Mapoly0007s0221



Description

Homeobox domain // Homeobox associated leucine zipper

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0005634 Nucleus
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
KEGGORTH K09338 Homeobox-leucine zipper protein
KOG KOG0484 Transcription factor PHOX2/ARIX, contains HOX domain
OrthoMCL OG5_133011
PFAM PF00046 Homeobox domain
PFAM PF02183 Homeobox associated leucine zipper
PANTHER PTHR24326 FAMILY NOT NAMED
PANTHER PTHR24326:SF171

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC1HDZ Homeodomain protein Public
MpHD3 transcription factor, HD Mapoly0007s0221.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0007s0221.1 scaffold_7:2396122..2400147  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0007s0221.1  

Gene structure:

mRNA scaffold_7:2396122..2400147  ( - strand )
three_prime_UTR scaffold_7:2396122..2397363  ( - strand )
CDS scaffold_7:2397364..2398032  ( - strand )
CDS scaffold_7:2398205..2398611  ( - strand )
CDS scaffold_7:2398837..2398957  ( - strand )
five_prime_UTR scaffold_7:2398958..2400147  ( - strand )

Sequences:

Gene

>Mapoly0007s0221.1
AGAGAGAGAGAGAGAGNNNNNNNNNNNNNNNNNNNNGAGAGAGAGAGAGAGAATGCGAGATACGTCCGACACATAAAGCCGAAGACTGACTGACGGAAGGAGCGGAAGATCGGATTCTCTGGGAGGTTGGAGTCATAGCGAGAGCGAGAGGAGCTGCTCCAGGTTGGGGTGATAAGAGGTTCACGACTAGGTGGGTGTCGGTGGCGGTGGAGGTGAAAGAAACTGTAATTGGAGTCGGAGGCGCGGTTTCGAAGGGAAGATTAAGGAGTTAAGCTCGCACGCACGAGCGATTGGTCGCTGTCGCTCATCCTGCGGCTCCCCCGCTGGACATTGCTCGCGAAAGAGGGCTCAGAGGGCAGCCGGGGCGAATTTTTTCTCTGAAGCAGCAGCCCGCGGTCGCCTTCAATCGGGCACGACGAAGATTAGACGTAGACAGTGAGCCCAGGCCGCGCGGACCCACGAGAGAAAGAGAGGTTTGGACGGCGAGTTTAGCCCCCGGCAAATCAAATCCCCGCTGCGGATGCTGTGCTCGAATGCTCGCCTGCGCTGGCGCATTTCTGACGAGGATCTGAGCAGCTCCGCCCGCTTCCCCCCGTGGCTCGCCCTCTCGCGCTGCCACCATTTCTTGATTTGACTCCCCCGGGCCCTCCCGCCTGCAGTCAAAGCGCCAGGACGACAGCCCATCACCTGCGCTTGCAGCAGGACAGGTCTCGTGCTGCTCAAGAAGCAGCAGCACAAAAGAGCTAGAGAGCGAGAGAGTCATTGCAGTGGCGGCGTGAAAGAGGAACAGATTCGGCCACCATCCCATCCCATGCACAGCAGCAGAGCCACGGGCGTAGATGTTCTACCATCCCTCGCTTCCCTTCGTTGTGGACGCTCGAGCTCGCGCTTATAAACATCAGGCTTCTTCAAGCGCCAGCGCTCACCAAATTGCTCCCAGCTCGAGCTGAGTTTGCGCCGCTCGCTCGCTCTCTCGCGGCCCCTCTCGTCGGCTGTATGCATCTTGAGGGCGATGGAGCTCACGAGTTCCTAGGAACCGGAAAACAGGAATGCTGGTGTCTTAGAACCTCTGTCTGCGGTCTTGAAACGAATGCATTTTTGGCCTACAATTGCCCGTGGAGCTCAAGAGGACTTGCTCGTCGCCGCAGCCTAAGACATCCGGGCCACCGGGTTGTTCTTCAGCAGCATATATGATGGCGGCTAGCGCTCGCGCGTATAATGCAGCCAATGTGATGCTCATGCGGAGCGAGAGCACCTCGGCCGACACCTTGGTGGCCATGCTCGCCTCGTGCGGCGCACCGGGCATGCAAGGTCAGTAGTTCTCTCTACCTCTTCCCCTCTCTGGTCTCGAATTGCACACCTCGTTCTGGATTCCGAAATGCAACTCGATCTGATCCGCGTGCCGATCGGTAATGCTTAATTGGCTCGAGAGCCCACGAGTCTTGAATTGTCGAGAGGCGAGGAGAGCGGAGGGAATTGGGCCGAGAGCCGAGAGCTGACGATGGGTTTGCGATGGGTGTGTCATTGTGTGCGCAGCTCCTCGATCCGTGGGGGTCGGAGGATTGGAGGAGGCGGTCATGGGAGGTGGGCAGAAGCGCCCCTTCTACCCGATTTTCGACACATCGGAGGACAATGGCGACGACGACGGCGGCGACGACTGCTCGCACCACGTCGAGAAGAAGCGCCGGCTCACCACCGATCAAGTCAAGTCGCTCGAGAAGAACTTCGAGCTCGAGAACAAGCTCGAGCCCGAGCGCAAGCTGCAGCTGGCTCGCGAGCTCGGCCTCCAGCCTCGCCAGGTCGCGGTCTGGTTCCAAAACCGTCGCGCTCGCTGGAAAACCAAACAGCTCGAGCGCGATTACGACGTGCTCAAGTCCGACTACGACAACCTCAAGGCCAGCTTCGACACCATCGTCGCCGAGAAAGAAAAGCTCCAGGCCGAGGTCAGTAGCTCTCCTCTCCCCACACCCTCTCGTGCTTTTGACATAGTCCAGCTCGATGCCTCGAGAGTTGCATTGCGGAGCTGAGGATCTGGCTTGACTCGGTGGGATCTGGACTCGAGTGTGCGACGTGGGGGGCTAACTTTGTTACGTGGGGCTTGATTATGATGCTCAGGTGCTGCAGCTGACGAGCAAGCTCCAGGCCAAAGAGAAGCAAAGGAAGCTGGACGGGGCGGCGGGGCAGGTGTTCGAGGCCGAGGAGCTCGAAGTGGCGGTGAATAATCTGTCGCCGCATGCGCATTTGGATGTGGTGGTGCCGAGCATGAAGTCCGAGCTGCCCACGCACCAACACTTGGTTCAGGAGTTTCAGCAGCAGCAGCAGCAGCAGCAACAACAACAGCAGCAGCAAATGGGAACGCCTCCGGCGACGACCGAGAGTCTGGTCAAGTGCAAGGACAAGGAGGGATCGACGAGCTCCGAGAGCAATTCGAGCGAGATTATGAACGCCGACAGCCCGCACCCAATTGACAGCGGTCTGAGCCCCGGCGTGGACCAGAAGCTCATCCAGTGCTCGTCCGGGTTCTCGCTGGGCGGAGGCGGAGGAGGAGGAGGCGCTGCGGCCGCGGCCGCAGCCGCAGCTGCTGCGGACACGGGCGTCGAGACGTCGCTGGTGCAATTCGCCGAAGAGCTGTGCGGCGGCGCCCGATTGGTCCCGCCTCAAGGATACCAGAGAATTTCCGTCAAACTCGAAGATGGCTCCAATGTGCTCCAAGACGAGTGTAATTACTACTTCCATCAGATGGACGCCGATCAGGCCTCTCTCCCTTGGTGGGAGTGGCCCTGAGCCGAGGTCCACGCTTGACCGTCCACGGATTCCTGGATTTCGCCCTCGAGCTCTCGGTGCAGCAGCAGCAGCAGCAGACGTAGTAGAATCAGAAGACGACGACAGAAGAGGGTGCTACGGAATCGAATCGTAGGGTCCATCCGGACAAGATTTTGCTCCGCAACAGGAGCTCGGGAAGGAACGATGATCATCATGCCTATCACGACGACGAAGACCATGGAGACGGGAGGAGTACACGACGGCGACGGCGACGACGACAACGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGCATGAACGAACGACTGCACGAAGCGAGGGCTTGTGGTCTCCGGAGTCAGTCCGAGTCTCGCGATATCCGAGAAGTTCCACGAGCTGGAAGCCTTCTGACGGGTGCACGGGACTGGTCTACGTGAGAAATTTGTCTGTCCGCCACCATCGTCGCCACCACCACACCACCACCACCACCATCACCAGCACAGCACAGCCGCACGTGAACGTACAGCAGGTCTGCGAACGCAGTCGTTCGCATCCGGAAGAAGGCTCCGGGAATTTGCTGTAGAGGAGAGGAGAGGAGAGGAGAGGAGGAGCGGGAGGAGTATAGGATGGAAAGAAGAGGAGGAGGAGGAGGAGGAGGTTTTGAGGATTTAGTATAGCGCGAGAGAATCGAAACTTTGCTCTGCTGTTACACTCATTTTGTTTACGCTGGCTTGAGGAGCGCGAAATGATGTAACATCAGTGCATTTGTATCAAGATATTGCTTTAGGGTACATATCAATAACATACGCAGAGGACCTGTCCGTCCATTTTCACCGAGAGGTTCTTGTGCAGGTCAGGTCACACCCCCTTTCCCCGCGGTTCTCCCACCGAGGGGAAATTGAATCCAAGTGGAGTGAAGCTCAGTGAGCACGATGATGATGATCGACCCATCCGATCCAACTGCAGTAGCAGCAGCAGCAGCCGCAGCCGCAGCATGCACGCTAGCTCGCTCGCTCGCTCGCTCGCTGCACTCGTCGTCTGCCTTGTTCTTCTAGGCAGCAGCCCCCAACCCCACTGGCTTGCCGAACGCAGCCTTTTACTGTATAGTCTTTGCAATAAATTTTAGTCTTGTCGACATGACCCCCGCAAACAGAGTGCAGCCGCAGCAGCAGCAGCAGCCACCCCACCTCCCCCCACCGTCCACTACATTTTGCTTCTCCGAAGCCTGTGCAGCATTTTTGTTAACTAATAAAACTT

