Mapoly0003s0245



Description

(UnKnown)

Reference DB

Database ID Description

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-1 transcription factor, C2H2-ZnF Mapoly0003s0245.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0003s0245.1 scaffold_3:2499258..2507981  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0003s0245.1  

Gene structure:

mRNA scaffold_3:2499258..2507981  ( + strand )
five_prime_UTR scaffold_3:2499258..2499496  ( + strand )
five_prime_UTR scaffold_3:2499761..2499972  ( + strand )
five_prime_UTR scaffold_3:2501086..2501101  ( + strand )
CDS scaffold_3:2501102..2501281  ( + strand )
CDS scaffold_3:2501399..2502110  ( + strand )
CDS scaffold_3:2502290..2502423  ( + strand )
CDS scaffold_3:2502609..2502656  ( + strand )
CDS scaffold_3:2502848..2502901  ( + strand )
CDS scaffold_3:2503144..2503248  ( + strand )
CDS scaffold_3:2503462..2503668  ( + strand )
CDS scaffold_3:2503909..2503994  ( + strand )
CDS scaffold_3:2504092..2505280  ( + strand )
CDS scaffold_3:2505501..2506455  ( + strand )
CDS scaffold_3:2506782..2507425  ( + strand )
three_prime_UTR scaffold_3:2507426..2507981  ( + strand )

Sequences:

