Mapoly0004s0169



Description

SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 [EC:3.6.4.-]

Reference DB

Database ID Description
EC 3.6.4.- Acting on acid anhydrides; involved in cellular and subcellular movement.
GO GO:0003676 Nucleic acid binding
GO GO:0003677 DNA binding
GO GO:0005524 ATP binding
GO GO:0005634 Nucleus
GO GO:0006338 Chromatin remodeling
GO GO:0016818 Hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides
GO GO:0031491 Nucleosome binding
GO GO:0043044 ATP-dependent chromatin remodeling
KEGGORTH K11654
KOG KOG0385 Chromatin remodeling complex WSTF-ISWI, small subunit
OrthoMCL OG5_127117
PFAM PF00176 SNF2 family N-terminal domain
PFAM PF00271 Helicase conserved C-terminal domain
PFAM PF09110 HAND
PFAM PF09111 SLIDE
PANTHER PTHR10799 SWI/SNF-RELATED MATRIX-ASSOCIATED ACTIN-DEPENDENT REGULATOR OF CHROMATIN SUBFAMILY-RELATED
PANTHER PTHR10799:SF73 ISWI CHROMATIN-REMODELING COMPLEX ATPASE ISW1

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB1 transcription factor, MYB Mapoly0004s0169.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0004s0169.1 scaffold_4:1865034..1879073  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0004s0169.1  

Gene structure:

mRNA scaffold_4:1865034..1879073  ( - strand )
three_prime_UTR scaffold_4:1865034..1865394  ( - strand )
CDS scaffold_4:1865395..1865418  ( - strand )
CDS scaffold_4:1865639..1865752  ( - strand )
CDS scaffold_4:1866153..1866371  ( - strand )
CDS scaffold_4:1866520..1866698  ( - strand )
CDS scaffold_4:1866997..1867162  ( - strand )
CDS scaffold_4:1867438..1867502  ( - strand )
CDS scaffold_4:1867644..1867692  ( - strand )
CDS scaffold_4:1867941..1868010  ( - strand )
CDS scaffold_4:1868220..1868309  ( - strand )
CDS scaffold_4:1868718..1868794  ( - strand )
CDS scaffold_4:1868981..1869018  ( - strand )
CDS scaffold_4:1869191..1869379  ( - strand )
CDS scaffold_4:1869486..1869579  ( - strand )
CDS scaffold_4:1869712..1869799  ( - strand )
CDS scaffold_4:1870112..1870332  ( - strand )
CDS scaffold_4:1870507..1870580  ( - strand )
CDS scaffold_4:1870982..1871264  ( - strand )
CDS scaffold_4:1871503..1871637  ( - strand )
CDS scaffold_4:1872630..1872851  ( - strand )
CDS scaffold_4:1873056..1873235  ( - strand )
CDS scaffold_4:1873355..1873452  ( - strand )
CDS scaffold_4:1876019..1876131  ( - strand )
CDS scaffold_4:1876353..1876468  ( - strand )
CDS scaffold_4:1876635..1876766  ( - strand )
CDS scaffold_4:1877746..1878177  ( - strand )
five_prime_UTR scaffold_4:1878178..1878285  ( - strand )
five_prime_UTR scaffold_4:1878477..1879073  ( - strand )

Sequences:

