Mapoly0005s0203



Description

cellular nucleic acid-binding protein

Reference DB

Database ID Description
GO GO:0003676 Nucleic acid binding
GO GO:0003677 DNA binding
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0008270 Zinc ion binding
KEGGORTH K09250 Cellular nucleic acid-binding protein
KOG KOG3070 Predicted RNA-binding protein containing PIN domain and invovled in translation or RNA processing
OrthoMCL OG5_126866
PFAM PF00098 Zinc knuckle
PFAM PF00313 'Cold-shock' DNA-binding domain
PANTHER PTHR11544 COLD SHOCK DOMAIN CONTAINING PROTEINS

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpCSD transcription factor, CSD Mapoly0005s0203.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0005s0203.1 scaffold_5:2168525..2171229  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0005s0203.1  

Gene structure:

mRNA scaffold_5:2168525..2171229  ( + strand )
five_prime_UTR scaffold_5:2168525..2169064  ( + strand )
CDS scaffold_5:2169065..2169640  ( + strand )
three_prime_UTR scaffold_5:2169641..2171229  ( + strand )

Sequences:

Gene

>Mapoly0005s0203.1
CCTTCCCTCCTCTTCTCTTCTTCCCTGCGCCACAACATCGTAGAGCTCCTCTTTTGCCCTCCGCCTGCTGCATTCTGCGGTTCAGTAAGCCACGAGAGAGCCCGAGGGAGAGGAGAAAGGGATAGTAGTGTGGGTGTGGTTGTCCCTGGTGTCGGAGCGAAAGTAGTTTAAGAGGTGTGTTAATGTAAGCAAGCTCTCGCCTAGTGAATAGCGTTGGTGATCTTAAGCAAGCAAGCGAGCTCTAGCCCAAGAGGGTGAGTGGGGACTCAGTGACGTGATTGAGCTTGGAGCCTGAACAACCAGGATTGTCGAGTGAAGTCCGTGGTGTGGTGGAGACTTGCCTACAATACCCTGCACGCGAGCGGGCACGCAGAGGAGACCGAGGCTTCTCCCCTGAGTTGCTGCTGTCGAGACGCGGCATATCCCCGAAAAGGGTTTAAGATAGTGGTCGATCAGAGAGTCTGCGCGCTCTCTGTCGTAGGTCGTGCACGGGCTGGGAGTGATATCGACTGATTGTCGTTCTCTACGTTGAAGTAGGCAATGGCGGACGATTCGCCGGTAGTGAAGAAGACCGGGAAGGTGAAATGGTTCAATAGCAGTAAAGGGTTTGGTTTCATCACCCCTGATGATGGCGGTGAGGACCTCTTTGTCCACCAAACGTCTATCCATGCTGAGGGATTTAGGTCTTTGAGGGAAGGAGAGAGCGTTGAGTTTACTGTCGAAGTAGGAGAAGACAATCGAACCAAAGCTCTGGATGTCACTGGACCCGGAGGAAGTTACGTCCAAGGTGCTCCTCGTCGAGACGGGTATGGAGGTGGAGGAAGAGGAGGTGGTGGTGGAGGTGGTGGTGGTGGAGGAAACTTCAGCGGAGGAATGGGTAGAGGAAGGGGCCGTGGTGGAAGAGGCGGAGGCAACTTCGCCGGAGGAGGCGGTGGTGGAGATCGGACATGTTACAACTGCGGAGAGCCTGGACACATTGCTCGTAACTGTCCCAGTGAACCTGCTGGCAACGGCAGAGCAGGTGGTGGTGGCGGTGATGGCGGTAATCGCAACTGCTACAACTGTGGCGAGTCAGGGCATCTTGCTCGAGATTGCGCTCCGGCTGCAGCTGCCTAGACGGCGATCCACTTTTTTTGATTTGTGGTCTTCTGGGACCTTTGGTAGTTTTCGGTCGCTGGAAGCCTCGCAGTTTAATCGTCGAAGGTTTTGATGATTTCACTCGATGGGTGTAATTCAACTCAAGACCGCAGAAAGATTGCGCATTCTCTTGCTTCCCAATGCTTTCGGCTGTTGTACCTCTGAAGGCAAAGTCCATCCTCTCTTGAGCTTGTGATGGCTGAATGAGGTGATGTTGCTTAAGCTTCTCAGTTGATTCTTTTTGTGGGGGTGTGAAGTGGACGTCTTGAAGGAGAACTTTCGTTTATCGTGGAGAATCCCGCTGTCGTTTTTCTGTGGACGGGCTGTGTGCAAGTTGTGTTGCCCGTTGTTTACTCCACTCTCAACATCGACGAGCGGCGGGTTAGGGGCGTAGGTGAAAGCAGAAAAGGTCGAGGCCGGTAGATGTCGTGGGAAAGAAAGTGTTTAGGATGGGTTGTTACGTTCTGGAAAGCGTACGAAAGTGACGTGTGGAAACTCTGAGAATGGGTGGCTAGGTCATGGCTCTATTCACCCGTCTCTCTTACTTCATTGCTTCTTTTTAAGGAGCAAGTTTTCACTTCCTCTCCTCTTCGAGGCTATCCTGTGCTTAATTTCCTCCTGAGTGCTGAAGACTCTCCTTCGAGATTTTTTGTAGTATTCCTTGGCAAGTGGTGGGCTTTCGTTTGCTCTACGGGCCCTGTTTTGTCTCCGTGGTTTTGTTTCCTTCTCCGTCTGAAACTTCTTCCTCGACGTAGGCCGGGAGGCTTGGGTCTTATGGAGATGGCGCTTGGTGCAGTGTTGACATCAGCAAGTTGTGGAAGGCCACGATTGGTTGACCTTGCCCTCCTTGGTTTTGTCTTTGTACTTCAATGCCCTCTGCTTAGGAGTGGCATACCCGGGAGACTTGCTATTTCGGTTGAGCTAGTAGCTTTTAGTTTTATTCTTATACTTTCCTTACAGTAGATCTCATTTGGCATTCCGGACGGCATGAAAGCCTGTTCTGTATAGTCACAAAAAATGTCCGCATCTTCTCCAATGCACTTCTACCATTAATTTTCCACAGTATTTCTGTGTCCAATTTTTGTGTACAACATCTGGTCTCACTTCTTGTTGTATCTTGTAAGTGACGTGTTCTTCTCTTTGATGCCGCGAATGATTGTACAATCAACTCTCAATTGTGTTAGAAAGTTCGCAGATCCACCTTGTGCTATATACGACATTGTCGTGCATTGAGATCAGGTTCGATTTCGATCAATTGCCGGTGAACGATGAAGTGCTTCTGCATGTCGAAACACAGTTTGAAGAAGTTGAGCGTTGCTTGAGTTGACGAATGTGTTCCTTGTCATGATTAACACAACCTATCCAGGCGCTGATGTAACTGTAAATGGTACTCATGCGTGAGTAGAGTAATCTTTCTATCACACCCGGAACACTTGACAAGTAGGCCAATCGTAGGGCAAGTGGAAAGACCTGTCCATGCAACCAGCCAAGAGCAGACGACCGTTATCTCTTAATCTCTCAAACTTAACGCACACCTTCAAGGAAGGTAAATAAAGATGTAAGTTGAC