Gene

>Mapoly0003s0245.1
GGGAGAGGGAGCGGCTGAGTGAAGGATCGACTGCGTTCAACTGTGTTTGCGAAATTCATCTCCAATCCTGCTCTCGCCTGTAGCATGTTGTGAATATTGAGCGAGTGAGGTGTATTGGATTCTCATAAAGGATCCGTAATTTAGGTCGCGATCGGAGCCGAGTGTGATCGACCTTCCCGATTGTTCCTACGTCCTTCCTGGTTTTTCCTTCTTCTGGCATATGCACCGAGACTTTGGTGGTACGAATTGATCACGCACCTACTTTTTTTCTCTTCTTTAGAATTGTTTGTCGTCACCATTGTTCTTTTGCACTGCGTTCGTCTTCTGAGGGCTGAGCGTTCATCTTTCAAGGTCGGACTATCCATACGGTCTTCTTTCTCTTTCTTTTCCTCTCCGAGTGGGCAAAGAATCGGATCGCTTCCTCTGATCTCCATTTACATTCGGTGCATTGAATGGAGATCGATCGAAAAAGTTCCTCCTGATGATGGGCTCCTTGGTATCAGGCTTACGTCGATTCCAAACTTTGAAGCCGGAGTTGGAGTCTTGTACACTGGAAGGGAGCCAATTTATTTTACATTCGGTAGCGAGCAAGTTTACAAGGAGTTGCGAAACCTAAGTCGGGACTACTGTTGTTCTTCCGCTCATTTGGCAATCGCTGAACGTCTACTCATGTGCGGTCTGATTCTACAGTGGCAAAAGACGAGTTTTGTATAGGGTATGACATTCCCTCCCTTCTCAGCTAAGTGAAGCTAAATCGAACGAGTCCATTTACACTCCAGCTTATTTTGCTCAAGGATTCCCTCGTATTATACATTCCGGGATTTTGATTGTCTGGGAAATACAGTGACGTATACAAGCTTTGAAGTGCACATCCAAATGTCTCTTCGTCCAAGTCGACTGTCCAGAGATTTCCGTCGATGGGTGTTCTGATGAAAGGACCCATTGCTTGCGTACAGCCCATTTTTGGGACTGAGAGATCGGACCACACGCGGCAAGTAGGCCTTTGCGGACAACGGTGGATAGAGGAGAAGATAGCAGGTTCTGAGCACTAGGCTAGATGTGGGTGGTGGTCAAGTTTGTCAAAGTGGAGAACTTGATAGCGACCGATATAAAGCCGTCAAGAAGCCCTTCTGGCAAATCCTCAGCGCAGTTGAAGGTCCATGTGAGATCATGAACGGTTCTTCTCGTGTACTCGACTGTGGAGGTGAGTCTAGTGACAAGGATAACAGCCCTCCGTGGGATGACCAAATTTCACGAGTCTCTATACCTGACCCGATTGACGAGAGTACTCATGAAGACGCGTATGGTATTGTTCTTGGGAACACCATCGGAGACGATTCCTGGCCATCTGCCTCCGAAGTTGAGGAGCAGCCAGTGACTGGTTCTGGTGACCAACTAACCTCAGCCCAGCGACCAAGATTTGCAATCATAACTGATGGCAACGGCGATAGTCGAAACGGCGATCCTCAATATACTGCAAATATAGCCCCTGAAAAACCACATCTTTATCTTGATTCAGGAGCTCCTAGCAGGTGAGTGGTTAGGCACATCAAACATAGCAGAACTCATCATCCTAGGTCAGAAGTATTTGTAAGGTCCTGTTTCTACTGGTAAAAACAACTAAATTCTTTTGTCATGATGGTAGGTTTGAATCAATCTGAGCTGATACCCACATCATTAGACATCTCTTTGCCCACCGAGCTGTGCCTCGTAGATTGGTATGTTTATAATTGGCAACTGTCTAATATATGAACTACTGAAGTTGCGTACCGTCTAACAGTTCCTGAACGCGACCATCTCGTAACCGATTTCTCTATGTGTTTTGCAGTTCTCATGCAAGTATTATGCAGTCTGATGATGAGAATGTTACAGTGGGTCAGAAACATAGTTGTAAGGTGGCCATCAGGGACCTTGAAGCAGGACTTTATATTGACAACATATCTTACATGGATGAAGAAGAAAAACTTGATGTGGACATATGTAAAGATGAGAACAATCCAGATCATGTGGAAGCCACGCATGAGGTTGTCACTGCGGAGACCTGTTATTACCATGTTGCATCTTGTGATGTTAAGGCTGTGATTGACTCTAACCTTAGCAAAATATTTACTGTTCAGACTGATGACACTGAATTTCCGCAGGATAAAGAAGTTCTCTTGAACGCTGAGAACAAGCCCGGGGTCGATTTACTTGAGAAGGAAGCTGAAGTTCATGGGCTTCGGAAGCGACGAGTGGCGAAGGTGGACACAGTAAGATCAGTTGTCACCGGTGATTCCGCATTCGGAAGAATGCCAGAAGAGGAGCGCCGAGGTGCGGCAATCGCGAATCGTATGAAAGACGTACCTTTTGAAAGTGGCCCAGAGACGAAACAGAAGCCCTTAGACAAGAAAACAGGGAAGCAGGCTAAGGGCTCAGTGAAACCAGCTGGAAGGCGTGGTAGTGATGGTCCACCTCTCGAGGATTTCAGAGTGAAGGAAGATGCAGAAACAAATAGGAAGGTGCACGAATCTCTTGATAATTTTATTAGACAGACAATCCGATGTGAGCCATACATGACCTTCTCAGGGAGACCGGGGGATAAGCCTTTACAGCGTCTCAGGTCTGATGTATTTGAGAATCATGTTGGAGGGAAGTTTGGACGGGGATTTAAAGTTGAGGGTGGCTCAGACGCCAGGGATATTATTGCTGAAGATAATATTAGCACCGATGGTCTCACAAGTGATGTAGATGGCCTAAAAGAAACGCCTCTCAGCGGATCCAAGGGAATTGGTGGTCTCGGTAGGGGACCTCAACATTCCCTGAAAGTCCCGCCAGGAGTTGTTGCCTTCACCCAGGCGGCTGCGAAAGGCACTGGTAAGTCCCTTGTCATTTGTTTCATATTTTATCCTTCCCCACTGTAAAAATATGATTGAAGAACCATTGTATAAAAGATAGCTAATGGATAAATTCACCTTCTTCCCGTCATAGTAATGATATGCGATTCATCTCAACATGTATTGAAAGATGTGTACATGGCGGTGTATTTTGTATAGATCTTCCCGGATGGCCGTTATCATCTCCCTCTAAAATGACTTTGACGAAATGTGATAAATGTTCTCGAGAGTTTTGCTCGAGTCTCAATTATCGAAGACACGTGAGAGTGCACAGGAAAACTCTCACCGAGAAGGTACATAACTCTCTAAGTTTTACTCTGAACTGACATCACGTAAGCTTCTTTCGAGAAAAGTAATTGCAGCCTTTTGTTCCTTCACCTAGACTTCGCGCAGAAAAAATATATGCATTGAGTTTCAGGTTGACCTATTCTATGGTCGGATTTAGAAGCTTACTGAACTTGAGTTCCTTGTATGCTAGAAGGACCTAAGCAAAGAGAGGTCAAAAGTTGCAGAATTTTGGGACAAGGTATGTTTTCCTCAAATTTGAAGATCATGGTCCATGCTGAGTTAATTTGTTTCATTATATACGAAGTGGTAAGCTTAATCATGAGATTGCGGGATACCTGTTGAATAGCAGAATGCTTGTTGGCACCTCGGGGCTGTTTCACGTAGTTCTTATTGAAAACGTTTACTTACTCGAATCACAATGTTGTGCAGTTAACACCAGAGCAGGCCAGTGTTATTGTAAACTATGAGAATATGGAAATAGAGGTACTTGCCTGACCAATATATTCATGGTTGCCTGAGTTTTGTTGACTGTGACTAGCTATGTGCTCATTGTAAGGTTTTAACGTTACGTTTTGCAAAGTATTATTGAACTTTTTACTGTATGAAGGATCAAACCAGTTTTTTTTTTTTCATTTTGCATTACTATATTTCATATTTCATTTCCGCACAAAAGATGCTTTTTAGTTCTTTGTAAACATAATAAGTAAGTTGGACTTTGTGAGCAGGATTTATCAGGAAATTCGTTACTTAAAGCCCTGGCGGGTTTTATACAACAACCTGGCATGCCTTCGATGCCATCAGGACTCATGAAGGCAGGGTCAGCACTTCTTGTAAGTCCTAGAAACTTGCAGGAGCTGTCAGTCTATATAGCATCTGGAACAAGCAGTGTAGTTGTCTAGCTCCAAAATCTTTATTTATTTCTCAGTTCCAGGATGTGGCTTGTTTCTAACCTGCTTTTGCTAAATCTTATGCGTGAATATTGTAAGAGGTGTACGCGGATACATCATCTCGAGCTTTTCTTAACCACGAAGTTCGTCTCTCAGGATATAGTACAAAACAAGCCATCAGTGTACCCTCTCCCCTCCGAACGACTTCTCAGCATTTTAGATGATGCCAGCGAGAAGACGTTTCTTACTGGAGGAGCGTCTGGTACCTACCCTCGCGTTGTATTTAATGGCGATGCTGGGAAAGTTGGATTAGAGGAGAAAAATCTTGTCGCTTCCATGGGCTTTCATGTCGAATTGAGACTGGTATTTGACTCTCCTCGAAAACAATGCGTTCTCCACTGTCTTGAGTTCAGAGCTTAGATTCATTGCTTGGGTGAACTTAACTAATTGACAGTCTAGCTGTTTCTTCATACTGAAATCTCTTCAATACAAATATGAAAATCGTGGACAAAAAACGAGGAGATTTGCATTAGGTTTTAGTTTCGTGACTAGCTTTCAGTTTGAATTTTCGATGGACTTTATTACTCATCTATGTATAAACAGGTTAAAGCGTGGATGGCCGATAAGGAAGCTGAAGCTTTGCGAAACCAACAAGCGCTATTTAAGGAGGAGGAGGCTGCACAACAAAAGTATTCCACCTTCACCTTTGCTGTCTTTGTTCCTAATGCTGGCGTTCTGTCGTCAATGCTACGAATTTTTTGTGACATATTTCTTTGTCTTCTTTAGACGGGCAAAACTCCTTGAAAAAAGGCGAATGAAGAAGATCCGGCAAAAGGAGCGCAAAGTCACGGCTTCACAACTGGTTCAGGAGTTGGAGAACGAATCCTTGGACGATGAGGGTAACATTCCTGGAGTGGAGGAGGATGATTCCCCAACAGCTACAGGGTCCAGTGTTTCGTCTCTTGTTTCCGCCCATGATCTAGCAATGCCAGGAACCTCTGACCTAGATATGAATGAGGATATAGGACAGGTAGAAGGAAGAGATGAACAACCCGGCCTAGCGGGGGAACCAGTTATAGAAAGGAACAAAGTCAGAGAGGAGGATACTGTGCAACTCCCTAAAGACATATCTTCACCCGGTGGAATAGGGAAATCTATGTTTTACAATCCAGAGGATTCTTCAGATTCTTTCGTTTCGGTTAGTAGGAAGGGTGATTACCACTCTTTTGACCACACTGTAAAGGACAAAGAAATCCTCTCTAGAAATTTAGAAGAGGCAGTTCAGGATATTGATAGAGACTCCAGAATGGCTCAACAAGTAACATACAATCGTAGTGGGAGGCCAGCCGATGTGCAGACAGGTCTGCACAGTCGCAAGGGTGATCAAGAGAGAATAACCTCAGACTTTAGAAGGCGTGAGTCTGACAGATCTGTTGTAGAGAGGAAACCTTTGAGGATTAGCAGGGACAGGACAAGAATTGAGTATCCGGAGGTATTCCAAAAGCCTGGAAGAGACACTAAAGGTTATGACACAAGATATGTGGACGGTCCTTCGCAATCCACATTCAAACCTGTCAGGAAAGCGAATTCTTTCGCTTTAAAGAGTGACTCTGGGACTTCTGATTTGGCTGTTCTTTCAAGAACCCAGCAGTATCGAAGTAAGCCTCCAGGTATGCATCGTACGACGCATACGCCGATTGCAGGTAATGGTCAAGTTGTTTGGACCAGAAAGGTTTCCCAACCAGCCGTTGTGGAATTATGCAAGGACAGAAAGGAGGAGGTTATCCAAGATGATAAGTTGGCCAACAATTCTCTCACTTGTCACGAATGGGAGCTACAAATAGAGTTGACAGACGCTGTAGAGCTGGCCTCGGAATCTACAGGTGCTCCAGAGGTTGTGAAACCGGATAGGGAAGATACAGAGACGAAGGAAGCCACAACTACTTCAGCTATATTGGACGTGAAGCCTGGAAATGTGAGTACAGGAATACACCATCTGAAGGTGGTCCTAAGCATGTCATGGTTTCTATTTTACAGTTTTAGCACATCTGACCGTCAGCATGTCATCAGAATGCCTTTCACTGTACGGAACCCCTCTTGAAACCGAAACTTTTGTCAAATAAAACACGATTTACGCCACATATGCTTCCCTAGCACAAGAGCTTATGTTTGTCTTCGTTTCCAAGTGTTTGCAGGAATTGAAGGCAGGGGGATTGGCTGAGGATACCACCTTCGTCTTTGGGCAGAAGGAACTCGATAACGATGATGACACAATGTATAGCGGTGCACTTTTGGTTGGATCTCTCAGTGTGCCCATCGGTAAATTTGCCACAGAAAAATTTGGCCAGTCCAGGAACTATCGAGCTTTCCGTTCTGCCTCAGATCTTTTGCCTGATTTAGCATTGAGTCCAGCTCCTGATGGGGAAGGAAATGATCTGGGAGTGAGACCTCAGCCTTCAGTTCAGCCAGATGATGCGTCGTTGTGTATCCCTCGTTTGAAGCTTACTGTACCCGAAAGCTCCGATGGGCCCAGCGAAAATGTTGGAAGCGATTTGCCAGTTCCTGTCGTTAGGCCCAACCTAGGTTTTGATCAAGGCTTAAAGCTGAAGCCCCAGTCACCTACGTCTATTCCAGACAGAGCAGAAAGTGGACGTCCTCTTGCTTTGCCTCCTGGACAGGATCGACTTGCAGTGAAACCAGGCTCTTGGCAGACTTCTGCCGGTCGCTATGTTACTGCAAAAGTGTGGCGTGCTGTGGGTCTGGTCGGCGAAAGGCAAGATGCTGTTCCTGGAGTGGCGAGTGCAGGAGATGGCGAGGCAAGAATTCTCCAGGAAGAAACGGATACTTTAGATGGAAATGGAGCTGATGGGTTGCTGGTCAAGAAAGATGCAGAGATGCAAAGCCGTGATGATGACGCCTCTGTTGTTTTGGACTCCAATTCTGTGGAGTACAGTGGTGACCAGGCTTTTCACACTAGTACGCAGATTACATCCAGGCCTGTGGATTCTGAGGCAGATGTTCCCTCGAACGGAGCTACACAGAGCTCATTTGTTCCAGTGACTGAAGATGGTGCAGATACTGCAGCCCTGGTTTCGGATCTCTGTTCTTTATCTGTTTTCTTGGAAGTCGCGGAAAGGTTTTTGAGTGAAAGTAAGTATCTCGTTTCCAAAGAATGGATCTGTCAGTTTCGCTGCATGATTCGCAGTGTCACAAATGACGCAAATTTCTTTAATATCAACCATGTTCTTCTGCTAAACATGAATGAGAAAATCCTTTCGTTGAGATGGACGCTGTTCCCGGATTATCTTGTCTATTAACTGTACATTAATCTCGGGATTCAACTTCAAAATAGAAATATAAAATTCGTATACACACCCGTCGTGTTCTCAACTTAAGCCCATTTGAATGTGTTGTAACTCGCATTCTGGGTCTGGTTTTGTCGAATTCTTGAGCGGAATTTTGCATCTGTTTTGCAGGATGGAGAGTAGCAATTGCTCAAGCATCTCCGGATGAATATGTGGACTATTCGGCGGAAGGAATATCAAAAGTAGCTGAAGTCTGCAATATGACGGAAATGTTATCACAACAGCTGTCTGGTAAGGGCATGAGGCACCATTCAGGTGCAGACCCTTTGCCTTGTTCATCTTCCTCTGTTGTGACTCAGTCGTTGGGGAAGACTGCCCATGATGGGGGCGTGTTTTTGTCCAGGATCTTCAACGACTCTGATCAAACTGGTATGGAAGATGTAAGTCATCAAACGACACATGATGATCAACGGCTGGATGGAGCAGGTTCCCAGGAGTGCCGTATGCCTCAAGTGCTTTCATCAGAGGAGGATTCCGGAATGAGGGATTCACTGTCCTCTCCTATTGATTGTGAGCAGTTTATCAGTGGGACTGAGAACTTTAGAAGTTACATTGGGTCTGCGGCTCAGGTGGGAAGGGTACATGGATCCGAGAGACATTCTGAATCAAGAGGAGGTGGAGGGGGGAGTTTAGGTTATTCGCATGCAAGGCACTCAAGTAGTAGGCAAGAAAGATGGTATCGAAATCCCCGGGACAGGTTTCCAGAACAAAGATACATGCCTCGCAGGCGGGCTCCAGTGGAGAAGAATTGCTGAGATGACGGATTCTGATGAAGTTATGTTTGACAAATTTGGGCTTTGTGGACATGTTGTGTAGTTTCTCCTCCCCTGTTTGCCATGATTCTTTGGATGGGCATTGCCATTGCAATGACCCGTTGTGTCAATAGAGTATTCATCATGACAGGTGTGCATTGATGCAGCAGGTGCATCCATTTGTAGGTTATGTGAGTCCCTAAATCAACACGTCGGAGTGTAGTCCTCAGCTCATATTGCTAGATGTATCCACTCTAGTATTTCCTGCGAGGACTGTGTAGCAAGCAGGTTTTCGGCTTTTGCTGTAGGAGGCCTGTGCCCACAGTCCTATGTGAAGAAGATAGTGGCCACGGGTTCCCTCCGCAGATAGCAGAATGAATCTCTTTCCTTTAGGGGTTCTCTGTATTAGTCACTGGCGGCATGTACATATTTTAGAAGGAAGAGTAAGAAAACTAGTCAATTTTTGTGCCTTTTGCTGTGCCGTGGGTTGATCCCATCGTTTGCAAGGATGACGTTGCAAACGTGGATGTCTAGCAAGATCAGTCACCTATTGTTCTCC

mRNA

>Mapoly0003s0245.1
GGGAGAGGGAGCGGCTGAGTGAAGGATCGACTGCGTTCAACTGTGTTTGCGAAATTCATCTCCAATCCTGCTCTCGCCTGTAGCATGTTGTGAATATTGAGCGAGTGAGGTGTATTGGATTCTCATAAAGGATCCGTAATTTAGGTCGCGATCGGAGCCGAGTGTGATCGACCTTCCCGATTGTTCCTACGTCCTTCCTGGTTTTTCCTTCTTCTGGCATATGCACCGAGACTTTGGTGGCTTACGTCGATTCCAAACTTTGAAGCCGGAGTTGGAGTCTTGTACACTGGAAGGGAGCCAATTTATTTTACATTCGGTAGCGAGCAAGTTTACAAGGAGTTGCGAAACCTAAGTCGGGACTACTGTTGTTCTTCCGCTCATTTGGCAATCGCTGAACGTCTACTCATGTGCGGTCTGATTCTACAGTGGCAAAAGACGAGTTTTGTATAGGTTCTCATGCAAGTATTATGCAGTCTGATGATGAGAATGTTACAGTGGGTCAGAAACATAGTTGTAAGGTGGCCATCAGGGACCTTGAAGCAGGACTTTATATTGACAACATATCTTACATGGATGAAGAAGAAAAACTTGATGTGGACATATGTAAAGATGAGAACAATCCAGATCATGTGGAAGCCACGCATGAGGATAAAGAAGTTCTCTTGAACGCTGAGAACAAGCCCGGGGTCGATTTACTTGAGAAGGAAGCTGAAGTTCATGGGCTTCGGAAGCGACGAGTGGCGAAGGTGGACACAGTAAGATCAGTTGTCACCGGTGATTCCGCATTCGGAAGAATGCCAGAAGAGGAGCGCCGAGGTGCGGCAATCGCGAATCGTATGAAAGACGTACCTTTTGAAAGTGGCCCAGAGACGAAACAGAAGCCCTTAGACAAGAAAACAGGGAAGCAGGCTAAGGGCTCAGTGAAACCAGCTGGAAGGCGTGGTAGTGATGGTCCACCTCTCGAGGATTTCAGAGTGAAGGAAGATGCAGAAACAAATAGGAAGGTGCACGAATCTCTTGATAATTTTATTAGACAGACAATCCGATGTGAGCCATACATGACCTTCTCAGGGAGACCGGGGGATAAGCCTTTACAGCGTCTCAGGTCTGATGTATTTGAGAATCATGTTGGAGGGAAGTTTGGACGGGGATTTAAAGTTGAGGGTGGCTCAGACGCCAGGGATATTATTGCTGAAGATAATATTAGCACCGATGGTCTCACAAGTGATGTAGATGGCCTAAAAGAAACGCCTCTCAGCGGATCCAAGGGAATTGGTGGTCTCGGTAGGGGACCTCAACATTCCCTGAAAGTCCCGCCAGGAGTTGTTGCCTTCACCCAGGCGGCTGCGAAAGGCACTGATCTTCCCGGATGGCCGTTATCATCTCCCTCTAAAATGACTTTGACGAAATGTGATAAATGTTCTCGAGAGTTTTGCTCGAGTCTCAATTATCGAAGACACGTGAGAGTGCACAGGAAAACTCTCACCGAGAAGAAGGACCTAAGCAAAGAGAGGTCAAAAGTTGCAGAATTTTGGGACAAGTTAACACCAGAGCAGGCCAGTGTTATTGTAAACTATGAGAATATGGAAATAGAGGATTTATCAGGAAATTCGTTACTTAAAGCCCTGGCGGGTTTTATACAACAACCTGGCATGCCTTCGATGCCATCAGGACTCATGAAGGCAGGGTCAGCACTTCTTGATATAGTACAAAACAAGCCATCAGTGTACCCTCTCCCCTCCGAACGACTTCTCAGCATTTTAGATGATGCCAGCGAGAAGACGTTTCTTACTGGAGGAGCGTCTGGTACCTACCCTCGCGTTGTATTTAATGGCGATGCTGGGAAAGTTGGATTAGAGGAGAAAAATCTTGTCGCTTCCATGGGCTTTCATGTCGAATTGAGACTGGTTAAAGCGTGGATGGCCGATAAGGAAGCTGAAGCTTTGCGAAACCAACAAGCGCTATTTAAGGAGGAGGAGGCTGCACAACAAAAACGGGCAAAACTCCTTGAAAAAAGGCGAATGAAGAAGATCCGGCAAAAGGAGCGCAAAGTCACGGCTTCACAACTGGTTCAGGAGTTGGAGAACGAATCCTTGGACGATGAGGGTAACATTCCTGGAGTGGAGGAGGATGATTCCCCAACAGCTACAGGGTCCAGTGTTTCGTCTCTTGTTTCCGCCCATGATCTAGCAATGCCAGGAACCTCTGACCTAGATATGAATGAGGATATAGGACAGGTAGAAGGAAGAGATGAACAACCCGGCCTAGCGGGGGAACCAGTTATAGAAAGGAACAAAGTCAGAGAGGAGGATACTGTGCAACTCCCTAAAGACATATCTTCACCCGGTGGAATAGGGAAATCTATGTTTTACAATCCAGAGGATTCTTCAGATTCTTTCGTTTCGGTTAGTAGGAAGGGTGATTACCACTCTTTTGACCACACTGTAAAGGACAAAGAAATCCTCTCTAGAAATTTAGAAGAGGCAGTTCAGGATATTGATAGAGACTCCAGAATGGCTCAACAAGTAACATACAATCGTAGTGGGAGGCCAGCCGATGTGCAGACAGGTCTGCACAGTCGCAAGGGTGATCAAGAGAGAATAACCTCAGACTTTAGAAGGCGTGAGTCTGACAGATCTGTTGTAGAGAGGAAACCTTTGAGGATTAGCAGGGACAGGACAAGAATTGAGTATCCGGAGGTATTCCAAAAGCCTGGAAGAGACACTAAAGGTTATGACACAAGATATGTGGACGGTCCTTCGCAATCCACATTCAAACCTGTCAGGAAAGCGAATTCTTTCGCTTTAAAGAGTGACTCTGGGACTTCTGATTTGGCTGTTCTTTCAAGAACCCAGCAGTATCGAAGTAAGCCTCCAGGTATGCATCGTACGACGCATACGCCGATTGCAGGTAATGGTCAAGTTGTTTGGACCAGAAAGGTTTCCCAACCAGCCGTTGTGGAATTATGCAAGGACAGAAAGGAGGAGGTTATCCAAGATGATAAGTTGGCCAACAATTCTCTCACTTGTCACGAATGGGAGCTACAAATAGAGTTGACAGACGCTGTAGAGCTGGCCTCGGAATCTACAGGTGCTCCAGAGGTTGTGAAACCGGATAGGGAAGATACAGAGACGAAGGAAGCCACAACTACTTCAGCTATATTGGACGTGAAGCCTGGAAATGAATTGAAGGCAGGGGGATTGGCTGAGGATACCACCTTCGTCTTTGGGCAGAAGGAACTCGATAACGATGATGACACAATGTATAGCGGTGCACTTTTGGTTGGATCTCTCAGTGTGCCCATCGGTAAATTTGCCACAGAAAAATTTGGCCAGTCCAGGAACTATCGAGCTTTCCGTTCTGCCTCAGATCTTTTGCCTGATTTAGCATTGAGTCCAGCTCCTGATGGGGAAGGAAATGATCTGGGAGTGAGACCTCAGCCTTCAGTTCAGCCAGATGATGCGTCGTTGTGTATCCCTCGTTTGAAGCTTACTGTACCCGAAAGCTCCGATGGGCCCAGCGAAAATGTTGGAAGCGATTTGCCAGTTCCTGTCGTTAGGCCCAACCTAGGTTTTGATCAAGGCTTAAAGCTGAAGCCCCAGTCACCTACGTCTATTCCAGACAGAGCAGAAAGTGGACGTCCTCTTGCTTTGCCTCCTGGACAGGATCGACTTGCAGTGAAACCAGGCTCTTGGCAGACTTCTGCCGGTCGCTATGTTACTGCAAAAGTGTGGCGTGCTGTGGGTCTGGTCGGCGAAAGGCAAGATGCTGTTCCTGGAGTGGCGAGTGCAGGAGATGGCGAGGCAAGAATTCTCCAGGAAGAAACGGATACTTTAGATGGAAATGGAGCTGATGGGTTGCTGGTCAAGAAAGATGCAGAGATGCAAAGCCGTGATGATGACGCCTCTGTTGTTTTGGACTCCAATTCTGTGGAGTACAGTGGTGACCAGGCTTTTCACACTAGTACGCAGATTACATCCAGGCCTGTGGATTCTGAGGCAGATGTTCCCTCGAACGGAGCTACACAGAGCTCATTTGTTCCAGTGACTGAAGATGGTGCAGATACTGCAGCCCTGGTTTCGGATCTCTGTTCTTTATCTGTTTTCTTGGAAGTCGCGGAAAGGTTTTTGAGTGAAAGATGGAGAGTAGCAATTGCTCAAGCATCTCCGGATGAATATGTGGACTATTCGGCGGAAGGAATATCAAAAGTAGCTGAAGTCTGCAATATGACGGAAATGTTATCACAACAGCTGTCTGGTAAGGGCATGAGGCACCATTCAGGTGCAGACCCTTTGCCTTGTTCATCTTCCTCTGTTGTGACTCAGTCGTTGGGGAAGACTGCCCATGATGGGGGCGTGTTTTTGTCCAGGATCTTCAACGACTCTGATCAAACTGGTATGGAAGATGTAAGTCATCAAACGACACATGATGATCAACGGCTGGATGGAGCAGGTTCCCAGGAGTGCCGTATGCCTCAAGTGCTTTCATCAGAGGAGGATTCCGGAATGAGGGATTCACTGTCCTCTCCTATTGATTGTGAGCAGTTTATCAGTGGGACTGAGAACTTTAGAAGTTACATTGGGTCTGCGGCTCAGGTGGGAAGGGTACATGGATCCGAGAGACATTCTGAATCAAGAGGAGGTGGAGGGGGGAGTTTAGGTTATTCGCATGCAAGGCACTCAAGTAGTAGGCAAGAAAGATGGTATCGAAATCCCCGGGACAGGTTTCCAGAACAAAGATACATGCCTCGCAGGCGGGCTCCAGTGGAGAAGAATTGCTGAGATGACGGATTCTGATGAAGTTATGTTTGACAAATTTGGGCTTTGTGGACATGTTGTGTAGTTTCTCCTCCCCTGTTTGCCATGATTCTTTGGATGGGCATTGCCATTGCAATGACCCGTTGTGTCAATAGAGTATTCATCATGACAGGTGTGCATTGATGCAGCAGGTGCATCCATTTGTAGGTTATGTGAGTCCCTAAATCAACACGTCGGAGTGTAGTCCTCAGCTCATATTGCTAGATGTATCCACTCTAGTATTTCCTGCGAGGACTGTGTAGCAAGCAGGTTTTCGGCTTTTGCTGTAGGAGGCCTGTGCCCACAGTCCTATGTGAAGAAGATAGTGGCCACGGGTTCCCTCCGCAGATAGCAGAATGAATCTCTTTCCTTTAGGGGTTCTCTGTATTAGTCACTGGCGGCATGTACATATTTTAGAAGGAAGAGTAAGAAAACTAGTCAATTTTTGTGCCTTTTGCTGTGCCGTGGGTTGATCCCATCGTTTGCAAGGATGACGTTGCAAACGTGGATGTCTAGCAAGATCAGTCACCTATTGTTCTCC

