCGGCGTGGCGTGCGACGCGCTGGGCAATGTCATCTCGTTGAGCCTGTCGCGGATGAATCTGTCCGGGGCCATCTCGGGGGTCATCGGATCGCTCAAGCATCTGACGACACTCAGCCTCGACGCGAACAATTTCACGGGCCCCATCCCGGACGACATCTCGGAGCTGACGCGCCTGCGCTTCTTCAACATTACCAAAAACCTCTTCTCCGACGGCTTCCCGGCGGGCTTCGCCAACCTCACGAAGCTCGAGGTTCTGGATTGCTACAACAACAACATGTCGGGCAAGCTGCCGCTGCAGATCGTGGGCCTGCGCAACCTCAAGAAGGTCCATCTAGGCGGCAACTCGTTCGACGGCAGCATCCCCGTCGAGTACGGCAGCTTCGGCCAGAACCTGGAGTATCTTTCTCTGTCGGGCAACTCCCTCACGGGCGCCATCCCTCGCGAGCTCGGCAACCTCACGGGCCTCACGCAGCTCTTCCTCGGCTACTTCAATGAGTTCGATGGCTCGATCCCGCCCGAGCTCGGCCAGCTGACCAACCTGCAGCTGCTCGACATCCCATCGTGCGGCCTCACTGGCAGCATTCCCAAGGAGCTCGGCAATTTGCGCAATCTCCAGAGCCTCTTTCTCTACGGCAATTTCTTGTCGGGCTCGCTGCCTCCGGAGCTCGGCTCGCTCTCGAATCTGCTCTCGCTCGATGTGTCGAGCAATCAGCTGAGCGGCCCGATCCCGGCCTCGTTCGGGGGCCTGGCCAATGTGACGCTCATCAGCCTGTTCCGGAATTTCCTCGAGGGCGAGATTCCGGCGGCGCTGGGCGATCTGCCGGCGCTCGAGGTGTTCAACATGTGGGAGAACAATCTGACCGGCCCGATCCCGGCGAGCATGGGCCGGAGCGGGAGGCTGATCTATCTGGACGTGTCGAGCAACCAGCTGACCGGCACGCTGCCGCCGGACCTGTGTCGGGGAGGCAGGCTCACGAACCTGATCGTCATGGACAACCGGCTGATCGGGCCGGTGCCGCCGGGGCTGGCCGCCTGCGCCTCGCTCGAGTACGTCCGGATGCACGACAATTTCCTGAACGGCACCGTGCCGGCGCAGTTCTTCAACCTGCGCAACGTCACGATGCTGCAGCTGAACAACAACTACTTCACCGGGCCGCTTCCGGCGACCATGACGGCGCCCATGCTGCGCGTGCTCATGCTCTCGAGTAACCAGCTGGTCGGCACGGTGCCGGAGGCGGTGGGCGGGCTGGCGGCGCTGCAGACGTTGCAAGCCGCGGACAACCAGCTGACGGGGTACATCCCGTCGACGATTTGTGACATCCCGGCGCTCTCGGTGCTCGACCTGAGCGTGAACTACCTGATGGGCTCCATCCCCGCGACGCTTGCGAATTGCTCGAGCCTGTCGCGGCTGGACCTGAGCAAGAACGACCTGGTGGGCGCGATCCCTCCCGAGCTCGTGCAGCTGTCGGTGATCGCCATTCTCAACCTGTCGCGCAACCATCTGACCGGCTCGATCCCGGAGCGGTTCGGGCTGATCCAGAGCCTGACGCAGGTCGACTTCTCCTACAACAACCTGTCGGGGCCGGTGCCGACGCTGGGCGAGGCCGAGTACTACAGCTACGAGGCCTTCGAAGGCAACCCGCTGCTGTGCGGCGGCGCAGTGCTGGCGCCCTGCAGCGAGCGCGACGCGCCGGCCTCGAACGGGACGGGGCGGGGCGCGGGCGCCGCGAAGGGCAACCCGGACCTGCTGGCGTGGCTTGTGGGCGCGCTGTTCTCGGCGGCGCTGGTGGTGCTGCTGGTCGGGATGTGCTGCTTCGTGAAGAAGTACCGGCACTTCATCGCGAAGGTGCTGCGGAAGGAGGGCAAGATCCGGCCGTGGAAGCTGACGCCGTTCCAGCGGCTGGAGTTCACGGCGAACGAGCTGGTGGAGTGCCTGAGCGACGAGAACATCATCGGGCGCGGCGGCGCGGGGACGGTGTACAAGGGCGAGATGGCGAGCGGGGAGATGGTCGCGGTGAAGAGGCTGGCGTGCGGGCGCGGGACGTCGTCGCACGACCACGGGTTCTCGGCGGAGATCCGGACGCTGGGGAAGATCCGGCACCGGAACATCGTGCGGCTGCTGGGGTTCTGCACGAACAACGAGATGAACCTGCTGGTGTACGAGTACATGCCGAACGGGAGCCTGGGCGAGTTCCTGCACGGCAAGAAGAGCGGCGTGCTGGACTGGAACATGCGCTACAGCATCGCCGTGCAGGCGGCGCACGGGCTCTGCTACCTGCACCACGACTGCTCGCCGCTCATCGTGCACCGCGACGTCAAGTCCAACAACATCCTGCTCGACTCCAACCTCGAGGCCCACGTCGCCGACTTCGGCCTCGCCAAGCTCTTCCAGGACTCCGGCAAGTCCGAGTCCATGTCCTCCATCGCCGGCTCCTACGGCTACATCGCCCCCGAGTACGCGTACACGCTGAAGGTGAACGAGAAGAGCGACATCTACAGCTTCGGGGTGGTGCTGATGGAGCTGCTAACGGGCAAGCGGCCGATCGAGCCCGAGTTCGGCGACGGCGTGGACATCGTGCAGTGGGTGCGCACCAAGATCCAGACCAAGGAGGGCGTGATGGAGATTCTGGACCCGCGCGTCGGCGGTGTCACGGTGCCGCTGCAGGAGGTCATGCTGGTGCTGCGCGTCGCGCTGCTCTGCTCGGGCGACCACCCCATCGACCGCCCCACCATGCGCGACGTCGTGCAGATGCTCTCCGACGTCCGCCCCACCGTCCGCACCGGCAGCATGGACTCCCGCGAGCTTAAGCCCCAGCAAATCCTCCTCACGGACGATCTCTTGACCTTCTAG