Gene

>Mapoly0004s0169.1
CCAGAATTCCCCGCCATCGGGCGGCGGACGAGAGGCAGAACTACCGACGCGCTCCCGTCTCTTGTGACTTGGAAAACGGCCCGAAAGTACGGACTGCTCTTTGCTCGCTCTTTTGCATGGGAGTCCGAGTTCTGTGCACATTTGGAATCTGCAGTAGCGACTCCTGAATCGATCCCGTCTCGGTTTCAGATGTCGTACAGCCTTTGCCCACTGTACGTGGTAATCGCGAGCTCGGGCTTGGGCGGGCAGCCGGCGCGTTCAGACATTTCGAAGGCATTTCGAAAAAGCCCCCAGGGCCTGTGAGCGCAGCAGCAGCAAGTGTGGACGCATTCTTCTGCAGATGATGGTCCTTTTTCTTGGAGGTCATTGTTCGGAGATTCAAAGCCATGTGCCAGCGTGAGGTAGGCAGAATACTTTCCGTAGACGCATACCATCGGTAAACCCTATTCAATTCAGTGCGGGAGACGTATCTGTCCTTCAGGTCTGTTGCTTTGTGTGTGTCTGCTCGGCTAGCTGCTGAACGTGTGCAGCTTGTAGACGTCGGAATGTCCTGCAAGAAATACTTTCGGAGGTGGTGAGGCGGAATTTTCGTCCGAAGTAGGCCGTCTGTTTATCCTTTTTGTTCGTGTTTGGGGGAGTTTTCAGAGGCCTGTTGCAGCTTTTGGATTTCGAGATTTTCAATATACATTTTGCTTACTCTTCTAGGTTCTCGAATTTTGGAAAACTTTGTTTTTGAAGGATATGACAACTGCTGAGTGTTGACACTCAAGTTGCGCAATTGTTTCCAGCGGATGAGCAATTTGTCGGGCCAATTGCTTCGGAGCCCGAGGACGCTGTCTCTATTTTAGAAGGTACAGACTCTTGGCGCATTTGGTAAAGGGATTGTCGTGAGTAGAATGGCTCCGCAGCGTCCTCTTTCCGATTCTGAGGAAGAGGATGAGCAGATGTCAGACGAGCATGAAGCGGGCCGAGCAGAAGCCGACGAGGAAATGGAGGAGGAAGTAGAAGGTGAAGGGGATGGAGAGGGAGAAGGCGAAGAGGAGGAGGAGGAGGAGGAGGATGAGCAAGATCAACAGGATGGAGAAGAACAGGAAATAGGTGAGCAAGAAGGAGAAGGAGAAGGAGAGGCAGAAGGAGATGAACAGGAAGGTGATGAGCAGGAAGGGGACGAAGAAGACCCAGAGGAAATGGCAGCTATTGAAGAGGCTGCTGCACCAGAGGAGGTGGAAACTGAGGTAGCTGCTGCATCGCCGGCAACACCACGAGACGAGGAAGAAAATCATGAAGAAGATGATTCTGAAGACGCTGAAACAGATGATGATAATGAGGTGATTATTCAACGTTGTAACCCCCATTGGATTCGTGATTGAGGTTTCCGACTCTAACTCTTGCATTAAGGTCTCATTTCCACGCATTTTCCTCGAGTGAGCCGTTAAGTTGTCTCCATTGGGAAGTCCATTCTTTTTCTTTTCTTCCAGAAATATTCGTAACTCCTGTTCTCAGTACAGTTTCAAGTCATGATTGAGAGAACGGTTGGTTTTAGGGTTGGTTTTACTTCTAAATCTCAGTAATGACCAAAGGTAGGACTATGACATCGAGTGAAGAACCCAGGTCTTTGCAACGGCCGCTGTTGATTCGCCACTCAAACTTGGAGGCTCACCTGGGGCTTCCGAGACTTATAAATGTATCTGCTCAGGATTCGAAAAGCATGTTGTAGGTCCAGGACTCGATCATCTTGAAATGAATTGGAAGTTAACATGCAGCAGTTTGGATTCCGATTACAAGTTTTTTGACCGATCTACAATTTGGAGTCACAATTATGCCTCTTTCGAGTTCCTTGACCAGTTCGATCTCACCCTCCCGCAAAGTAACATTTTGTCAGAGGATTGGACACTCGACTATTGTAGGAGTGTTCCATTCACCTCGCTCCGATTTTTTCTTTTCTTCATGGGAGAAGTGTCCTTCGAGGGTCTCTTGAGCTCAAAGGATATTGATGTGCACGCAGAGAGGTGTCTTGAGAGGATCCTAACAGGTCCTTGAATCAACCTTGAGTTGCGAACGCTAGATGCCAGCAGATACAAAGTTACCTGGAAGCGTGAAGATATGGAATGGAACCTTTGAGAAGAGAAGAATGGTACAAGTGGATGGGACTTTAAGTTAGCAAGGCATATGACATATGAGTTCTGACAGAGTTGAAAGCAGAAGGTCTCTCAACCCACTGAATATATTCACAATTGCATCTAAAGGAACTTATGTCTCAAAGATAGCAGTCCGAAAAATACCTAACTGGAGTGTTTACACCTGTAGGGCTTGAGGTCTCCTTCCAAAGTTGACATCGCCCGTCGGGAAAAGCAGAGATTGCGAGAGTTGAAGAAGCGAAAGAGGGACGAGCTTGACAAGTTCTTGAACCAGCAAAACGCCATGGTGGATGCTGACATGGTACGTTCGCCCCACTAGATGTTGTGTTAAATGGTGAATTTGGACTGGATTGGAAGTGTACGTCGCCGGAGCTGATTAACAGACGTGAGAGAGAGAATACAGAGTGTTGTTATTCTTTTTGTCGTTTTAACGGGGATCGTCGTTCAATTTTTTTCTGTGCCTCCAGAATAGCAAGGCCCGTGGAAGGTTAAAGTTTCTTTTGCAGCAAACAGAAATTTTTGCGCATTTCGCACAGGGTCCCACAGGTGTACCTGGTGCACCAAGTCGGAAGGGTAAAGGCCGGTAAGTGATACGATGATTGAGGCTTAAAATACCGGATAAGATCGACTCGTGCACTTTCTCCTTGAATCTGTTGTCGTGTAGCATGATTGCGGTCTAGTAAGCACGCATGTCAAAGAGGTTGTTGGAATTGTGCCATCATGAAGAGATGAACACATGGTTCAATAGCACAATCTCATCTTGTAAATATGTAATGTACCCCCATTGTTGTGATTTGTATTCAGGGGGAGACACAGTTCCAAGTTAACTGAAGAAGAGGAGGATGAAGAATATCTGAAAGAAGAAGAAGATGCTCTTGGTGGCACGGGCGGTACAAGGCTACTCGCACAACCCACTTGTAAGTGATCCGTTTCATTGCGCCCACATTTACTCTAAATTAATTGCGACATGTACCTAGACACGTCTCTTGATTGAGTTGGGCAAATTATTTCCAATGGTATTGCCAAAGGTTGACGTTTTGAGTTTTCAGAATACCGTCTAGTAGAGGGTTCAGGTTCATTTGCATCAGATGAAGGAGAAGTTGTGTGTGGAACTTCGATACAACCAAATGGTGTTAGGAAACAAAACACCTTTTACTTCTCGTTGTCCTTCATACTTCTCAACTTCTATCTTGTTGACGTTGAAGCAGTATGTTATGCCAATACCATCCAACAGTCGATGCTGGATAATCCACAGCCGGAAGCCTTGTGCTGATTGTTATGACATTCACAACAGCATGTCTAGTAGGAATAAGGTCAGTGCTAAGAGGTCAGAGAACTGAAGTACGATGCATGTAGATTGGAGACTGAACAAATAACGGACAATAGAATATGGAAGGGGTCACATCATACCAAAATGAAGGATTCGAAGTAAATATTAAACCTCTCATCAACCACTCAACCGCTCCTGTACCGAGCGGAATCTTCAAGCATCGTCTTCAGGTTTATCTGGTTCTGGACGCGCCTAATTCAAGGGTATGCTTGAAGTGCAATTTTCGTATCGAAAGCACAACCGGAATTCTAATTTGTTTACCACGAGGAGAGTTAAACGGCAAAATATCCCGGGAATTGCATGCTGGGTGACAAGGAGGACGAATCTTCGTTTGAACCTATAATGGCATGCAGCTCTTCGCTAAATATGAAAGGTGCTTCTTTCTTGTTATTTGGTGAAGACCAAGAAATGTACCAAATTTGCTGAACTCGATCCATATCCAACATACATGGATCGTAATACATACGGGGTTTGCTGTAACTCCCAACTGAACGACTTGTAACGCTATCTGCTTGATAGCTGGTTGCGGATAGTCTTCAGCGTTTCGGCATCCGCTTTTACGAAAACAATTTCTCTAAAGGAAAGTTATTTCTTCTGGGACACCCAACTGTGGGCACAAGCCCAACGGCACGTTACTTCAAGGGCTACAGGGGTAATTCATTTTACGCCCGGCTATCTAGCACTCAGGAGGCCCTCTTTTGCTCTGCTTATGAATTATTTGTCACTGACCTCCACCGTGATTTTTCCGTCCAGGGCCTTTGATGTTATTGTTCCGTAACAAGCTAGCCCTCCGCTGTACAAGTTTAACAGTAGCTTCGGCAATAGCTGTGGAGATTCTCCTACTGTGGTTAGGGTTATACTCAACCCCGACACGTCCAGTGCCAATACCCAACCGTGTAATGTCCGTCATGGAGATTTTGTTTATGGTCGTTCCTCGCACCGAATACGAAGAAGTGTACCGCACTCTCCTAAAGTAACTTTGCAGTCGTATTTTCCAAATTCAATTTCCTATAATAACATGTTGAATGTAATTTCCTGGATGGCAATTGCCTTTCCCCGTGTTACGGGACTCGCATGCAAATTTCTGGCCTTGGTAATTTTATTGATAGTGTCCATGGTTCCTTGGTACTCTGTTGGCAATCGCCATCGAAGTTTTCTACGCTTGTTGGGCTTGGAGTTTCTAGTGAGCCCTGCGCGGTCCAGTGCCGCAACCTATGCATCTTGGTATGGACTAATGCAACAGCCGAGTGTATGTGATGGGAGCTGCATAACTCCAATTCCAGTATTGTTGATGGTCATTATAGCCCATTCTTGGACCGGAGGGACTCTTTAAAGTGCTCACTCAGCTTTCCAGCAATGTGATATGGACAGGACTAATTGCACTAGCTTCCATAGTGCACTGTTGTCCCATTCCTTGTTTTTACCTGAATTTTTGCATTCAAATGTTTTGATTCAACTGCCATACCGAAAATACCAGTTGAATCAGTTCATTCGTCTTGGTTTGCTCGTCCTTGTGGTCCAAGTCTTCATGCTTCTTCTGGTCTGATACAATGGCACCCTTGAGCGTTGCAGCCCAAACTCGATATACGTTGATCCCCTTGTATGCTAGGTCCTCACGGATGATCGTGTACTAAGTTACGTATGAGTTTTGTCGATTAAAGTTGGCCTTTCTGCTAGAGAATGCTGTGCCGTGTATGCTTTGGCATGGCTTTTCGTAATTGCTTCATCAGCTCCTGATCTAGCCATATCTGAGCGGCGGTTGTGATTCTTGGATGAGGTACCAAGAATCCGAACGTGGTTAAGTTTCCTCGTATCTGATGTTTTGTTCTAAATGATAGCTTGGAAGATCAAACTAACCTCCCCGTCGGTGAAAACTTTCACATAGAGAGAAACCTATACCCTATCTAGTTGTGTCTGATACGGATCATTTACAAACTGGAACGAATCCCACTTTCAACCAAGGCGCGGGGTCTGTGGTCTTTACTCCATAACAAATCGACATTTACCCATCGTACAATCAATCGTACAACGCACTCAGCCTGACCAGTATAATTTTGCTAACACTGAAACAGAGGTGTACACAACTGGTGGAAGAATGGAAGATCATGGACTGGATTAGGCGCTGAAATTATGTATCGTCCCTGTGTTTTTAGGTATTGTGGGAAAGATGCGAGATTATCAGTTGGCGGGTCTGAACTGGTTGATTCGGCTGTACGAAAATGGGATAAACGGAATTCTTGCAGATGAAATGGTGTGCATATTTTTTCCCACTTTCATCGCTCTGTCATTGACTAATGCTTTTCAGTGAAAGTTATTCGATGTGTCCAATTCAAGTTGTAATAAAAAAAAGATTGAACCCCTGTCTTTCAGGGTTTGGGGAAGACGCTGCAGACAATATCTCTTCTCGCATATCTTCACGAGTTTAAAGGGATTTCAGGTCCACACATGGTGGTGGCACCGAAGTCAACTTTGAGTAACTGGATGAACGAAATTCGGAGATTTTGTCCTATTCTTCGAGCAATGAAGTTCCATGGTAACCAGGAAGAGAGGGTAAGCAGTGACTTCTGTATGGACCTATTTGCGGGCAATGCTTCATTTCATTTCATTGTGTTTTAGTACGCATCCGTGTACGATGTACATGATATTGTGGGAATGCTGTACACAACGGAATGTGTGTATTCTTAGGCTAGCCCTGTCGAAGGTGGAATTAACTTCGTCCTTAATTTGGGTGTTTTATTTGCCATTCACTCGCAGGCTAACCAGCGGGACAATCTGCTGGTCGCGGGAAAATTTGACATTTGCGTCACCAGTTTTGAGATGGCAATCAAAGAGAGAACAGCTTTGAGAAAATTCAGCTGGCGATATATCATCATTGATGAAGCTCATCGTATCAAGAATGAGAATTCCATTTTGGCCAAAACAATGAGGCTATTCAACACAAATTATCGACTTCTTATTACTGGAACTCCTCTCCAGGTGAAGGGTTTGATTCATCTTCCTCCTATAACAGTAGTGAATTTATAGCTGACTGTTCTGCGTCAAATTCTGTCGGTCCGTGGGCAAGCCGTAGACACTGCTTTTTTTGTTGGGCCTCGAGTTACACTCAGCCGCGCTGTCCAGTTTGCCTGTTATGTCATATATGCAGCTGGAACTCGTTCTCTTACTGACTGTTTCACGTTCTTCCATTTGTACGTCTATATTCCCATGCATGTTCACTTATAATCACTCCCTACCTATTTATAAATTGCTGGATATCATCAATCTACTCAGAACTATCCCTGTAAGGATGTCCCACCCTGGTCCGCACCAGTTTGGTCCACTTGCATCGTATGCCCTTGCTGTTGATCGTTTAAAGCGTTAGTTATTGTCAGTCTCTCATTACGGTTGTTTCTAAGAAACAAGTATCTTGGATCGGCTCTTGTTTACAACCTGAACTCATTGCATATTAGGTAAATCATTGGGAGTTGGTATTGTACCACAAATATTTTCTACATATGGTTCCAAAGATCATTCGTACTTCCTTTTTTTGTATCATTCACCTCTCTACCGCCGTGTCTCGGGACGGTGATTAAAGAAATCATCCTCTACCAATTTTTTTTTCTACTATGAGCTTTTTCTGCATTTTTTTTGGAACGAAAGGGAGTCCGTAAGCATTGTTACTTGTCATTTCTATTACATGGATATTATCAACTGTGCCTCAGTTGTTTACATAGTCCGATTCAAGAAACTCTTGGTTCATACTTCACTTCTGCCACTGAACGTACGATCTAGTTCGTCTCGGCCGTTATTAGTTTTCACCCTAATTTGTTGCCTTTTCTGTTGTCCTTGGCATAGAACGTATGAGGTGCAGAGCTTTTCCACGCAGTGGGCTTTGTAAAGATATGTTGTTGCCGTTTTTTCCTGCCCCTCTTTCTTACACATTTTCTTCTGCTTCAGTCTGATTGACTGGGTCTGTGGACTTTTTGCAGAATAATTTGCATGAACTCTGGGCCCTTCTCAATTTTTTGCTCCCTGAGATATTCAGCTCAGCAGAAGCCTTCGATGAATGGTTTCAAATTTCTGGTGAAAATGACCAGCAGGAGGTTGTGCAGCAGCTACACAAGGTAATGCTTTCACAAGGTATCATTTTAAGGTTTGAGCCATCAAATGTCTGAATTGGTCTTAAGTTTGTTCACTTAAGTGAACGTGAGAGATATTCTATTTTCAAATTCGGCTTGGTTGTCTTCCTAACTCTTGTCAAAGTACGTTTCTCTACGAATGTGGAGAGCCCGCATGTGGAAGAAAGTCGTGTTGAACGATTGATATTAATACAATACCTTCGGGGAACTCCTGTTGTTGTAGGTTCTACGACCATTTTTGTTGCGTCGGCTCAAGTCGGACGTGGAACGTGGGTTGCCTCCAAAGAAGGAGACAATTTTGAAGGTCGGAATGTCTCAAATGCAGAAGACGTACTACCGTGCCCTCTTGCAGAAAGACATAGATGCAGTGAACACTGGTGGCGAGCGCAAGCGACTTCTCAATATAGCTATGCAGCTTCGTAAATGCTGCAACCATCCTTACCTTTTTCAAGGAGCCGAGCCGGGGCCACCGTATACCACTGGCGATCATCTTGTCGAGAATGCAGGTGGGACTCTGAGCTCACATGTTTTCTTTAGTGCAATATTACCATTCCCTTACCTTGGTACCGCGGGCATTTGGGAATTTCTCTTACGTGGTTTGGTCATAGGAGAAGTGCTGTAGATTTAAGAGTTTGCTTTCACATGTCAGCCCTCTTATATCGCGGAAGCAGATGACGATCGGTCTGTTTAATTTCTGTGGTATGTGTAGCCGCTCAAAACCATATATATATTTTAACAATTTATATGATTGCAGTCTGCCTAAAACATCATAAGTACACGATCCTCATGAATCTCTTCAGGTTTAAGCCTTCGTAGTCGCAGACATGCTGGTATGTTGATATTTCAAACAGGCGGGAGGCGTGGTTTCATTTCTTAGACCTAAAATGTTTTTCCCACCATTTTGTAGGCAAGATGGTTCTGCTGGACAAGCTCTTACCAAAGCTGAAATTTCGTGATTCTCGAGTACTTATATTTTCACAGGTGAATTTCTTTGATTTTACTGGAAGAACCTTGGTTTCTTTGAGTTTTTGTGGAGAGATATGTTTTATTTGTGACGTAAATCCTACTAGTGTCTGGCTGGTTCATGACATTTGTTAAGATGGCAATTGAAAATGTGAAACAAATTACTTCTGACCTACTGATCTTGTCGCTCAGATGACAAGGCTTCTCGATATTCTCGAAGACTACTGTCAGTATCGTGGGTATTTGTACTGTCGGATTGATGGTAACACAACTGGAGAAGACCGGGAGAGTGCTATTGACTCTTTCAATGTTGAAAATAGCGAAAAGTTCATTTTCTTGCTCTCTACAAGAGCTGGTGGATTGGGTATCAATCTCGCTACGGCTGATACAGTTATTTTGTACGACAGTGATTGGTATGTTCTCGAACTGGAACTGGATATGGTTACTTCATCCAATGTTTCGGCACAAAGTAATCTCATTCTCAGCAAAGCACCTAGTATAGTGTCTATGGTTTAGGATGTAATATTCTGCTCTCCGAGCACTACAAGCCCCGGAGGGGCTGTCAATATCTCTGCTAAGGTGATGTATCCACGTTACCAATGCATCGTTTCTGCATGACCTGCATCGTCATCGTTCAACCATATCCTATACTCTCATTATACGGACGAAGTCAATTCTAAAGTTGTTTAACCTAAAACCTGTGCTCTAATGCTGTTTTGTTGCAGGAATCCGCAAGTTGATTTACAGGCCCAGGATCGTGCTCATCGTATTGGACAGAAGAAGGAAGTACAAGTTTTTCGGTTTTGTACCGAGGTAAGTGTCTTACGATCTTTGTAGCGAGAATTTTTTGTGAGGCATTTCTGTTACTCTCCCACTGTTCAGTGGCAGTATGCCTATTACCATGATTTGCTTCCTGCCTGAGTGTTTCATCTGTGATACTGTCAGTTTACCATCGAGGAAAAAGTTATAGAGAGAGCATACAAGAAACTTGCGCTGGATGCCCTCGTCATCCAGCAAGGCCGGCTTGCAGAGCAGAAAGGTAGGTTCTCCCGTCATTTTCTCATATTTCGCTAGGTACTGCAGAGGCTTTTTCTGAGTTTCTATGTAGAATTGTTTCTTATGTCTGACGGGAGGTTGGATTGCAGCGGTAAATAAGGATGAACTGCTTCAGATGGTTCGATTTGGAGCTGAGAAGGTCTTTAGCTCCAAGGACAGTACCATCACAGACGAGGATATTGACCGCATCATTGCGAAGGGAGAGGAAGCCACGGCTGAGTTGGATGCGAAAATGAAGAAATTTACTGAAGATGCCATCAAGTTCAAGATGGATGATAGTAAGAATTTTTGTTTGCTCGGGCGGATATTTTCCTCACTTTTTAACGCACGATGCTTGATTGTTCGTGACTTCTGTTTTGAGTAGAACGAAACGACTCTAATTGTTGTAAGTACTTTTTTTTTTCCCATGATACCATTCTCCTTGACGGAAAATCGTAACTGTTTTTACAGCCGCAGGCCTCTACGATTTCGATGACAAAGATGATAAGGTGCATTTCACCAGCCATTCTGTACATAGTTAAAAATATTTTCTATTCACATCTAACTACAAGTACAAGTGTTGGTTTTGAGGTATCTCATCTGGATTTTTTTTTTGTACAGACGTAACCAGGATATAATTGAGCACCTGTCGCATAATTTAACCACCTGTTGACATCCTTTTGTGGAACTTGTAGGATGAGGGCAAGGTGGACTTGAAGAGAATGATTGCTGAGAACTGGATAGAGCCACCCAGGCGTGAACGTAAACGAAAGTAGGTTACACAGATATCCTGCCATGTTTTGGTCTACTCGATCGTCTAGCAATTCGAAACGAGAACTGATTCGTCAGTTAAAAAGTTCTATTGTTCATTACGATATCATGGTTTTCAATTTGTTGATCGCTTTCACTATATCAGTTCAATGCCTAGAAAACTCTCGTCTCATTCACTCAGTTGTTTTCTTTTAGCTTAAGAAACTCCGATTTGCTGTTCTCCAATATATCGGACTTTGCCACCAACTGCTCTATCCTCGAAGAAGATTTTCGTGCATTTTAGTTCGTGGCACCAGTTGGCATGGCTGTGGCCCTATGAGTAGCTCAGTGCCGAGGACTTTTATTATGCGATCCTACGCCTGTTCATAAATTCTACTGTTTAATTCTCTCTTCATATTTCTCTGCACAGCTACTCGGAAACAGAGTACTTCAAGCAAGCGATGCGCGCAGGAACTGTTACTAAACCAAGGGAGCCTCGAATTCCCCGAATGCCTCAACTGTATCCTTATTTTTCTCAAAATTTGAAAGTTTTTGTGTGTTGGAAATTTAGTTTAGGAACGTAACACAAAAGGGAACGAAGTTAATACAAGCGTTATCAAAGCGTCCAACATGTGACATTTCTGCCAAATCTATACAAGTTTCAAATGACAGTTTGAGTATTTTTTCCTTTTTTGTTTGCAAGTGACTATCCTTAACGAAGAAAAACAGGCATGATTTCCAATTTTTCAACAACACTCGTCTGACTGAACTCTATGAGAAGGAAGTGAGATCTCTTCTGGTAAGTTTTCTAATTTAGAGTCTCAAGTATTTTCACTTGCGTGTCAATCATGGTCGTCGAAGACCGTGGACACTTCTGTCACTCATTGAATGTTTTAAGATTATAGCGACCTCTGTTCAAATTTATTTATGTCACATACTTCTCCTGGATCGCAGGGCTTTTGATCTTATATGTCAGATGTTACCGGCTGATCATATGTTAGTTCAGTTCTGTAACTCTGAAATTTGTTGCTTGTGTGTGGTGAACAGCAAGCTCATCAAAGGTCGGTCGGAGAAGATGTAATTGCCATTGATGCCGGTGAGTTGCAGTGCTTAACCTGGCCTTTTCTTTTAACATCTGATATATAGGACTACTATGTACGTTCATGTTTGGACTTTTTTAGTCTGCAGCTTTTCCCGCCCGTCTGGATTGTGATTAAAGCATGTCACATGCTTGCAGACACTGCTGTAGCGGAACAACTAACTGAGAAGGAGCAGGAAGAGAAGGATCGTCTGCTTGAGGAGGTATGATGCGTATGCGACTGTAGAACTTATTATCATTAAGATAAGTCTTGCTTTATCATGCCTTAGGGTTGAGGGCAGAATGTCCTCTTCCTGGATGGATAAGAACAGAGGATTTAAATGATTGTATATGTCATTATCGTAAAGTCCTCCGTAGCATTTTTGTTTTACAGACGAGTGCTGGTTATGCTTTACTACTTTGTTCAAAGAATTTGTTTTGCTCATGGAGGGTTAATGCACTCGCCCATTAACCACGTACTTTTTCTCCTTCAAAACAGGGCTTTTCCAACTGGACACGTCGTGACTTCAATGCGTTTGTTCGAGCTTGTGAGAAATATGGGCGCAATGACATCAGAAGTATAGCAAGCGAGATCGAAGGAAAGAGTGAAGACGATATCAGCAGATACTCAAAGATATTTTGGGAAAGATACAAGGATTTGAATGGTACGTTGGCTTTTGCTGGTTTCAGTAAACCGATTCAGCGCTCAGAATCATGTCTATATTTGACACTGAATGACATAATTACAACTAAGGATTTTTACCTTTAACTTACATGTTCATTGTGATGTTAGCACCGAAGTCTAGACGAATTAGCCTTGACCCATGGATTTAATCTCCCTGGTCATCTGTCGAAGTCAACAGTGACTGGTCCAATCGACTGTGAAGTTCTTCATTGAGTTCTTTTCCCAAGTTACCTCTATCCTTTGTTTGAGAAACTTGTGTCCATCTCTTCGTTCTCCAGATTATGATCGGATAATCAAGAACATCGAAAGAGGCGAGGCTAGGATCTCGCGGAAGGACGAGATAATGAAGTCCATTGGGAAGAAATTAGATCGATATCGAAATCCATGGCTGGAACTGAAAATCCAGTATGGACAGAACAAAGGGAAGCTGTATAACGAGGAGTGTGACCGCTTTTTGGTATGTTTCCGAATCAGGTTTTGATGTCGATATACATAGAATGGATTCACAACTAGGCATTTATGCATGCGCAAAATTTCATTACCAACGTTGATTGGTGCTTGCTTATATCTCCTAATGAGTTTTTTTTGGTCGTTTTCTTCTACAGCTTTGTATGGTGCACAGACTTGGATATGGTAACTGGGATGAGTTGAAGGCCGCTTTCCGCATGTCACCGTTGTTCAGATTCGATTGGTTTGTAAAATCTAGAACTGCCTCAGAGTTAGCCAGACGATGTGACACTCTGATACGGTTAGTTGAGCGTGAGAACCAAGAGTTGGATGAGAAGGAGCGCCAAGCGCGAAAAGACCAAAAGAAGCTTGCCAAAGTAAGTCGTTTGGGAATCGTATCTCACCCGTCTTAGGTGTTCAGAAATCTCAAGTTGGTTTCAAGTAGTCTCACTTTAAGGTTTGAACGGTACGAGGAGTGTCGATGGGGAAGACATATCATCAACGCTATTGCATACGTAGGAGGAAGAAATAAATACGGCCATCAAGTCCACCGAGCCTAGGGGGACATGGGACAGAGAATGTAAATCTGAAGGAATCGAGAATAAATTGCTGGTTAATACGTCCAGGGAACGTGGTATAGATGTGTAATGTTTCTACCCGAGTGCAATGTGAACTTGATGGGGCTGATAGTGAGAAAAATTTTCAGTAGGATATGCATGAATATTGTGGTATCGAGGTCTTTCTCAGATATCCTGTTTCTCTTTTATCTCGATGTAGAGTAACGCATCACCTGGGAGACGGGCATGGTCTGTTGAGAAGGAGGGCACCAGTGGGTCTGCCCCGAGAAAGGGCAAACAAGCAAGCTTAGAAAGCTTCATGACTGGTTCAGCGGTACGTCATTTTGTCTGTCTTTTCGAAATGTATGTCTTAGGCTTATGATACTGCAGGAGGGACCTCGTTGAATCTTCCTCTCTTACATTCGCTTCTGCTTCTCTCGTTTGATTGAAGTCGATGTTATCATATGTAACTCGTAAGACCTTTAGATCGGAACTCCTCGATGCTGCTATACCTCGTTCTTCTTAGCTTACGGAAAGCCTCGCTGGTTTTGCAGGCAAAGAAACGGTCACGAGGTTAGGTCACGTCTGTCTCCTGCCAGGCATCTGCAGTAGATTGCGATCCACTTGTATCCCAGCTCATCGTGGATCACATCGAGTCACGACGATTGTTTTCTAGTTCGTCACAGTTGGGTGGGTTGTGACAAAGAACACTCCGAAGTTGAACCAGGTTCCCATGTAACCTTCGATGAGCAAACAGTCCACGAGGTGAACAGATCTAAAACAGGTACTAGTGTAGAGCGAAAATTTTCCGAGGCACGTAGTCTTTGTAGATATTAGAGCTAGCACAAGGGTATCTTCTATCCAAGCCCTCAGACTTGAAGGGCTCCTCATTATTTATGTACAATAAAGAGCATTGTCGGAAACTGAACGATATTTTCC

