Mapoly0007s0033



Description

TELOMERIC REPEAT BINDING PROTEIN

Reference DB

Database ID Description
GO GO:0003682 Chromatin binding
OrthoMCL OG5_133795
PFAM PF00249 Myb-like DNA-binding domain
PANTHER PTHR21717 TELOMERIC REPEAT BINDING PROTEIN

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB2 transcription factor, MYB Mapoly0007s0033.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0007s0033.1 scaffold_7:651448..656195  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0007s0033.1  

Gene structure:

mRNA scaffold_7:651448..656195  ( + strand )
five_prime_UTR scaffold_7:651448..651735  ( + strand )
CDS scaffold_7:651736..653512  ( + strand )
CDS scaffold_7:653635..653921  ( + strand )
CDS scaffold_7:654114..654298  ( + strand )
CDS scaffold_7:654398..654464  ( + strand )
CDS scaffold_7:655013..655078  ( + strand )
three_prime_UTR scaffold_7:655079..655100  ( + strand )
three_prime_UTR scaffold_7:655380..655544  ( + strand )
three_prime_UTR scaffold_7:655667..656195  ( + strand )

Sequences:

Gene

>Mapoly0007s0033.1
CAAACACCATCGTGTAAGTTGTAGAATTTCATATGTTACTTTGTCCAACGTCTTATATCTTTACCGAAGTGGGGTAAGTCGCGAGAAGAGTCACGCACACGCCCCTACGCTGGCCTCTTCCAGACAAGAGCCACGATTCGAATTCGATGTCGGGTGCAAATTCCGGTCACGGCAATTTTTTCGAATTGGGATTGACGTGGGCGCAGAGCTGTCTCGCGCTTCGAGTCTCATGACAGTCCGCCCTTGCTCTCGAAATCGCTGTCAGAGCGCGCCACAGCTGCGGAGACTATGGCCGTGTCGAATTTGCGGCCTCTTTCCGCCGCTTGCAGTCTCTTGATTGGACCTGCTCAGGGCCAAGACGAGGCCGATCGAGACCTGAAACAGAGAGAATGGATTTGGGAGTTTTTCTTGAAGAATAACACGAATGGAAGTTTGCTCTTGGAGTTGATGACTGCTCTGCCATTTCCGAATGAGAATTTAAATCTCAAGCGATTGCTACTTTTGAGGTCTCTTTCCTTACAGTTGTCGTTAGGACAATTTGATGAACTTACGCTTGACATCCTGAAGGCTCTCGGGGAGATGGTCAGGAAGCCTGACTGTTCACTTGAAAGCATCTGTTTTCGTGAAGCATCTGATGAGCCTGCAAAGAAGCGGAAAGCGACTGAGAAAGGGGAAAAGCACGACACTCGAATTTCGAAAGTGGAAGCGACGAAAGAATCGGTGAAAAGGGGACTCCCGGAGAGCCTTTTCGGGAGGAAGTCGAAGAAGTCACGCAGAGAACGCACAGGGGAAGAGGGAAGACGAGACGCGAATCGGTCTGAAGAACTCTTTCCCAGAGGAGACGCAATTGGCCTCAAAGATGGAAGTCTAAGAACAAATTTTGCCTATATGCAAGCAGGAGCTCCTTCGTGGGAACTTCAATTGGATGTAATGATTGAGTTAACTGTAAAACATTTGAGGGGGGTTTCGCTTAGTAAGAAGGCCTTTGAAGCAGCGCTGGCTAAATACTGGGGAGATTTTATTATGGATACAGAGGAGCCGGTTGCAGAAAGGCTTTCATTTGAAATTGCCAGGGAGGACATCAGAAATGAGCTATGGAAGGTTCATAGTAACCTCGATCTCTTGGAAGAGATCACACAAAAGTACACCGAAGGAAGAGTTAGGAACAAACTGGCATGGTTTCTGAGAGAAGCATGGGCAGACACGCAGAAAACTTTTCTGGAAACAGTTAGCAGCGATGTTCTTGATGGTACTTACGAACCTCTGAACCCTGATGTTCATCGGAGGAACGTGGGAGCAGTTGTAGGGGAAGATGGAGTGGCAGTGAATGCTAGAGAGCTTACAAGCGAGAAGCCCTGGGTTAGATCTTCGAGAGGGAGACTCTCAAGGAGTCGAGAGAAGCTGCAAAAAGCCTTTGGGGTTCTTGAAATCAACGCCAGACGGGAACTGGAGCAATCCGGAAACATAATGGATGGCGGTGATAATGAGAAGAATACAGAAGTCGTTAAGATATGCAAAATCAACGACATTCTTGGTCCTCCCTTGCTACAAACTCGAACAGCGGAGGTATACTTGCCGAGTGCAACAGATGCCAACAATGAAACTGGATCCAAGCAAAAGATCTATTCTGGATCAGAAGATACGGCCGATGCAGCTGAACGTGAGACTGAAGAATTTGACCATGAAGAAACAGGAAGAAGTCAGCCTTGTGATAGGGTACTTCGTAGGACTGAGGATCATGCAAACTTGGTGAAAGATGGAGGTCTCTCGGATAAAGAGATAACAGGTGACCGACAAGTAAGAAGCGCGAGTACGTCACCTGTATCCCCAACCACCCGAGGTGATTTAAAGTCTTATCGCCAAGATCTTAAGGGTAAAGGTTCATACTCTAAGGACGAAGCATCATCGGATGGAGCGTGCAATAGGACGAAGTGCACTGACTTGCAAGTTGCCGATCCACAACATTCGAAGATGGAAGGAACTGCTGTAGAAACAATAAATCTGTTGTCGCCTTCTCCCCGACCATTAGCCAAGATCCAAGGCTCGCTAAGCCCTCCCCCTTGGGGTAGGTTCTGCTCCCAACTCCCGCTCTATCTTTGTAACAGTGCAGATGTGACTACTTCCTTCCCATATGTACAGATTAAATCTTCTTATCCGCTGTCTGACGCTCATAAATATCGATTGCAGTAGAAGCCAGATTGCGATTTAGAAGGAAACCGGCTTCACCCTCGAGTAATAATCAGACAACAGGGCCTGCTCAAGTTTATGAAGGAAACACAAGAGCAGGAGCGTCAAGTGAAGCCGGAAGTGCAAAGGAGAATTCTGGCCCGGGTAGTGCTGAAAAGTCAAGGAAAGACAGAAACATGGATGCACAACACGAGGTCCTACTACAGTTTCCCATATCGAAAATTGGAGAAACAGCTGCAGCGAAGCCCAGCTTCTTACAACGAAATTCCACTGCCCGTACGCTAGAGGTTTGGAATTCTGAAATCAAGCAAGCGAACATAATGAACAAGAGGAAGTGAAGCCAATTTTATTTTCTTGGGATGGAAGATTATACACGAAGTTGGTACGCGAGTTGATTTTCTAACTGAACATTGTATTTACAAGGGACTTTACCTTTCTCAAGCCATTAAGCTAGCTTGACTGATCTGAAAATGGTGCAGTGGAAAGACGAAGATGACATTTCTGAAAGTCCGCCAAGTCCTCCAGAATCAAGGCGTGTTGCTTCAGCCCGGACCTCTGCAGTGATCGCCACTCGCAGGGCTTCATCTCAAACTAGCACGCGGAGGAGGAAACATCGCAAATGGTCTAATGAGGAAACCGAGCTTTTGAAAAGTGAAGTGTTCAAGTGAGTTGCTTTTTGTGGTTGCTATTTGATTTGTTTGATTTGCTTGCAGTGCATTTAGAATTGTGGTTCTGACTTCTGACGACACGAATGGCTTTTCAGGTATGGTAAGGGTCGATGGAAACTAATTCTTGCTAATAATCAGACAGTTTTCGAAAGCCGCACAGAGGTACTATCATGACTCTCCCGTTTTAAATGTAGCGTATCATTTTCATGGACTCCATAACAAAATAATATCAGTAGCTCTTGACGCCCAGCAGGACACGTTACTAGGTATATCTTAATCTCTGCGGCAAAAATCTGGAAAAATGTATGTTTCGTTGTAAGTAACTTTGAAACAAGGACTCTTTTGCTGTTGCGAATCTCGATACTAGCAGGCTTTGCCTTGGATGAATCTAGCATTCCACTGTGAGTTTCGGAAGTTTGTCAATTTCTCGGTTTTACCTACAGGGTTACATTCTTTATTTATGCACCTTTTTATTTTCCATAGACGTTTAATATTTGCGACATGTCGATCGATTGTGAATTTTAGCCGATTTTGGTGCCTTAGTCTGTTCGCAGCATTAGTGACATCAGTTCTTCATTGAGCTTGATCATAAATGCCAGGATGCCATTGGCACAGACTTGTGCCTACAGATTTCCGTTCTCTACTGGGATCTCTCATTTATCATCGATGATCAACATTCGTTTGTAACTATCGTGGGTCACCTCTTACAGGTAGATTTGAAGGACAAGTGGCGGAATTTAGAAAGGTTTGAAGGCTTGAGCGTCTCAGACGATTGAGGGCACCATTCGTCTGGCACAGGTAAAAGTCCTTCGATGTTTGTACAAGTTAAGGTCCAAAATATGCGTACTCCTTGTTTCGCATAAATTTATCAAGGATTGGCGATGGTGCCTCTACTGCAGAATGTAAGTTGCTATGAGGTTATCTAGTTTTGACTCACGCATGCTTGTTTGAAGATGGTTGTCGTTTATCTCCGGGAGGTTTCTATACTCCAACAGTGCTAGTAGTCTTGTAGGTGAAACCAGTTATTCGTTTCATTCTCGTGTGAAATCAGCTTTGGATCTTGCGGGTGTTTTTCAGAGCGGCTGCATCATGTATTGTGGATGCACTTCTGCCATCGGCCTTCTAAGACGAGGATTGGTGATCCATCTTTATTTCCGGATTGTTTGAAATCACCTCCTTTACAAACGCAGCTACAAGTCAGCTGCAGATGAGTTATTATACGCGAAAGTTCGACAAATCCAGGTATCCAAAGTTAGTCTCGACAAGGATGATTCAAGCTTTCTTCTTTGTCCAATATTGAATGTTGAACATTACAGAACACGGGGCTTGCTGACAGAATGATGTTGTTTGTTTTGTGCTTCAAGGTTGATCGCGGAGCTGATAAGGACAGCTTAAGTTTTGAGTAAAAGGGTAGCTCTGCAGTCTAGATCCCCCCTGAAAGGTAAGGAGTAGACGGAGATGTTTGAGTTCTGAAGTGGAGAGCGTTGAATCTGAGTAACCAGAAAAATGAAACAAATGCTAAACATCAAATACCGAAAAGGATCACAACATGGTGATCTCTTGAGGTCGCAGTTGTCTGGGTAGTAGAGCGTTCACTTACCTCTTTAGTATAAGGTGTGGAATAAGGATAAACTTTCAACCCAGTCTTGAAAGTTCAATTTCAAGGTGCCCATGTGATGGAGGTGGTGACTTGATGATCACACTCTGATGCCGCTGCTGAAGATTTCTATACTGGTGGGATTATACACTGTAGGAACCTTGTTGCAGATCCCGATGCTATTATGTCGTGATACCGTTACACAATGCCAAGTCCTTCTAGGCGTTCAGTTCTGCATGCCTGAACATCGCTGTGGTTGTATCCTCGAAAATTATTAAGATATTCATAACACATTT