Protein

>Mapoly0002s0106.1
MGVRSNDQSLAHIDSWVQKFSLLRTRESREATAPSCRARRQMEGLRGGMWTSILLMLVVTASHCFESNAALSSDGVALLALKSSIVDDEGVLLDWVESSQTPCNWTGVACDALGNVISLSLSRMNLSGAISGVIGSLKHLTTLSLDANNFTGPIPDDISELTRLRFFNITKNLFSDGFPAGFANLTKLEVLDCYNNNMSGKLPLQIVGLRNLKKVHLGGNSFDGSIPVEYGSFGQNLEYLSLSGNSLTGAIPRELGNLTGLTQLFLGYFNEFDGSIPPELGQLTNLQLLDIPSCGLTGSIPKELGNLRNLQSLFLYGNFLSGSLPPELGSLSNLLSLDVSSNQLSGPIPASFGGLANVTLISLFRNFLEGEIPAALGDLPALEVFNMWENNLTGPIPASMGRSGRLIYLDVSSNQLTGTLPPDLCRGGRLTNLIVMDNRLIGPVPPGLAACASLEYVRMHDNFLNGTVPAQFFNLRNVTMLQLNNNYFTGPLPATMTAPMLRVLMLSSNQLVGTVPEAVGGLAALQTLQAADNQLTGYIPSTICDIPALSVLDLSVNYLMGSIPATLANCSSLSRLDLSKNDLVGAIPPELVQLSVIAILNLSRNHLTGSIPERFGLIQSLTQVDFSYNNLSGPVPTLGEAEYYSYEAFEGNPLLCGGAVLAPCSERDAPASNGTGRGAGAAKGNPDLLAWLVGALFSAALVVLLVGMCCFVKKYRHFIAKVLRKEGKIRPWKLTPFQRLEFTANELVECLSDENIIGRGGAGTVYKGEMASGEMVAVKRLACGRGTSSHDHGFSAEIRTLGKIRHRNIVRLLGFCTNNEMNLLVYEYMPNGSLGEFLHGKKSGVLDWNMRYSIAVQAAHGLCYLHHDCSPLIVHRDVKSNNILLDSNLEAHVADFGLAKLFQDSGKSESMSSIAGSYGYIAPEYAYTLKVNEKSDIYSFGVVLMELLTGKRPIEPEFGDGVDIVQWVRTKIQTKEGVMEILDPRVGGVTVPLQEVMLVLRVALLCSGDHPIDRPTMRDVVQMLSDVRPTVRTGSMDSRELKPQQILLTDDLLTF

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>