mRNA

>Mapoly0005s0203.1
CCTTCCCTCCTCTTCTCTTCTTCCCTGCGCCACAACATCGTAGAGCTCCTCTTTTGCCCTCCGCCTGCTGCATTCTGCGGTTCAGTAAGCCACGAGAGAGCCCGAGGGAGAGGAGAAAGGGATAGTAGTGTGGGTGTGGTTGTCCCTGGTGTCGGAGCGAAAGTAGTTTAAGAGGTGTGTTAATGTAAGCAAGCTCTCGCCTAGTGAATAGCGTTGGTGATCTTAAGCAAGCAAGCGAGCTCTAGCCCAAGAGGGTGAGTGGGGACTCAGTGACGTGATTGAGCTTGGAGCCTGAACAACCAGGATTGTCGAGTGAAGTCCGTGGTGTGGTGGAGACTTGCCTACAATACCCTGCACGCGAGCGGGCACGCAGAGGAGACCGAGGCTTCTCCCCTGAGTTGCTGCTGTCGAGACGCGGCATATCCCCGAAAAGGGTTTAAGATAGTGGTCGATCAGAGAGTCTGCGCGCTCTCTGTCGTAGGTCGTGCACGGGCTGGGAGTGATATCGACTGATTGTCGTTCTCTACGTTGAAGTAGGCAATGGCGGACGATTCGCCGGTAGTGAAGAAGACCGGGAAGGTGAAATGGTTCAATAGCAGTAAAGGGTTTGGTTTCATCACCCCTGATGATGGCGGTGAGGACCTCTTTGTCCACCAAACGTCTATCCATGCTGAGGGATTTAGGTCTTTGAGGGAAGGAGAGAGCGTTGAGTTTACTGTCGAAGTAGGAGAAGACAATCGAACCAAAGCTCTGGATGTCACTGGACCCGGAGGAAGTTACGTCCAAGGTGCTCCTCGTCGAGACGGGTATGGAGGTGGAGGAAGAGGAGGTGGTGGTGGAGGTGGTGGTGGTGGAGGAAACTTCAGCGGAGGAATGGGTAGAGGAAGGGGCCGTGGTGGAAGAGGCGGAGGCAACTTCGCCGGAGGAGGCGGTGGTGGAGATCGGACATGTTACAACTGCGGAGAGCCTGGACACATTGCTCGTAACTGTCCCAGTGAACCTGCTGGCAACGGCAGAGCAGGTGGTGGTGGCGGTGATGGCGGTAATCGCAACTGCTACAACTGTGGCGAGTCAGGGCATCTTGCTCGAGATTGCGCTCCGGCTGCAGCTGCCTAGACGGCGATCCACTTTTTTTGATTTGTGGTCTTCTGGGACCTTTGGTAGTTTTCGGTCGCTGGAAGCCTCGCAGTTTAATCGTCGAAGGTTTTGATGATTTCACTCGATGGGTGTAATTCAACTCAAGACCGCAGAAAGATTGCGCATTCTCTTGCTTCCCAATGCTTTCGGCTGTTGTACCTCTGAAGGCAAAGTCCATCCTCTCTTGAGCTTGTGATGGCTGAATGAGGTGATGTTGCTTAAGCTTCTCAGTTGATTCTTTTTGTGGGGGTGTGAAGTGGACGTCTTGAAGGAGAACTTTCGTTTATCGTGGAGAATCCCGCTGTCGTTTTTCTGTGGACGGGCTGTGTGCAAGTTGTGTTGCCCGTTGTTTACTCCACTCTCAACATCGACGAGCGGCGGGTTAGGGGCGTAGGTGAAAGCAGAAAAGGTCGAGGCCGGTAGATGTCGTGGGAAAGAAAGTGTTTAGGATGGGTTGTTACGTTCTGGAAAGCGTACGAAAGTGACGTGTGGAAACTCTGAGAATGGGTGGCTAGGTCATGGCTCTATTCACCCGTCTCTCTTACTTCATTGCTTCTTTTTAAGGAGCAAGTTTTCACTTCCTCTCCTCTTCGAGGCTATCCTGTGCTTAATTTCCTCCTGAGTGCTGAAGACTCTCCTTCGAGATTTTTTGTAGTATTCCTTGGCAAGTGGTGGGCTTTCGTTTGCTCTACGGGCCCTGTTTTGTCTCCGTGGTTTTGTTTCCTTCTCCGTCTGAAACTTCTTCCTCGACGTAGGCCGGGAGGCTTGGGTCTTATGGAGATGGCGCTTGGTGCAGTGTTGACATCAGCAAGTTGTGGAAGGCCACGATTGGTTGACCTTGCCCTCCTTGGTTTTGTCTTTGTACTTCAATGCCCTCTGCTTAGGAGTGGCATACCCGGGAGACTTGCTATTTCGGTTGAGCTAGTAGCTTTTAGTTTTATTCTTATACTTTCCTTACAGTAGATCTCATTTGGCATTCCGGACGGCATGAAAGCCTGTTCTGTATAGTCACAAAAAATGTCCGCATCTTCTCCAATGCACTTCTACCATTAATTTTCCACAGTATTTCTGTGTCCAATTTTTGTGTACAACATCTGGTCTCACTTCTTGTTGTATCTTGTAAGTGACGTGTTCTTCTCTTTGATGCCGCGAATGATTGTACAATCAACTCTCAATTGTGTTAGAAAGTTCGCAGATCCACCTTGTGCTATATACGACATTGTCGTGCATTGAGATCAGGTTCGATTTCGATCAATTGCCGGTGAACGATGAAGTGCTTCTGCATGTCGAAACACAGTTTGAAGAAGTTGAGCGTTGCTTGAGTTGACGAATGTGTTCCTTGTCATGATTAACACAACCTATCCAGGCGCTGATGTAACTGTAAATGGTACTCATGCGTGAGTAGAGTAATCTTTCTATCACACCCGGAACACTTGACAAGTAGGCCAATCGTAGGGCAAGTGGAAAGACCTGTCCATGCAACCAGCCAAGAGCAGACGACCGTTATCTCTTAATCTCTCAAACTTAACGCACACCTTCAAGGAAGGTAAATAAAGATGTAAGTTGAC