mRNA

>Mapoly0004s0169.1
CCAGAATTCCCCGCCATCGGGCGGCGGACGAGAGGCAGAACTACCGACGCGCTCCCGTCTCTTGTGACTTGGAAAACGGCCCGAAAGTACGGACTGCTCTTTGCTCGCTCTTTTGCATGGGAGTCCGAGTTCTGTGCACATTTGGAATCTGCAGTAGCGACTCCTGAATCGATCCCGTCTCGGTTTCAGATGTCGTACAGCCTTTGCCCACTGTACGTGGTAATCGCGAGCTCGGGCTTGGGCGGGCAGCCGGCGCGTTCAGACATTTCGAAGGCATTTCGAAAAAGCCCCCAGGGCCTGTGAGCGCAGCAGCAGCAAGTGTGGACGCATTCTTCTGCAGATGATGGTCCTTTTTCTTGGAGGTCATTGTTCGGAGATTCAAAGCCATGTGCCAGCGTGAGGTAGGCAGAATACTTTCCGTAGACGCATACCATCGGTAAACCCTATTCAATTCAGTGCGGGAGACGTATCTGTCCTTCAGGTCTGTTGCTTTGTGTGTGTCTGCTCGGCTAGCTGCTGAACGTGTGCAGCTTGTAGACGTCGGAATGTCCTGCAAGAAATACTTTCGGAGGTGGTGAGGCGGAATTTTCGTCCGAACGGATGAGCAATTTGTCGGGCCAATTGCTTCGGAGCCCGAGGACGCTGTCTCTATTTTAGAAGGTACAGACTCTTGGCGCATTTGGTAAAGGGATTGTCGTGAGTAGAATGGCTCCGCAGCGTCCTCTTTCCGATTCTGAGGAAGAGGATGAGCAGATGTCAGACGAGCATGAAGCGGGCCGAGCAGAAGCCGACGAGGAAATGGAGGAGGAAGTAGAAGGTGAAGGGGATGGAGAGGGAGAAGGCGAAGAGGAGGAGGAGGAGGAGGAGGATGAGCAAGATCAACAGGATGGAGAAGAACAGGAAATAGGTGAGCAAGAAGGAGAAGGAGAAGGAGAGGCAGAAGGAGATGAACAGGAAGGTGATGAGCAGGAAGGGGACGAAGAAGACCCAGAGGAAATGGCAGCTATTGAAGAGGCTGCTGCACCAGAGGAGGTGGAAACTGAGGTAGCTGCTGCATCGCCGGCAACACCACGAGACGAGGAAGAAAATCATGAAGAAGATGATTCTGAAGACGCTGAAACAGATGATGATAATGAGGGCTTGAGGTCTCCTTCCAAAGTTGACATCGCCCGTCGGGAAAAGCAGAGATTGCGAGAGTTGAAGAAGCGAAAGAGGGACGAGCTTGACAAGTTCTTGAACCAGCAAAACGCCATGGTGGATGCTGACATGAATAGCAAGGCCCGTGGAAGGTTAAAGTTTCTTTTGCAGCAAACAGAAATTTTTGCGCATTTCGCACAGGGTCCCACAGGTGTACCTGGTGCACCAAGTCGGAAGGGTAAAGGCCGGGGGAGACACAGTTCCAAGTTAACTGAAGAAGAGGAGGATGAAGAATATCTGAAAGAAGAAGAAGATGCTCTTGGTGGCACGGGCGGTACAAGGCTACTCGCACAACCCACTTGTATTGTGGGAAAGATGCGAGATTATCAGTTGGCGGGTCTGAACTGGTTGATTCGGCTGTACGAAAATGGGATAAACGGAATTCTTGCAGATGAAATGGGTTTGGGGAAGACGCTGCAGACAATATCTCTTCTCGCATATCTTCACGAGTTTAAAGGGATTTCAGGTCCACACATGGTGGTGGCACCGAAGTCAACTTTGAGTAACTGGATGAACGAAATTCGGAGATTTTGTCCTATTCTTCGAGCAATGAAGTTCCATGGTAACCAGGAAGAGAGGGCTAACCAGCGGGACAATCTGCTGGTCGCGGGAAAATTTGACATTTGCGTCACCAGTTTTGAGATGGCAATCAAAGAGAGAACAGCTTTGAGAAAATTCAGCTGGCGATATATCATCATTGATGAAGCTCATCGTATCAAGAATGAGAATTCCATTTTGGCCAAAACAATGAGGCTATTCAACACAAATTATCGACTTCTTATTACTGGAACTCCTCTCCAGAATAATTTGCATGAACTCTGGGCCCTTCTCAATTTTTTGCTCCCTGAGATATTCAGCTCAGCAGAAGCCTTCGATGAATGGTTTCAAATTTCTGGTGAAAATGACCAGCAGGAGGTTGTGCAGCAGCTACACAAGGTTCTACGACCATTTTTGTTGCGTCGGCTCAAGTCGGACGTGGAACGTGGGTTGCCTCCAAAGAAGGAGACAATTTTGAAGGTCGGAATGTCTCAAATGCAGAAGACGTACTACCGTGCCCTCTTGCAGAAAGACATAGATGCAGTGAACACTGGTGGCGAGCGCAAGCGACTTCTCAATATAGCTATGCAGCTTCGTAAATGCTGCAACCATCCTTACCTTTTTCAAGGAGCCGAGCCGGGGCCACCGTATACCACTGGCGATCATCTTGTCGAGAATGCAGGCAAGATGGTTCTGCTGGACAAGCTCTTACCAAAGCTGAAATTTCGTGATTCTCGAGTACTTATATTTTCACAGATGACAAGGCTTCTCGATATTCTCGAAGACTACTGTCAGTATCGTGGGTATTTGTACTGTCGGATTGATGGTAACACAACTGGAGAAGACCGGGAGAGTGCTATTGACTCTTTCAATGTTGAAAATAGCGAAAAGTTCATTTTCTTGCTCTCTACAAGAGCTGGTGGATTGGGTATCAATCTCGCTACGGCTGATACAGTTATTTTGTACGACAGTGATTGGAATCCGCAAGTTGATTTACAGGCCCAGGATCGTGCTCATCGTATTGGACAGAAGAAGGAAGTACAAGTTTTTCGGTTTTGTACCGAGTTTACCATCGAGGAAAAAGTTATAGAGAGAGCATACAAGAAACTTGCGCTGGATGCCCTCGTCATCCAGCAAGGCCGGCTTGCAGAGCAGAAAGCGGTAAATAAGGATGAACTGCTTCAGATGGTTCGATTTGGAGCTGAGAAGGTCTTTAGCTCCAAGGACAGTACCATCACAGACGAGGATATTGACCGCATCATTGCGAAGGGAGAGGAAGCCACGGCTGAGTTGGATGCGAAAATGAAGAAATTTACTGAAGATGCCATCAAGTTCAAGATGGATGATACCGCAGGCCTCTACGATTTCGATGACAAAGATGATAAGGATGAGGGCAAGGTGGACTTGAAGAGAATGATTGCTGAGAACTGGATAGAGCCACCCAGGCGTGAACGTAAACGAAACTACTCGGAAACAGAGTACTTCAAGCAAGCGATGCGCGCAGGAACTGTTACTAAACCAAGGGAGCCTCGAATTCCCCGAATGCCTCAACTGCATGATTTCCAATTTTTCAACAACACTCGTCTGACTGAACTCTATGAGAAGGAAGTGAGATCTCTTCTGCAAGCTCATCAAAGGTCGGTCGGAGAAGATGTAATTGCCATTGATGCCGACACTGCTGTAGCGGAACAACTAACTGAGAAGGAGCAGGAAGAGAAGGATCGTCTGCTTGAGGAGGGCTTTTCCAACTGGACACGTCGTGACTTCAATGCGTTTGTTCGAGCTTGTGAGAAATATGGGCGCAATGACATCAGAAGTATAGCAAGCGAGATCGAAGGAAAGAGTGAAGACGATATCAGCAGATACTCAAAGATATTTTGGGAAAGATACAAGGATTTGAATGATTATGATCGGATAATCAAGAACATCGAAAGAGGCGAGGCTAGGATCTCGCGGAAGGACGAGATAATGAAGTCCATTGGGAAGAAATTAGATCGATATCGAAATCCATGGCTGGAACTGAAAATCCAGTATGGACAGAACAAAGGGAAGCTGTATAACGAGGAGTGTGACCGCTTTTTGCTTTGTATGGTGCACAGACTTGGATATGGTAACTGGGATGAGTTGAAGGCCGCTTTCCGCATGTCACCGTTGTTCAGATTCGATTGGTTTGTAAAATCTAGAACTGCCTCAGAGTTAGCCAGACGATGTGACACTCTGATACGGTTAGTTGAGCGTGAGAACCAAGAGTTGGATGAGAAGGAGCGCCAAGCGCGAAAAGACCAAAAGAAGCTTGCCAAAAGTAACGCATCACCTGGGAGACGGGCATGGTCTGTTGAGAAGGAGGGCACCAGTGGGTCTGCCCCGAGAAAGGGCAAACAAGCAAGCTTAGAAAGCTTCATGACTGGTTCAGCGGCAAAGAAACGGTCACGAGGTTAGGTCACGTCTGTCTCCTGCCAGGCATCTGCAGTAGATTGCGATCCACTTGTATCCCAGCTCATCGTGGATCACATCGAGTCACGACGATTGTTTTCTAGTTCGTCACAGTTGGGTGGGTTGTGACAAAGAACACTCCGAAGTTGAACCAGGTTCCCATGTAACCTTCGATGAGCAAACAGTCCACGAGGTGAACAGATCTAAAACAGGTACTAGTGTAGAGCGAAAATTTTCCGAGGCACGTAGTCTTTGTAGATATTAGAGCTAGCACAAGGGTATCTTCTATCCAAGCCCTCAGACTTGAAGGGCTCCTCATTATTTATGTACAATAAAGAGCATTGTCGGAAACTGAACGATATTTTCC