CDS

>Mapoly0003s0245.1
ATGCAGTCTGATGATGAGAATGTTACAGTGGGTCAGAAACATAGTTGTAAGGTGGCCATCAGGGACCTTGAAGCAGGACTTTATATTGACAACATATCTTACATGGATGAAGAAGAAAAACTTGATGTGGACATATGTAAAGATGAGAACAATCCAGATCATGTGGAAGCCACGCATGAGGATAAAGAAGTTCTCTTGAACGCTGAGAACAAGCCCGGGGTCGATTTACTTGAGAAGGAAGCTGAAGTTCATGGGCTTCGGAAGCGACGAGTGGCGAAGGTGGACACAGTAAGATCAGTTGTCACCGGTGATTCCGCATTCGGAAGAATGCCAGAAGAGGAGCGCCGAGGTGCGGCAATCGCGAATCGTATGAAAGACGTACCTTTTGAAAGTGGCCCAGAGACGAAACAGAAGCCCTTAGACAAGAAAACAGGGAAGCAGGCTAAGGGCTCAGTGAAACCAGCTGGAAGGCGTGGTAGTGATGGTCCACCTCTCGAGGATTTCAGAGTGAAGGAAGATGCAGAAACAAATAGGAAGGTGCACGAATCTCTTGATAATTTTATTAGACAGACAATCCGATGTGAGCCATACATGACCTTCTCAGGGAGACCGGGGGATAAGCCTTTACAGCGTCTCAGGTCTGATGTATTTGAGAATCATGTTGGAGGGAAGTTTGGACGGGGATTTAAAGTTGAGGGTGGCTCAGACGCCAGGGATATTATTGCTGAAGATAATATTAGCACCGATGGTCTCACAAGTGATGTAGATGGCCTAAAAGAAACGCCTCTCAGCGGATCCAAGGGAATTGGTGGTCTCGGTAGGGGACCTCAACATTCCCTGAAAGTCCCGCCAGGAGTTGTTGCCTTCACCCAGGCGGCTGCGAAAGGCACTGATCTTCCCGGATGGCCGTTATCATCTCCCTCTAAAATGACTTTGACGAAATGTGATAAATGTTCTCGAGAGTTTTGCTCGAGTCTCAATTATCGAAGACACGTGAGAGTGCACAGGAAAACTCTCACCGAGAAGAAGGACCTAAGCAAAGAGAGGTCAAAAGTTGCAGAATTTTGGGACAAGTTAACACCAGAGCAGGCCAGTGTTATTGTAAACTATGAGAATATGGAAATAGAGGATTTATCAGGAAATTCGTTACTTAAAGCCCTGGCGGGTTTTATACAACAACCTGGCATGCCTTCGATGCCATCAGGACTCATGAAGGCAGGGTCAGCACTTCTTGATATAGTACAAAACAAGCCATCAGTGTACCCTCTCCCCTCCGAACGACTTCTCAGCATTTTAGATGATGCCAGCGAGAAGACGTTTCTTACTGGAGGAGCGTCTGGTACCTACCCTCGCGTTGTATTTAATGGCGATGCTGGGAAAGTTGGATTAGAGGAGAAAAATCTTGTCGCTTCCATGGGCTTTCATGTCGAATTGAGACTGGTTAAAGCGTGGATGGCCGATAAGGAAGCTGAAGCTTTGCGAAACCAACAAGCGCTATTTAAGGAGGAGGAGGCTGCACAACAAAAACGGGCAAAACTCCTTGAAAAAAGGCGAATGAAGAAGATCCGGCAAAAGGAGCGCAAAGTCACGGCTTCACAACTGGTTCAGGAGTTGGAGAACGAATCCTTGGACGATGAGGGTAACATTCCTGGAGTGGAGGAGGATGATTCCCCAACAGCTACAGGGTCCAGTGTTTCGTCTCTTGTTTCCGCCCATGATCTAGCAATGCCAGGAACCTCTGACCTAGATATGAATGAGGATATAGGACAGGTAGAAGGAAGAGATGAACAACCCGGCCTAGCGGGGGAACCAGTTATAGAAAGGAACAAAGTCAGAGAGGAGGATACTGTGCAACTCCCTAAAGACATATCTTCACCCGGTGGAATAGGGAAATCTATGTTTTACAATCCAGAGGATTCTTCAGATTCTTTCGTTTCGGTTAGTAGGAAGGGTGATTACCACTCTTTTGACCACACTGTAAAGGACAAAGAAATCCTCTCTAGAAATTTAGAAGAGGCAGTTCAGGATATTGATAGAGACTCCAGAATGGCTCAACAAGTAACATACAATCGTAGTGGGAGGCCAGCCGATGTGCAGACAGGTCTGCACAGTCGCAAGGGTGATCAAGAGAGAATAACCTCAGACTTTAGAAGGCGTGAGTCTGACAGATCTGTTGTAGAGAGGAAACCTTTGAGGATTAGCAGGGACAGGACAAGAATTGAGTATCCGGAGGTATTCCAAAAGCCTGGAAGAGACACTAAAGGTTATGACACAAGATATGTGGACGGTCCTTCGCAATCCACATTCAAACCTGTCAGGAAAGCGAATTCTTTCGCTTTAAAGAGTGACTCTGGGACTTCTGATTTGGCTGTTCTTTCAAGAACCCAGCAGTATCGAAGTAAGCCTCCAGGTATGCATCGTACGACGCATACGCCGATTGCAGGTAATGGTCAAGTTGTTTGGACCAGAAAGGTTTCCCAACCAGCCGTTGTGGAATTATGCAAGGACAGAAAGGAGGAGGTTATCCAAGATGATAAGTTGGCCAACAATTCTCTCACTTGTCACGAATGGGAGCTACAAATAGAGTTGACAGACGCTGTAGAGCTGGCCTCGGAATCTACAGGTGCTCCAGAGGTTGTGAAACCGGATAGGGAAGATACAGAGACGAAGGAAGCCACAACTACTTCAGCTATATTGGACGTGAAGCCTGGAAATGAATTGAAGGCAGGGGGATTGGCTGAGGATACCACCTTCGTCTTTGGGCAGAAGGAACTCGATAACGATGATGACACAATGTATAGCGGTGCACTTTTGGTTGGATCTCTCAGTGTGCCCATCGGTAAATTTGCCACAGAAAAATTTGGCCAGTCCAGGAACTATCGAGCTTTCCGTTCTGCCTCAGATCTTTTGCCTGATTTAGCATTGAGTCCAGCTCCTGATGGGGAAGGAAATGATCTGGGAGTGAGACCTCAGCCTTCAGTTCAGCCAGATGATGCGTCGTTGTGTATCCCTCGTTTGAAGCTTACTGTACCCGAAAGCTCCGATGGGCCCAGCGAAAATGTTGGAAGCGATTTGCCAGTTCCTGTCGTTAGGCCCAACCTAGGTTTTGATCAAGGCTTAAAGCTGAAGCCCCAGTCACCTACGTCTATTCCAGACAGAGCAGAAAGTGGACGTCCTCTTGCTTTGCCTCCTGGACAGGATCGACTTGCAGTGAAACCAGGCTCTTGGCAGACTTCTGCCGGTCGCTATGTTACTGCAAAAGTGTGGCGTGCTGTGGGTCTGGTCGGCGAAAGGCAAGATGCTGTTCCTGGAGTGGCGAGTGCAGGAGATGGCGAGGCAAGAATTCTCCAGGAAGAAACGGATACTTTAGATGGAAATGGAGCTGATGGGTTGCTGGTCAAGAAAGATGCAGAGATGCAAAGCCGTGATGATGACGCCTCTGTTGTTTTGGACTCCAATTCTGTGGAGTACAGTGGTGACCAGGCTTTTCACACTAGTACGCAGATTACATCCAGGCCTGTGGATTCTGAGGCAGATGTTCCCTCGAACGGAGCTACACAGAGCTCATTTGTTCCAGTGACTGAAGATGGTGCAGATACTGCAGCCCTGGTTTCGGATCTCTGTTCTTTATCTGTTTTCTTGGAAGTCGCGGAAAGGTTTTTGAGTGAAAGATGGAGAGTAGCAATTGCTCAAGCATCTCCGGATGAATATGTGGACTATTCGGCGGAAGGAATATCAAAAGTAGCTGAAGTCTGCAATATGACGGAAATGTTATCACAACAGCTGTCTGGTAAGGGCATGAGGCACCATTCAGGTGCAGACCCTTTGCCTTGTTCATCTTCCTCTGTTGTGACTCAGTCGTTGGGGAAGACTGCCCATGATGGGGGCGTGTTTTTGTCCAGGATCTTCAACGACTCTGATCAAACTGGTATGGAAGATGTAAGTCATCAAACGACACATGATGATCAACGGCTGGATGGAGCAGGTTCCCAGGAGTGCCGTATGCCTCAAGTGCTTTCATCAGAGGAGGATTCCGGAATGAGGGATTCACTGTCCTCTCCTATTGATTGTGAGCAGTTTATCAGTGGGACTGAGAACTTTAGAAGTTACATTGGGTCTGCGGCTCAGGTGGGAAGGGTACATGGATCCGAGAGACATTCTGAATCAAGAGGAGGTGGAGGGGGGAGTTTAGGTTATTCGCATGCAAGGCACTCAAGTAGTAGGCAAGAAAGATGGTATCGAAATCCCCGGGACAGGTTTCCAGAACAAAGATACATGCCTCGCAGGCGGGCTCCAGTGGAGAAGAATTGCTGA