mRNA

>Mapoly0007s0033.1
CAAACACCATCGTGTAAGTTGTAGAATTTCATATGTTACTTTGTCCAACGTCTTATATCTTTACCGAAGTGGGGTAAGTCGCGAGAAGAGTCACGCACACGCCCCTACGCTGGCCTCTTCCAGACAAGAGCCACGATTCGAATTCGATGTCGGGTGCAAATTCCGGTCACGGCAATTTTTTCGAATTGGGATTGACGTGGGCGCAGAGCTGTCTCGCGCTTCGAGTCTCATGACAGTCCGCCCTTGCTCTCGAAATCGCTGTCAGAGCGCGCCACAGCTGCGGAGACTATGGCCGTGTCGAATTTGCGGCCTCTTTCCGCCGCTTGCAGTCTCTTGATTGGACCTGCTCAGGGCCAAGACGAGGCCGATCGAGACCTGAAACAGAGAGAATGGATTTGGGAGTTTTTCTTGAAGAATAACACGAATGGAAGTTTGCTCTTGGAGTTGATGACTGCTCTGCCATTTCCGAATGAGAATTTAAATCTCAAGCGATTGCTACTTTTGAGGTCTCTTTCCTTACAGTTGTCGTTAGGACAATTTGATGAACTTACGCTTGACATCCTGAAGGCTCTCGGGGAGATGGTCAGGAAGCCTGACTGTTCACTTGAAAGCATCTGTTTTCGTGAAGCATCTGATGAGCCTGCAAAGAAGCGGAAAGCGACTGAGAAAGGGGAAAAGCACGACACTCGAATTTCGAAAGTGGAAGCGACGAAAGAATCGGTGAAAAGGGGACTCCCGGAGAGCCTTTTCGGGAGGAAGTCGAAGAAGTCACGCAGAGAACGCACAGGGGAAGAGGGAAGACGAGACGCGAATCGGTCTGAAGAACTCTTTCCCAGAGGAGACGCAATTGGCCTCAAAGATGGAAGTCTAAGAACAAATTTTGCCTATATGCAAGCAGGAGCTCCTTCGTGGGAACTTCAATTGGATGTAATGATTGAGTTAACTGTAAAACATTTGAGGGGGGTTTCGCTTAGTAAGAAGGCCTTTGAAGCAGCGCTGGCTAAATACTGGGGAGATTTTATTATGGATACAGAGGAGCCGGTTGCAGAAAGGCTTTCATTTGAAATTGCCAGGGAGGACATCAGAAATGAGCTATGGAAGGTTCATAGTAACCTCGATCTCTTGGAAGAGATCACACAAAAGTACACCGAAGGAAGAGTTAGGAACAAACTGGCATGGTTTCTGAGAGAAGCATGGGCAGACACGCAGAAAACTTTTCTGGAAACAGTTAGCAGCGATGTTCTTGATGGTACTTACGAACCTCTGAACCCTGATGTTCATCGGAGGAACGTGGGAGCAGTTGTAGGGGAAGATGGAGTGGCAGTGAATGCTAGAGAGCTTACAAGCGAGAAGCCCTGGGTTAGATCTTCGAGAGGGAGACTCTCAAGGAGTCGAGAGAAGCTGCAAAAAGCCTTTGGGGTTCTTGAAATCAACGCCAGACGGGAACTGGAGCAATCCGGAAACATAATGGATGGCGGTGATAATGAGAAGAATACAGAAGTCGTTAAGATATGCAAAATCAACGACATTCTTGGTCCTCCCTTGCTACAAACTCGAACAGCGGAGGTATACTTGCCGAGTGCAACAGATGCCAACAATGAAACTGGATCCAAGCAAAAGATCTATTCTGGATCAGAAGATACGGCCGATGCAGCTGAACGTGAGACTGAAGAATTTGACCATGAAGAAACAGGAAGAAGTCAGCCTTGTGATAGGGTACTTCGTAGGACTGAGGATCATGCAAACTTGGTGAAAGATGGAGGTCTCTCGGATAAAGAGATAACAGGTGACCGACAAGTAAGAAGCGCGAGTACGTCACCTGTATCCCCAACCACCCGAGGTGATTTAAAGTCTTATCGCCAAGATCTTAAGGGTAAAGGTTCATACTCTAAGGACGAAGCATCATCGGATGGAGCGTGCAATAGGACGAAGTGCACTGACTTGCAAGTTGCCGATCCACAACATTCGAAGATGGAAGGAACTGCTGTAGAAACAATAAATCTGTTGTCGCCTTCTCCCCGACCATTAGCCAAGATCCAAGGCTCGCTAAGCCCTCCCCCTTGGGTAGAAGCCAGATTGCGATTTAGAAGGAAACCGGCTTCACCCTCGAGTAATAATCAGACAACAGGGCCTGCTCAAGTTTATGAAGGAAACACAAGAGCAGGAGCGTCAAGTGAAGCCGGAAGTGCAAAGGAGAATTCTGGCCCGGGTAGTGCTGAAAAGTCAAGGAAAGACAGAAACATGGATGCACAACACGAGGTCCTACTACAGTTTCCCATATCGAAAATTGGAGAAACAGCTGCAGCGAAGCCCAGCTTCTTACAACGAAATTCCACTGCCCGTACGCTAGAGTGGAAAGACGAAGATGACATTTCTGAAAGTCCGCCAAGTCCTCCAGAATCAAGGCGTGTTGCTTCAGCCCGGACCTCTGCAGTGATCGCCACTCGCAGGGCTTCATCTCAAACTAGCACGCGGAGGAGGAAACATCGCAAATGGTCTAATGAGGAAACCGAGCTTTTGAAAAGTGAAGTGTTCAAGTATGGTAAGGGTCGATGGAAACTAATTCTTGCTAATAATCAGACAGTTTTCGAAAGCCGCACAGAGGTAGATTTGAAGGACAAGTGGCGGAATTTAGAAAGGTTTGAAGGCTTGAGCGTCTCAGACGATTGAGGGCACCATTCGTCTGGCACAGAGCGGCTGCATCATGTATTGTGGATGCACTTCTGCCATCGGCCTTCTAAGACGAGGATTGGTGATCCATCTTTATTTCCGGATTGTTTGAAATCACCTCCTTTACAAACGCAGCTACAAGTCAGCTGCAGATGAGTTATTATACGCGAAAGTTCGACAAATCCAGGTTGATCGCGGAGCTGATAAGGACAGCTTAAGTTTTGAGTAAAAGGGTAGCTCTGCAGTCTAGATCCCCCCTGAAAGGTAAGGAGTAGACGGAGATGTTTGAGTTCTGAAGTGGAGAGCGTTGAATCTGAGTAACCAGAAAAATGAAACAAATGCTAAACATCAAATACCGAAAAGGATCACAACATGGTGATCTCTTGAGGTCGCAGTTGTCTGGGTAGTAGAGCGTTCACTTACCTCTTTAGTATAAGGTGTGGAATAAGGATAAACTTTCAACCCAGTCTTGAAAGTTCAATTTCAAGGTGCCCATGTGATGGAGGTGGTGACTTGATGATCACACTCTGATGCCGCTGCTGAAGATTTCTATACTGGTGGGATTATACACTGTAGGAACCTTGTTGCAGATCCCGATGCTATTATGTCGTGATACCGTTACACAATGCCAAGTCCTTCTAGGCGTTCAGTTCTGCATGCCTGAACATCGCTGTGGTTGTATCCTCGAAAATTATTAAGATATTCATAACACATTT