CDS

>Mapoly0004s0169.1
ATGGCTCCGCAGCGTCCTCTTTCCGATTCTGAGGAAGAGGATGAGCAGATGTCAGACGAGCATGAAGCGGGCCGAGCAGAAGCCGACGAGGAAATGGAGGAGGAAGTAGAAGGTGAAGGGGATGGAGAGGGAGAAGGCGAAGAGGAGGAGGAGGAGGAGGAGGATGAGCAAGATCAACAGGATGGAGAAGAACAGGAAATAGGTGAGCAAGAAGGAGAAGGAGAAGGAGAGGCAGAAGGAGATGAACAGGAAGGTGATGAGCAGGAAGGGGACGAAGAAGACCCAGAGGAAATGGCAGCTATTGAAGAGGCTGCTGCACCAGAGGAGGTGGAAACTGAGGTAGCTGCTGCATCGCCGGCAACACCACGAGACGAGGAAGAAAATCATGAAGAAGATGATTCTGAAGACGCTGAAACAGATGATGATAATGAGGGCTTGAGGTCTCCTTCCAAAGTTGACATCGCCCGTCGGGAAAAGCAGAGATTGCGAGAGTTGAAGAAGCGAAAGAGGGACGAGCTTGACAAGTTCTTGAACCAGCAAAACGCCATGGTGGATGCTGACATGAATAGCAAGGCCCGTGGAAGGTTAAAGTTTCTTTTGCAGCAAACAGAAATTTTTGCGCATTTCGCACAGGGTCCCACAGGTGTACCTGGTGCACCAAGTCGGAAGGGTAAAGGCCGGGGGAGACACAGTTCCAAGTTAACTGAAGAAGAGGAGGATGAAGAATATCTGAAAGAAGAAGAAGATGCTCTTGGTGGCACGGGCGGTACAAGGCTACTCGCACAACCCACTTGTATTGTGGGAAAGATGCGAGATTATCAGTTGGCGGGTCTGAACTGGTTGATTCGGCTGTACGAAAATGGGATAAACGGAATTCTTGCAGATGAAATGGGTTTGGGGAAGACGCTGCAGACAATATCTCTTCTCGCATATCTTCACGAGTTTAAAGGGATTTCAGGTCCACACATGGTGGTGGCACCGAAGTCAACTTTGAGTAACTGGATGAACGAAATTCGGAGATTTTGTCCTATTCTTCGAGCAATGAAGTTCCATGGTAACCAGGAAGAGAGGGCTAACCAGCGGGACAATCTGCTGGTCGCGGGAAAATTTGACATTTGCGTCACCAGTTTTGAGATGGCAATCAAAGAGAGAACAGCTTTGAGAAAATTCAGCTGGCGATATATCATCATTGATGAAGCTCATCGTATCAAGAATGAGAATTCCATTTTGGCCAAAACAATGAGGCTATTCAACACAAATTATCGACTTCTTATTACTGGAACTCCTCTCCAGAATAATTTGCATGAACTCTGGGCCCTTCTCAATTTTTTGCTCCCTGAGATATTCAGCTCAGCAGAAGCCTTCGATGAATGGTTTCAAATTTCTGGTGAAAATGACCAGCAGGAGGTTGTGCAGCAGCTACACAAGGTTCTACGACCATTTTTGTTGCGTCGGCTCAAGTCGGACGTGGAACGTGGGTTGCCTCCAAAGAAGGAGACAATTTTGAAGGTCGGAATGTCTCAAATGCAGAAGACGTACTACCGTGCCCTCTTGCAGAAAGACATAGATGCAGTGAACACTGGTGGCGAGCGCAAGCGACTTCTCAATATAGCTATGCAGCTTCGTAAATGCTGCAACCATCCTTACCTTTTTCAAGGAGCCGAGCCGGGGCCACCGTATACCACTGGCGATCATCTTGTCGAGAATGCAGGCAAGATGGTTCTGCTGGACAAGCTCTTACCAAAGCTGAAATTTCGTGATTCTCGAGTACTTATATTTTCACAGATGACAAGGCTTCTCGATATTCTCGAAGACTACTGTCAGTATCGTGGGTATTTGTACTGTCGGATTGATGGTAACACAACTGGAGAAGACCGGGAGAGTGCTATTGACTCTTTCAATGTTGAAAATAGCGAAAAGTTCATTTTCTTGCTCTCTACAAGAGCTGGTGGATTGGGTATCAATCTCGCTACGGCTGATACAGTTATTTTGTACGACAGTGATTGGAATCCGCAAGTTGATTTACAGGCCCAGGATCGTGCTCATCGTATTGGACAGAAGAAGGAAGTACAAGTTTTTCGGTTTTGTACCGAGTTTACCATCGAGGAAAAAGTTATAGAGAGAGCATACAAGAAACTTGCGCTGGATGCCCTCGTCATCCAGCAAGGCCGGCTTGCAGAGCAGAAAGCGGTAAATAAGGATGAACTGCTTCAGATGGTTCGATTTGGAGCTGAGAAGGTCTTTAGCTCCAAGGACAGTACCATCACAGACGAGGATATTGACCGCATCATTGCGAAGGGAGAGGAAGCCACGGCTGAGTTGGATGCGAAAATGAAGAAATTTACTGAAGATGCCATCAAGTTCAAGATGGATGATACCGCAGGCCTCTACGATTTCGATGACAAAGATGATAAGGATGAGGGCAAGGTGGACTTGAAGAGAATGATTGCTGAGAACTGGATAGAGCCACCCAGGCGTGAACGTAAACGAAACTACTCGGAAACAGAGTACTTCAAGCAAGCGATGCGCGCAGGAACTGTTACTAAACCAAGGGAGCCTCGAATTCCCCGAATGCCTCAACTGCATGATTTCCAATTTTTCAACAACACTCGTCTGACTGAACTCTATGAGAAGGAAGTGAGATCTCTTCTGCAAGCTCATCAAAGGTCGGTCGGAGAAGATGTAATTGCCATTGATGCCGACACTGCTGTAGCGGAACAACTAACTGAGAAGGAGCAGGAAGAGAAGGATCGTCTGCTTGAGGAGGGCTTTTCCAACTGGACACGTCGTGACTTCAATGCGTTTGTTCGAGCTTGTGAGAAATATGGGCGCAATGACATCAGAAGTATAGCAAGCGAGATCGAAGGAAAGAGTGAAGACGATATCAGCAGATACTCAAAGATATTTTGGGAAAGATACAAGGATTTGAATGATTATGATCGGATAATCAAGAACATCGAAAGAGGCGAGGCTAGGATCTCGCGGAAGGACGAGATAATGAAGTCCATTGGGAAGAAATTAGATCGATATCGAAATCCATGGCTGGAACTGAAAATCCAGTATGGACAGAACAAAGGGAAGCTGTATAACGAGGAGTGTGACCGCTTTTTGCTTTGTATGGTGCACAGACTTGGATATGGTAACTGGGATGAGTTGAAGGCCGCTTTCCGCATGTCACCGTTGTTCAGATTCGATTGGTTTGTAAAATCTAGAACTGCCTCAGAGTTAGCCAGACGATGTGACACTCTGATACGGTTAGTTGAGCGTGAGAACCAAGAGTTGGATGAGAAGGAGCGCCAAGCGCGAAAAGACCAAAAGAAGCTTGCCAAAAGTAACGCATCACCTGGGAGACGGGCATGGTCTGTTGAGAAGGAGGGCACCAGTGGGTCTGCCCCGAGAAAGGGCAAACAAGCAAGCTTAGAAAGCTTCATGACTGGTTCAGCGGCAAAGAAACGGTCACGAGGTTAG

Protein

>Mapoly0004s0169.1
MAPQRPLSDSEEEDEQMSDEHEAGRAEADEEMEEEVEGEGDGEGEGEEEEEEEEDEQDQQDGEEQEIGEQEGEGEGEAEGDEQEGDEQEGDEEDPEEMAAIEEAAAPEEVETEVAAASPATPRDEEENHEEDDSEDAETDDDNEGLRSPSKVDIARREKQRLRELKKRKRDELDKFLNQQNAMVDADMNSKARGRLKFLLQQTEIFAHFAQGPTGVPGAPSRKGKGRGRHSSKLTEEEEDEEYLKEEEDALGGTGGTRLLAQPTCIVGKMRDYQLAGLNWLIRLYENGINGILADEMGLGKTLQTISLLAYLHEFKGISGPHMVVAPKSTLSNWMNEIRRFCPILRAMKFHGNQEERANQRDNLLVAGKFDICVTSFEMAIKERTALRKFSWRYIIIDEAHRIKNENSILAKTMRLFNTNYRLLITGTPLQNNLHELWALLNFLLPEIFSSAEAFDEWFQISGENDQQEVVQQLHKVLRPFLLRRLKSDVERGLPPKKETILKVGMSQMQKTYYRALLQKDIDAVNTGGERKRLLNIAMQLRKCCNHPYLFQGAEPGPPYTTGDHLVENAGKMVLLDKLLPKLKFRDSRVLIFSQMTRLLDILEDYCQYRGYLYCRIDGNTTGEDRESAIDSFNVENSEKFIFLLSTRAGGLGINLATADTVILYDSDWNPQVDLQAQDRAHRIGQKKEVQVFRFCTEFTIEEKVIERAYKKLALDALVIQQGRLAEQKAVNKDELLQMVRFGAEKVFSSKDSTITDEDIDRIIAKGEEATAELDAKMKKFTEDAIKFKMDDTAGLYDFDDKDDKDEGKVDLKRMIAENWIEPPRRERKRNYSETEYFKQAMRAGTVTKPREPRIPRMPQLHDFQFFNNTRLTELYEKEVRSLLQAHQRSVGEDVIAIDADTAVAEQLTEKEQEEKDRLLEEGFSNWTRRDFNAFVRACEKYGRNDIRSIASEIEGKSEDDISRYSKIFWERYKDLNDYDRIIKNIERGEARISRKDEIMKSIGKKLDRYRNPWLELKIQYGQNKGKLYNEECDRFLLCMVHRLGYGNWDELKAAFRMSPLFRFDWFVKSRTASELARRCDTLIRLVERENQELDEKERQARKDQKKLAKSNASPGRRAWSVEKEGTSGSAPRKGKQASLESFMTGSAAKKRSRG

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>