CDS

>Mapoly0005s0203.1
ATGGCGGACGATTCGCCGGTAGTGAAGAAGACCGGGAAGGTGAAATGGTTCAATAGCAGTAAAGGGTTTGGTTTCATCACCCCTGATGATGGCGGTGAGGACCTCTTTGTCCACCAAACGTCTATCCATGCTGAGGGATTTAGGTCTTTGAGGGAAGGAGAGAGCGTTGAGTTTACTGTCGAAGTAGGAGAAGACAATCGAACCAAAGCTCTGGATGTCACTGGACCCGGAGGAAGTTACGTCCAAGGTGCTCCTCGTCGAGACGGGTATGGAGGTGGAGGAAGAGGAGGTGGTGGTGGAGGTGGTGGTGGTGGAGGAAACTTCAGCGGAGGAATGGGTAGAGGAAGGGGCCGTGGTGGAAGAGGCGGAGGCAACTTCGCCGGAGGAGGCGGTGGTGGAGATCGGACATGTTACAACTGCGGAGAGCCTGGACACATTGCTCGTAACTGTCCCAGTGAACCTGCTGGCAACGGCAGAGCAGGTGGTGGTGGCGGTGATGGCGGTAATCGCAACTGCTACAACTGTGGCGAGTCAGGGCATCTTGCTCGAGATTGCGCTCCGGCTGCAGCTGCCTAG

Protein

>Mapoly0005s0203.1
MADDSPVVKKTGKVKWFNSSKGFGFITPDDGGEDLFVHQTSIHAEGFRSLREGESVEFTVEVGEDNRTKALDVTGPGGSYVQGAPRRDGYGGGGRGGGGGGGGGGGNFSGGMGRGRGRGGRGGGNFAGGGGGGDRTCYNCGEPGHIARNCPSEPAGNGRAGGGGGDGGNRNCYNCGESGHLARDCAPAAAA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>