CDS

>Mapoly0007s0033.1
ATGGCCGTGTCGAATTTGCGGCCTCTTTCCGCCGCTTGCAGTCTCTTGATTGGACCTGCTCAGGGCCAAGACGAGGCCGATCGAGACCTGAAACAGAGAGAATGGATTTGGGAGTTTTTCTTGAAGAATAACACGAATGGAAGTTTGCTCTTGGAGTTGATGACTGCTCTGCCATTTCCGAATGAGAATTTAAATCTCAAGCGATTGCTACTTTTGAGGTCTCTTTCCTTACAGTTGTCGTTAGGACAATTTGATGAACTTACGCTTGACATCCTGAAGGCTCTCGGGGAGATGGTCAGGAAGCCTGACTGTTCACTTGAAAGCATCTGTTTTCGTGAAGCATCTGATGAGCCTGCAAAGAAGCGGAAAGCGACTGAGAAAGGGGAAAAGCACGACACTCGAATTTCGAAAGTGGAAGCGACGAAAGAATCGGTGAAAAGGGGACTCCCGGAGAGCCTTTTCGGGAGGAAGTCGAAGAAGTCACGCAGAGAACGCACAGGGGAAGAGGGAAGACGAGACGCGAATCGGTCTGAAGAACTCTTTCCCAGAGGAGACGCAATTGGCCTCAAAGATGGAAGTCTAAGAACAAATTTTGCCTATATGCAAGCAGGAGCTCCTTCGTGGGAACTTCAATTGGATGTAATGATTGAGTTAACTGTAAAACATTTGAGGGGGGTTTCGCTTAGTAAGAAGGCCTTTGAAGCAGCGCTGGCTAAATACTGGGGAGATTTTATTATGGATACAGAGGAGCCGGTTGCAGAAAGGCTTTCATTTGAAATTGCCAGGGAGGACATCAGAAATGAGCTATGGAAGGTTCATAGTAACCTCGATCTCTTGGAAGAGATCACACAAAAGTACACCGAAGGAAGAGTTAGGAACAAACTGGCATGGTTTCTGAGAGAAGCATGGGCAGACACGCAGAAAACTTTTCTGGAAACAGTTAGCAGCGATGTTCTTGATGGTACTTACGAACCTCTGAACCCTGATGTTCATCGGAGGAACGTGGGAGCAGTTGTAGGGGAAGATGGAGTGGCAGTGAATGCTAGAGAGCTTACAAGCGAGAAGCCCTGGGTTAGATCTTCGAGAGGGAGACTCTCAAGGAGTCGAGAGAAGCTGCAAAAAGCCTTTGGGGTTCTTGAAATCAACGCCAGACGGGAACTGGAGCAATCCGGAAACATAATGGATGGCGGTGATAATGAGAAGAATACAGAAGTCGTTAAGATATGCAAAATCAACGACATTCTTGGTCCTCCCTTGCTACAAACTCGAACAGCGGAGGTATACTTGCCGAGTGCAACAGATGCCAACAATGAAACTGGATCCAAGCAAAAGATCTATTCTGGATCAGAAGATACGGCCGATGCAGCTGAACGTGAGACTGAAGAATTTGACCATGAAGAAACAGGAAGAAGTCAGCCTTGTGATAGGGTACTTCGTAGGACTGAGGATCATGCAAACTTGGTGAAAGATGGAGGTCTCTCGGATAAAGAGATAACAGGTGACCGACAAGTAAGAAGCGCGAGTACGTCACCTGTATCCCCAACCACCCGAGGTGATTTAAAGTCTTATCGCCAAGATCTTAAGGGTAAAGGTTCATACTCTAAGGACGAAGCATCATCGGATGGAGCGTGCAATAGGACGAAGTGCACTGACTTGCAAGTTGCCGATCCACAACATTCGAAGATGGAAGGAACTGCTGTAGAAACAATAAATCTGTTGTCGCCTTCTCCCCGACCATTAGCCAAGATCCAAGGCTCGCTAAGCCCTCCCCCTTGGGTAGAAGCCAGATTGCGATTTAGAAGGAAACCGGCTTCACCCTCGAGTAATAATCAGACAACAGGGCCTGCTCAAGTTTATGAAGGAAACACAAGAGCAGGAGCGTCAAGTGAAGCCGGAAGTGCAAAGGAGAATTCTGGCCCGGGTAGTGCTGAAAAGTCAAGGAAAGACAGAAACATGGATGCACAACACGAGGTCCTACTACAGTTTCCCATATCGAAAATTGGAGAAACAGCTGCAGCGAAGCCCAGCTTCTTACAACGAAATTCCACTGCCCGTACGCTAGAGTGGAAAGACGAAGATGACATTTCTGAAAGTCCGCCAAGTCCTCCAGAATCAAGGCGTGTTGCTTCAGCCCGGACCTCTGCAGTGATCGCCACTCGCAGGGCTTCATCTCAAACTAGCACGCGGAGGAGGAAACATCGCAAATGGTCTAATGAGGAAACCGAGCTTTTGAAAAGTGAAGTGTTCAAGTATGGTAAGGGTCGATGGAAACTAATTCTTGCTAATAATCAGACAGTTTTCGAAAGCCGCACAGAGGTAGATTTGAAGGACAAGTGGCGGAATTTAGAAAGGTTTGAAGGCTTGAGCGTCTCAGACGATTGA