mRNA

>Mapoly0007s0221.1
AGAGAGAGAGAGAGAGNNNNNNNNNNNNNNNNNNNNGAGAGAGAGAGAGAGAATGCGAGATACGTCCGACACATAAAGCCGAAGACTGACTGACGGAAGGAGCGGAAGATCGGATTCTCTGGGAGGTTGGAGTCATAGCGAGAGCGAGAGGAGCTGCTCCAGGTTGGGGTGATAAGAGGTTCACGACTAGGTGGGTGTCGGTGGCGGTGGAGGTGAAAGAAACTGTAATTGGAGTCGGAGGCGCGGTTTCGAAGGGAAGATTAAGGAGTTAAGCTCGCACGCACGAGCGATTGGTCGCTGTCGCTCATCCTGCGGCTCCCCCGCTGGACATTGCTCGCGAAAGAGGGCTCAGAGGGCAGCCGGGGCGAATTTTTTCTCTGAAGCAGCAGCCCGCGGTCGCCTTCAATCGGGCACGACGAAGATTAGACGTAGACAGTGAGCCCAGGCCGCGCGGACCCACGAGAGAAAGAGAGGTTTGGACGGCGAGTTTAGCCCCCGGCAAATCAAATCCCCGCTGCGGATGCTGTGCTCGAATGCTCGCCTGCGCTGGCGCATTTCTGACGAGGATCTGAGCAGCTCCGCCCGCTTCCCCCCGTGGCTCGCCCTCTCGCGCTGCCACCATTTCTTGATTTGACTCCCCCGGGCCCTCCCGCCTGCAGTCAAAGCGCCAGGACGACAGCCCATCACCTGCGCTTGCAGCAGGACAGGTCTCGTGCTGCTCAAGAAGCAGCAGCACAAAAGAGCTAGAGAGCGAGAGAGTCATTGCAGTGGCGGCGTGAAAGAGGAACAGATTCGGCCACCATCCCATCCCATGCACAGCAGCAGAGCCACGGGCGTAGATGTTCTACCATCCCTCGCTTCCCTTCGTTGTGGACGCTCGAGCTCGCGCTTATAAACATCAGGCTTCTTCAAGCGCCAGCGCTCACCAAATTGCTCCCAGCTCGAGCTGAGTTTGCGCCGCTCGCTCGCTCTCTCGCGGCCCCTCTCGTCGGCTGTATGCATCTTGAGGGCGATGGAGCTCACGAGTTCCTAGGAACCGGAAAACAGGAATGCTGGTGTCTTAGAACCTCTGTCTGCGGTCTTGAAACGAATGCATTTTTGGCCTACAATTGCCCGTGGAGCTCAAGAGGACTTGCTCGTCGCCGCAGCCTAAGACATCCGGGCCACCGGGTTGTTCTTCAGCAGCATATATGATGGCGGCTAGCGCTCGCGCGTATAATGCAGCCAATGTGATGCTCATGCGGAGCGAGAGCACCTCGGCCGACACCTTGGTGGCCATGCTCGCCTCGTGCGGCGCACCGGGCATGCAAGCTCCTCGATCCGTGGGGGTCGGAGGATTGGAGGAGGCGGTCATGGGAGGTGGGCAGAAGCGCCCCTTCTACCCGATTTTCGACACATCGGAGGACAATGGCGACGACGACGGCGGCGACGACTGCTCGCACCACGTCGAGAAGAAGCGCCGGCTCACCACCGATCAAGTCAAGTCGCTCGAGAAGAACTTCGAGCTCGAGAACAAGCTCGAGCCCGAGCGCAAGCTGCAGCTGGCTCGCGAGCTCGGCCTCCAGCCTCGCCAGGTCGCGGTCTGGTTCCAAAACCGTCGCGCTCGCTGGAAAACCAAACAGCTCGAGCGCGATTACGACGTGCTCAAGTCCGACTACGACAACCTCAAGGCCAGCTTCGACACCATCGTCGCCGAGAAAGAAAAGCTCCAGGCCGAGGTGCTGCAGCTGACGAGCAAGCTCCAGGCCAAAGAGAAGCAAAGGAAGCTGGACGGGGCGGCGGGGCAGGTGTTCGAGGCCGAGGAGCTCGAAGTGGCGGTGAATAATCTGTCGCCGCATGCGCATTTGGATGTGGTGGTGCCGAGCATGAAGTCCGAGCTGCCCACGCACCAACACTTGGTTCAGGAGTTTCAGCAGCAGCAGCAGCAGCAGCAACAACAACAGCAGCAGCAAATGGGAACGCCTCCGGCGACGACCGAGAGTCTGGTCAAGTGCAAGGACAAGGAGGGATCGACGAGCTCCGAGAGCAATTCGAGCGAGATTATGAACGCCGACAGCCCGCACCCAATTGACAGCGGTCTGAGCCCCGGCGTGGACCAGAAGCTCATCCAGTGCTCGTCCGGGTTCTCGCTGGGCGGAGGCGGAGGAGGAGGAGGCGCTGCGGCCGCGGCCGCAGCCGCAGCTGCTGCGGACACGGGCGTCGAGACGTCGCTGGTGCAATTCGCCGAAGAGCTGTGCGGCGGCGCCCGATTGGTCCCGCCTCAAGGATACCAGAGAATTTCCGTCAAACTCGAAGATGGCTCCAATGTGCTCCAAGACGAGTGTAATTACTACTTCCATCAGATGGACGCCGATCAGGCCTCTCTCCCTTGGTGGGAGTGGCCCTGAGCCGAGGTCCACGCTTGACCGTCCACGGATTCCTGGATTTCGCCCTCGAGCTCTCGGTGCAGCAGCAGCAGCAGCAGACGTAGTAGAATCAGAAGACGACGACAGAAGAGGGTGCTACGGAATCGAATCGTAGGGTCCATCCGGACAAGATTTTGCTCCGCAACAGGAGCTCGGGAAGGAACGATGATCATCATGCCTATCACGACGACGAAGACCATGGAGACGGGAGGAGTACACGACGGCGACGGCGACGACGACAACGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGCATGAACGAACGACTGCACGAAGCGAGGGCTTGTGGTCTCCGGAGTCAGTCCGAGTCTCGCGATATCCGAGAAGTTCCACGAGCTGGAAGCCTTCTGACGGGTGCACGGGACTGGTCTACGTGAGAAATTTGTCTGTCCGCCACCATCGTCGCCACCACCACACCACCACCACCACCATCACCAGCACAGCACAGCCGCACGTGAACGTACAGCAGGTCTGCGAACGCAGTCGTTCGCATCCGGAAGAAGGCTCCGGGAATTTGCTGTAGAGGAGAGGAGAGGAGAGGAGAGGAGGAGCGGGAGGAGTATAGGATGGAAAGAAGAGGAGGAGGAGGAGGAGGAGGTTTTGAGGATTTAGTATAGCGCGAGAGAATCGAAACTTTGCTCTGCTGTTACACTCATTTTGTTTACGCTGGCTTGAGGAGCGCGAAATGATGTAACATCAGTGCATTTGTATCAAGATATTGCTTTAGGGTACATATCAATAACATACGCAGAGGACCTGTCCGTCCATTTTCACCGAGAGGTTCTTGTGCAGGTCAGGTCACACCCCCTTTCCCCGCGGTTCTCCCACCGAGGGGAAATTGAATCCAAGTGGAGTGAAGCTCAGTGAGCACGATGATGATGATCGACCCATCCGATCCAACTGCAGTAGCAGCAGCAGCAGCCGCAGCCGCAGCATGCACGCTAGCTCGCTCGCTCGCTCGCTCGCTGCACTCGTCGTCTGCCTTGTTCTTCTAGGCAGCAGCCCCCAACCCCACTGGCTTGCCGAACGCAGCCTTTTACTGTATAGTCTTTGCAATAAATTTTAGTCTTGTCGACATGACCCCCGCAAACAGAGTGCAGCCGCAGCAGCAGCAGCAGCCACCCCACCTCCCCCCACCGTCCACTACATTTTGCTTCTCCGAAGCCTGTGCAGCATTTTTGTTAACTAATAAAACTT

