Mapoly0007s0056



Description

bZIP transcription factor

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
OrthoMCL OG5_146419
PFAM PF00170 BZIP transcription factor
PANTHER PTHR13690 FAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP2 transcription factor, bZIP Mapoly0007s0056.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0007s0056.1 scaffold_7:871784..875971  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0007s0056.1  

Gene structure:

mRNA scaffold_7:871784..875971  ( + strand )
five_prime_UTR scaffold_7:871784..872235  ( + strand )
CDS scaffold_7:872236..873131  ( + strand )
CDS scaffold_7:873656..873788  ( + strand )
CDS scaffold_7:873993..874077  ( + strand )
CDS scaffold_7:874405..874688  ( + strand )
three_prime_UTR scaffold_7:874689..875971  ( + strand )

Sequences:

Gene

>Mapoly0007s0056.1
GGGCCTGTGAAATCAATCACGGAGGACCGAGTGTTACCAGCGACTAAGTCAGGTTCTCTGCTTCAGCCTGTGTAGAGCAGGTCCAAGAGTGCATTTTGGTGGTGGGGCAGGTTGTGGATCAAATATGCAAAAGCAACAAAATACCGTTGCATCTTCTGATGGGCCCTAGTTCAGGCAGAACGCTTGGGCGGCAGCTAGAAATGTCATAGTAGTCACATGACACAGGAAGAGACGTCTAGAGAAGGCTGCAAAGAGCGAGGTTGATACGAGGTTTCGTAACGTTAAGTAGAGTTGTTGGGAAGTTTGCAGTTCGCTTGCCTGTCAGAGTGAAAGGTTAGAACAGGCGCTGATAGCTACGAGCAAAGGGCACAGTATTCGAGATCAAACTTGTCAGGAACAGATAGTAACGTCATCAAACCCGGCTGGGAAGCAGTAAACAGTTCTGTGAGGGGATGGACGGCCTCGGGGACGGATACGAGGCATTTGTAGAGCGATTACAATCGGATTTTGCAGCTACAAGTGCCGCTAAGAACTCAGGTCAAAACGGGAACACGACCACTCACAGCAGCCACCCTCCTCATCCCTCTCAGTCACAACTTCACCAGTCACGATATGTGGGCTACCCGTCACCAACACATGCATTCACGGTCAAGAGGGAGGCGTCACCCTCCGTATCAGAGTCATCCATGAGAACGGCTAACTCCCTTTCTATAGAGGTCTCCATGCAAGATCAGGTGACCTCGCCCGGACCTCCTAGCGTAACAGGTCCGTCTAGCTCTAGAAATCCCAGCCCAGCCAACAATTACAGCACTGATGTCAACCAGATGCCAGATACGCCCCCTCGCCGCAGGGGTCACAGGCGTGCCCAGTCGGAGATTGCTTTTCGACTCCCTGACGATGTATCCTTCGAACGTGATCTTGGTATGCATGGCTCTGAGATGCCCGCTCTTTCCGATGATGCGGCCGAAGATCTCTTTTCCATGTACATTGACATGGAGAAAATAAACTCCTTCAGCGCTACATCAGCCCCCTTGCCTGGTCCGAAGAGTACTGCAGCAGACAGCGGGTCTACACCTCCTCCCACTCACCACTCTAGAAGCTTGTCTGTAGATGGAGTGCTATCTGGATTTAACAGTGGTCGAGGTAGCATGGGCCTTTCTGGGGGAAGTGCTGGCTTTCCATCAGATGGACGCAGGTCTCGTCATCAGCATAGCAGTTCTATGGATGGCTCGACTTCCTTCAAGCATGATCTCTTGGCTGCAGAGCTTGATGGTGCAGATGCAAAGAAGGTCATGAATTCCGCAAAGCTGGCCGATATCGCACTTATTGATCCAAAGCGTGCCAAGAGGTTCGTGTCTTTTTCTTTTCCTCTTTTTGACTATCTTCGATGACATTAGTTTCCCTCACAACACAGTAGAAAATTTGGGTTGTACTGGGAGGTAATTTTTGTTGAAACATTTTGCCATCTGTCCAATCTACTGCGATAAATTATGCTCTACATCTGCGACTTTGTTCAATTTTCCAATGTTTCTTTTTCGATTTCCCGTGAGTAACGGGCGATTGTCTTGAGCGTTCTTCTTGTATGAACGAAATTGAAGCGAGTTCGTTGCTTGCCTCGATTCGGTGATTTTTCTTGTGATTCTTTCGTTTGTGTAAGATGTGCATATGAAAATTAGTTGGTCTACGTTGAACTTTGTATTTTACATCAGTTTTTTTGGTTAGTTTACCGTTTCCTGTTGGGGTGCTGACGCGTATCAAGCATTATACCTGTGATGAGTTAGAAGTTGGTGATTTGTAATTTCACAGTTTTACAGCTTCTTTTGAATTGAAGATTGGTTGTTCTCATATGGGCTGTAAATACCTGTACTTCAGAATTCTAGCCAATAGACAATCTGCCGCACGATCGAAGGAACGGAAAATGAGGTACATCTCAGAGCTTGAGCGGAAAGTGCAAACCTTGCAAACGGAGGCAACAACTCTCTCCGCGCAGCTTACCATGCTTCAGGTGAGGCAAAGTCATTGCTGACCTGGCTGTCTTCATATGGATTTATTTTGAAACCTTTGATTAGTCCCGTCATGGCAAGATTATGTCTTCATTTAGGCTTGACCCGCTTGGAAGCCAGAGCTAGTAGGGTGAAGCATTGTCCCCTAGTTGTACGAAGTTCAGGGCGAGGATGTCTTTTGATCTTGGACAAATCATCTGTTGCAGAGGGATACTACAGGTCTCACCACCGAAAACAGTGAACTTAAGCTGCGTTTGCAGGCCATGGAGCAACAAGCCCAACTTCGTGATGGTATGTCGCAACAACTGTCCTGTAAGTTCCTACAAATTGATGTTACGGGGAAGGAGTTCCGGTCGTGAATGCGATGGAAAATTTTCCCGTTTTTCCTACAATTTGTGTATAATAGCTGAACATCTGGACAATTAATCGGTCTGTTTTTCCTGGTTGACATGGGATTCTAAAGGTGTTTACAGCTGTCTTAGCGTATGCGGTTGCATATGCTTGCCTCCTTGTAAGGTTTAGGGACGGATGTGCGCGCACTTATGTGGAAGTCAAGGTTTACCAGCGAAAAGGAATTGTCATATTGAGTTTATTTTGTTTATTTTTGTTGCAATACAGCACTCAATGAAGCATTGCGAGATGAAGTACAACGACTAAAGGTAGCCACAGGACAGATGAATGGATTGACTGGGCACGTTTACGGACTTGGGCAAGGGCCCCTTACAGCCCAGCAGTTGCAGCAACTCCAGCAGCAGTCCTCTCAGCAACAAGCTCACAATGACTTTCTCCAAAGAGGTACATTCGGAGGGCTTCAAACAATGAGCGGTCAAATAGGTGGTTCTTTTATCAAATCAGAAGGATCCACAATCTCTGTAAATCAAGGGAGCAGTGCTTCTTTTTGATGCATTTTATAGAGTTGGCAGGGAGTTCAGAGCAAAGGGAGTGTGACTGAATTAAGGCTATGTCTGACTCTATACTTATTCTTGAACCATGCAATCTCCGGCATAGTGCATCTAAGTTAGGCCGCACGACCATGAGATTGCAGTCCTTGGTATGTGGCCTAGTTTAGATGATGGGCTTATGCGCAAATTCTCCTGCGGTTCTGTGAATAATTGGATCCACCTTACTCGCCCTGAGTGGGGGTGCTCACTTGAAGAGCAGTGCTGGTATCTGCTCGGGTGACTTAACACTTTTACCAATTGCCACGAAGTTGTCCACTCAGTTGCCTGCTTGTTAAAGAGGGCAGATCTTTTGCAATCTAATTTTTTTGGTTCTATCACCAAGATGATGTGGAAGAATCATCAATTTCTGTTGATTGGTGCTATCGTAGGTAGTGGTAGGATGTATTGTAATAACGTTGCCCTCAAATTCATACTATATAAATTGTATTTGCGAACAATAGGTTGTTTAGCATCCCGATAGAAGGGCAGTCTGGATCTCGCAGTGTACGCTGCTTTTTGTCACTATCCAGACCCTGGAAATTCGAAGCCGGTTCTGCTCTGCCGATGAGCTTAGCGCTACAGTCCCCACAATTACACAATTATTTAGTGGAAGCTTGAGGTATGTGCAAACAAAGCTTCAGTTTTGTACCAAATGTGCGTACTTTGTTTCGAGGATTTGGTTAGAGGGGCAATCGGGTTTTCCTTGTATGATATTTTAATACTGAACTTAGCTTTATTGGACATATTTTGGTAATTTTGCCTGTTTCTTCTATGGGGAAATACTTGTTTAGTCCATAGTACTTCAACCTTGGGAAACGTGGGGATAGACTAGTTCATCCTGCTTTTGAATAATGGTCGTTTGGCGCTTCCTCGAGTCTGTTGTCCCGAAGAGATGTTATGTTCTCACACTGATGTCTAAATGTGGAGAGGGAAGTTTTGAGTCGAGGTAGACAGACAGTTCGTTCTGAATCTTGTTAGTTTCCGGTGATGTGCGGAAATTGAACTCGGTTTTGCTCAACTCGATGCTTGAAATTTGTTGAATGTTGCAGGGAAGAATATACTCGTGTGTTGAATGTTCTATGGACGTGTCACACAGTTGATTCGAGGAATCAAATGTAGTAGCCAAGTTAGCCAAGTTAGCCAAGCAGGATATGGTACAAAACAGAATTTGATCCCAACGGCTTTGATTCTGGTTGATAATGGAAAAGAAAACTGCAGAAGCAATGGTTAGAAGTGTATGGTGT