Protein

>Mapoly0007s0033.1
MAVSNLRPLSAACSLLIGPAQGQDEADRDLKQREWIWEFFLKNNTNGSLLLELMTALPFPNENLNLKRLLLLRSLSLQLSLGQFDELTLDILKALGEMVRKPDCSLESICFREASDEPAKKRKATEKGEKHDTRISKVEATKESVKRGLPESLFGRKSKKSRRERTGEEGRRDANRSEELFPRGDAIGLKDGSLRTNFAYMQAGAPSWELQLDVMIELTVKHLRGVSLSKKAFEAALAKYWGDFIMDTEEPVAERLSFEIAREDIRNELWKVHSNLDLLEEITQKYTEGRVRNKLAWFLREAWADTQKTFLETVSSDVLDGTYEPLNPDVHRRNVGAVVGEDGVAVNARELTSEKPWVRSSRGRLSRSREKLQKAFGVLEINARRELEQSGNIMDGGDNEKNTEVVKICKINDILGPPLLQTRTAEVYLPSATDANNETGSKQKIYSGSEDTADAAERETEEFDHEETGRSQPCDRVLRRTEDHANLVKDGGLSDKEITGDRQVRSASTSPVSPTTRGDLKSYRQDLKGKGSYSKDEASSDGACNRTKCTDLQVADPQHSKMEGTAVETINLLSPSPRPLAKIQGSLSPPPWVEARLRFRRKPASPSSNNQTTGPAQVYEGNTRAGASSEAGSAKENSGPGSAEKSRKDRNMDAQHEVLLQFPISKIGETAAAKPSFLQRNSTARTLEWKDEDDISESPPSPPESRRVASARTSAVIATRRASSQTSTRRRKHRKWSNEETELLKSEVFKYGKGRWKLILANNQTVFESRTEVDLKDKWRNLERFEGLSVSDD

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>