CDS

>Mapoly0007s0221.1
ATGATGGCGGCTAGCGCTCGCGCGTATAATGCAGCCAATGTGATGCTCATGCGGAGCGAGAGCACCTCGGCCGACACCTTGGTGGCCATGCTCGCCTCGTGCGGCGCACCGGGCATGCAAGCTCCTCGATCCGTGGGGGTCGGAGGATTGGAGGAGGCGGTCATGGGAGGTGGGCAGAAGCGCCCCTTCTACCCGATTTTCGACACATCGGAGGACAATGGCGACGACGACGGCGGCGACGACTGCTCGCACCACGTCGAGAAGAAGCGCCGGCTCACCACCGATCAAGTCAAGTCGCTCGAGAAGAACTTCGAGCTCGAGAACAAGCTCGAGCCCGAGCGCAAGCTGCAGCTGGCTCGCGAGCTCGGCCTCCAGCCTCGCCAGGTCGCGGTCTGGTTCCAAAACCGTCGCGCTCGCTGGAAAACCAAACAGCTCGAGCGCGATTACGACGTGCTCAAGTCCGACTACGACAACCTCAAGGCCAGCTTCGACACCATCGTCGCCGAGAAAGAAAAGCTCCAGGCCGAGGTGCTGCAGCTGACGAGCAAGCTCCAGGCCAAAGAGAAGCAAAGGAAGCTGGACGGGGCGGCGGGGCAGGTGTTCGAGGCCGAGGAGCTCGAAGTGGCGGTGAATAATCTGTCGCCGCATGCGCATTTGGATGTGGTGGTGCCGAGCATGAAGTCCGAGCTGCCCACGCACCAACACTTGGTTCAGGAGTTTCAGCAGCAGCAGCAGCAGCAGCAACAACAACAGCAGCAGCAAATGGGAACGCCTCCGGCGACGACCGAGAGTCTGGTCAAGTGCAAGGACAAGGAGGGATCGACGAGCTCCGAGAGCAATTCGAGCGAGATTATGAACGCCGACAGCCCGCACCCAATTGACAGCGGTCTGAGCCCCGGCGTGGACCAGAAGCTCATCCAGTGCTCGTCCGGGTTCTCGCTGGGCGGAGGCGGAGGAGGAGGAGGCGCTGCGGCCGCGGCCGCAGCCGCAGCTGCTGCGGACACGGGCGTCGAGACGTCGCTGGTGCAATTCGCCGAAGAGCTGTGCGGCGGCGCCCGATTGGTCCCGCCTCAAGGATACCAGAGAATTTCCGTCAAACTCGAAGATGGCTCCAATGTGCTCCAAGACGAGTGTAATTACTACTTCCATCAGATGGACGCCGATCAGGCCTCTCTCCCTTGGTGGGAGTGGCCCTGA

Protein

>Mapoly0007s0221.1
MMAASARAYNAANVMLMRSESTSADTLVAMLASCGAPGMQAPRSVGVGGLEEAVMGGGQKRPFYPIFDTSEDNGDDDGGDDCSHHVEKKRRLTTDQVKSLEKNFELENKLEPERKLQLARELGLQPRQVAVWFQNRRARWKTKQLERDYDVLKSDYDNLKASFDTIVAEKEKLQAEVLQLTSKLQAKEKQRKLDGAAGQVFEAEELEVAVNNLSPHAHLDVVVPSMKSELPTHQHLVQEFQQQQQQQQQQQQQQMGTPPATTESLVKCKDKEGSTSSESNSSEIMNADSPHPIDSGLSPGVDQKLIQCSSGFSLGGGGGGGGAAAAAAAAAAADTGVETSLVQFAEELCGGARLVPPQGYQRISVKLEDGSNVLQDECNYYFHQMDADQASLPWWEWP

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>