mRNA

>Mapoly0007s0056.1
GGGCCTGTGAAATCAATCACGGAGGACCGAGTGTTACCAGCGACTAAGTCAGGTTCTCTGCTTCAGCCTGTGTAGAGCAGGTCCAAGAGTGCATTTTGGTGGTGGGGCAGGTTGTGGATCAAATATGCAAAAGCAACAAAATACCGTTGCATCTTCTGATGGGCCCTAGTTCAGGCAGAACGCTTGGGCGGCAGCTAGAAATGTCATAGTAGTCACATGACACAGGAAGAGACGTCTAGAGAAGGCTGCAAAGAGCGAGGTTGATACGAGGTTTCGTAACGTTAAGTAGAGTTGTTGGGAAGTTTGCAGTTCGCTTGCCTGTCAGAGTGAAAGGTTAGAACAGGCGCTGATAGCTACGAGCAAAGGGCACAGTATTCGAGATCAAACTTGTCAGGAACAGATAGTAACGTCATCAAACCCGGCTGGGAAGCAGTAAACAGTTCTGTGAGGGGATGGACGGCCTCGGGGACGGATACGAGGCATTTGTAGAGCGATTACAATCGGATTTTGCAGCTACAAGTGCCGCTAAGAACTCAGGTCAAAACGGGAACACGACCACTCACAGCAGCCACCCTCCTCATCCCTCTCAGTCACAACTTCACCAGTCACGATATGTGGGCTACCCGTCACCAACACATGCATTCACGGTCAAGAGGGAGGCGTCACCCTCCGTATCAGAGTCATCCATGAGAACGGCTAACTCCCTTTCTATAGAGGTCTCCATGCAAGATCAGGTGACCTCGCCCGGACCTCCTAGCGTAACAGGTCCGTCTAGCTCTAGAAATCCCAGCCCAGCCAACAATTACAGCACTGATGTCAACCAGATGCCAGATACGCCCCCTCGCCGCAGGGGTCACAGGCGTGCCCAGTCGGAGATTGCTTTTCGACTCCCTGACGATGTATCCTTCGAACGTGATCTTGGTATGCATGGCTCTGAGATGCCCGCTCTTTCCGATGATGCGGCCGAAGATCTCTTTTCCATGTACATTGACATGGAGAAAATAAACTCCTTCAGCGCTACATCAGCCCCCTTGCCTGGTCCGAAGAGTACTGCAGCAGACAGCGGGTCTACACCTCCTCCCACTCACCACTCTAGAAGCTTGTCTGTAGATGGAGTGCTATCTGGATTTAACAGTGGTCGAGGTAGCATGGGCCTTTCTGGGGGAAGTGCTGGCTTTCCATCAGATGGACGCAGGTCTCGTCATCAGCATAGCAGTTCTATGGATGGCTCGACTTCCTTCAAGCATGATCTCTTGGCTGCAGAGCTTGATGGTGCAGATGCAAAGAAGGTCATGAATTCCGCAAAGCTGGCCGATATCGCACTTATTGATCCAAAGCGTGCCAAGAGAATTCTAGCCAATAGACAATCTGCCGCACGATCGAAGGAACGGAAAATGAGGTACATCTCAGAGCTTGAGCGGAAAGTGCAAACCTTGCAAACGGAGGCAACAACTCTCTCCGCGCAGCTTACCATGCTTCAGAGGGATACTACAGGTCTCACCACCGAAAACAGTGAACTTAAGCTGCGTTTGCAGGCCATGGAGCAACAAGCCCAACTTCGTGATGCACTCAATGAAGCATTGCGAGATGAAGTACAACGACTAAAGGTAGCCACAGGACAGATGAATGGATTGACTGGGCACGTTTACGGACTTGGGCAAGGGCCCCTTACAGCCCAGCAGTTGCAGCAACTCCAGCAGCAGTCCTCTCAGCAACAAGCTCACAATGACTTTCTCCAAAGAGGTACATTCGGAGGGCTTCAAACAATGAGCGGTCAAATAGGTGGTTCTTTTATCAAATCAGAAGGATCCACAATCTCTGTAAATCAAGGGAGCAGTGCTTCTTTTTGATGCATTTTATAGAGTTGGCAGGGAGTTCAGAGCAAAGGGAGTGTGACTGAATTAAGGCTATGTCTGACTCTATACTTATTCTTGAACCATGCAATCTCCGGCATAGTGCATCTAAGTTAGGCCGCACGACCATGAGATTGCAGTCCTTGGTATGTGGCCTAGTTTAGATGATGGGCTTATGCGCAAATTCTCCTGCGGTTCTGTGAATAATTGGATCCACCTTACTCGCCCTGAGTGGGGGTGCTCACTTGAAGAGCAGTGCTGGTATCTGCTCGGGTGACTTAACACTTTTACCAATTGCCACGAAGTTGTCCACTCAGTTGCCTGCTTGTTAAAGAGGGCAGATCTTTTGCAATCTAATTTTTTTGGTTCTATCACCAAGATGATGTGGAAGAATCATCAATTTCTGTTGATTGGTGCTATCGTAGGTAGTGGTAGGATGTATTGTAATAACGTTGCCCTCAAATTCATACTATATAAATTGTATTTGCGAACAATAGGTTGTTTAGCATCCCGATAGAAGGGCAGTCTGGATCTCGCAGTGTACGCTGCTTTTTGTCACTATCCAGACCCTGGAAATTCGAAGCCGGTTCTGCTCTGCCGATGAGCTTAGCGCTACAGTCCCCACAATTACACAATTATTTAGTGGAAGCTTGAGGTATGTGCAAACAAAGCTTCAGTTTTGTACCAAATGTGCGTACTTTGTTTCGAGGATTTGGTTAGAGGGGCAATCGGGTTTTCCTTGTATGATATTTTAATACTGAACTTAGCTTTATTGGACATATTTTGGTAATTTTGCCTGTTTCTTCTATGGGGAAATACTTGTTTAGTCCATAGTACTTCAACCTTGGGAAACGTGGGGATAGACTAGTTCATCCTGCTTTTGAATAATGGTCGTTTGGCGCTTCCTCGAGTCTGTTGTCCCGAAGAGATGTTATGTTCTCACACTGATGTCTAAATGTGGAGAGGGAAGTTTTGAGTCGAGGTAGACAGACAGTTCGTTCTGAATCTTGTTAGTTTCCGGTGATGTGCGGAAATTGAACTCGGTTTTGCTCAACTCGATGCTTGAAATTTGTTGAATGTTGCAGGGAAGAATATACTCGTGTGTTGAATGTTCTATGGACGTGTCACACAGTTGATTCGAGGAATCAAATGTAGTAGCCAAGTTAGCCAAGTTAGCCAAGCAGGATATGGTACAAAACAGAATTTGATCCCAACGGCTTTGATTCTGGTTGATAATGGAAAAGAAAACTGCAGAAGCAATGGTTAGAAGTGTATGGTGT