Protein

>Mapoly0003s0245.1
MQSDDENVTVGQKHSCKVAIRDLEAGLYIDNISYMDEEEKLDVDICKDENNPDHVEATHEDKEVLLNAENKPGVDLLEKEAEVHGLRKRRVAKVDTVRSVVTGDSAFGRMPEEERRGAAIANRMKDVPFESGPETKQKPLDKKTGKQAKGSVKPAGRRGSDGPPLEDFRVKEDAETNRKVHESLDNFIRQTIRCEPYMTFSGRPGDKPLQRLRSDVFENHVGGKFGRGFKVEGGSDARDIIAEDNISTDGLTSDVDGLKETPLSGSKGIGGLGRGPQHSLKVPPGVVAFTQAAAKGTDLPGWPLSSPSKMTLTKCDKCSREFCSSLNYRRHVRVHRKTLTEKKDLSKERSKVAEFWDKLTPEQASVIVNYENMEIEDLSGNSLLKALAGFIQQPGMPSMPSGLMKAGSALLDIVQNKPSVYPLPSERLLSILDDASEKTFLTGGASGTYPRVVFNGDAGKVGLEEKNLVASMGFHVELRLVKAWMADKEAEALRNQQALFKEEEAAQQKRAKLLEKRRMKKIRQKERKVTASQLVQELENESLDDEGNIPGVEEDDSPTATGSSVSSLVSAHDLAMPGTSDLDMNEDIGQVEGRDEQPGLAGEPVIERNKVREEDTVQLPKDISSPGGIGKSMFYNPEDSSDSFVSVSRKGDYHSFDHTVKDKEILSRNLEEAVQDIDRDSRMAQQVTYNRSGRPADVQTGLHSRKGDQERITSDFRRRESDRSVVERKPLRISRDRTRIEYPEVFQKPGRDTKGYDTRYVDGPSQSTFKPVRKANSFALKSDSGTSDLAVLSRTQQYRSKPPGMHRTTHTPIAGNGQVVWTRKVSQPAVVELCKDRKEEVIQDDKLANNSLTCHEWELQIELTDAVELASESTGAPEVVKPDREDTETKEATTTSAILDVKPGNELKAGGLAEDTTFVFGQKELDNDDDTMYSGALLVGSLSVPIGKFATEKFGQSRNYRAFRSASDLLPDLALSPAPDGEGNDLGVRPQPSVQPDDASLCIPRLKLTVPESSDGPSENVGSDLPVPVVRPNLGFDQGLKLKPQSPTSIPDRAESGRPLALPPGQDRLAVKPGSWQTSAGRYVTAKVWRAVGLVGERQDAVPGVASAGDGEARILQEETDTLDGNGADGLLVKKDAEMQSRDDDASVVLDSNSVEYSGDQAFHTSTQITSRPVDSEADVPSNGATQSSFVPVTEDGADTAALVSDLCSLSVFLEVAERFLSERWRVAIAQASPDEYVDYSAEGISKVAEVCNMTEMLSQQLSGKGMRHHSGADPLPCSSSSVVTQSLGKTAHDGGVFLSRIFNDSDQTGMEDVSHQTTHDDQRLDGAGSQECRMPQVLSSEEDSGMRDSLSSPIDCEQFISGTENFRSYIGSAAQVGRVHGSERHSESRGGGGGSLGYSHARHSSSRQERWYRNPRDRFPEQRYMPRRRAPVEKNC

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>