CDS

>Mapoly0007s0056.1
ATGGACGGCCTCGGGGACGGATACGAGGCATTTGTAGAGCGATTACAATCGGATTTTGCAGCTACAAGTGCCGCTAAGAACTCAGGTCAAAACGGGAACACGACCACTCACAGCAGCCACCCTCCTCATCCCTCTCAGTCACAACTTCACCAGTCACGATATGTGGGCTACCCGTCACCAACACATGCATTCACGGTCAAGAGGGAGGCGTCACCCTCCGTATCAGAGTCATCCATGAGAACGGCTAACTCCCTTTCTATAGAGGTCTCCATGCAAGATCAGGTGACCTCGCCCGGACCTCCTAGCGTAACAGGTCCGTCTAGCTCTAGAAATCCCAGCCCAGCCAACAATTACAGCACTGATGTCAACCAGATGCCAGATACGCCCCCTCGCCGCAGGGGTCACAGGCGTGCCCAGTCGGAGATTGCTTTTCGACTCCCTGACGATGTATCCTTCGAACGTGATCTTGGTATGCATGGCTCTGAGATGCCCGCTCTTTCCGATGATGCGGCCGAAGATCTCTTTTCCATGTACATTGACATGGAGAAAATAAACTCCTTCAGCGCTACATCAGCCCCCTTGCCTGGTCCGAAGAGTACTGCAGCAGACAGCGGGTCTACACCTCCTCCCACTCACCACTCTAGAAGCTTGTCTGTAGATGGAGTGCTATCTGGATTTAACAGTGGTCGAGGTAGCATGGGCCTTTCTGGGGGAAGTGCTGGCTTTCCATCAGATGGACGCAGGTCTCGTCATCAGCATAGCAGTTCTATGGATGGCTCGACTTCCTTCAAGCATGATCTCTTGGCTGCAGAGCTTGATGGTGCAGATGCAAAGAAGGTCATGAATTCCGCAAAGCTGGCCGATATCGCACTTATTGATCCAAAGCGTGCCAAGAGAATTCTAGCCAATAGACAATCTGCCGCACGATCGAAGGAACGGAAAATGAGGTACATCTCAGAGCTTGAGCGGAAAGTGCAAACCTTGCAAACGGAGGCAACAACTCTCTCCGCGCAGCTTACCATGCTTCAGAGGGATACTACAGGTCTCACCACCGAAAACAGTGAACTTAAGCTGCGTTTGCAGGCCATGGAGCAACAAGCCCAACTTCGTGATGCACTCAATGAAGCATTGCGAGATGAAGTACAACGACTAAAGGTAGCCACAGGACAGATGAATGGATTGACTGGGCACGTTTACGGACTTGGGCAAGGGCCCCTTACAGCCCAGCAGTTGCAGCAACTCCAGCAGCAGTCCTCTCAGCAACAAGCTCACAATGACTTTCTCCAAAGAGGTACATTCGGAGGGCTTCAAACAATGAGCGGTCAAATAGGTGGTTCTTTTATCAAATCAGAAGGATCCACAATCTCTGTAAATCAAGGGAGCAGTGCTTCTTTTTGA

Protein

>Mapoly0007s0056.1
MDGLGDGYEAFVERLQSDFAATSAAKNSGQNGNTTTHSSHPPHPSQSQLHQSRYVGYPSPTHAFTVKREASPSVSESSMRTANSLSIEVSMQDQVTSPGPPSVTGPSSSRNPSPANNYSTDVNQMPDTPPRRRGHRRAQSEIAFRLPDDVSFERDLGMHGSEMPALSDDAAEDLFSMYIDMEKINSFSATSAPLPGPKSTAADSGSTPPPTHHSRSLSVDGVLSGFNSGRGSMGLSGGSAGFPSDGRRSRHQHSSSMDGSTSFKHDLLAAELDGADAKKVMNSAKLADIALIDPKRAKRILANRQSAARSKERKMRYISELERKVQTLQTEATTLSAQLTMLQRDTTGLTTENSELKLRLQAMEQQAQLRDALNEALRDEVQRLKVATGQMNGLTGHVYGLGQGPLTAQQLQQLQQQSSQQQAHNDFLQRGTFGGLQTMSGQIGGSFIKSEGSTISVNQGSSASF

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>