Mapoly0008s0016



Description

TELOMERIC REPEAT BINDING PROTEIN 1

Reference DB

Database ID Description
GO GO:0003682 Chromatin binding
OrthoMCL OG5_160347
PFAM PF00249 Myb-like DNA-binding domain
PANTHER PTHR21717 TELOMERIC REPEAT BINDING PROTEIN
PANTHER PTHR21717:SF9 TELOMERIC REPEAT BINDING PROTEIN 1

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB3 transcription factor, MYB Mapoly0008s0016.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0008s0016.1 scaffold_8:170176..176622  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0008s0016.2 scaffold_8:170176..176622  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0008s0016.3 scaffold_8:170176..176622  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0008s0016.1  

Gene structure:

mRNA scaffold_8:170176..176622  ( + strand )
five_prime_UTR scaffold_8:170176..170567  ( + strand )
five_prime_UTR scaffold_8:171504..171650  ( + strand )
five_prime_UTR scaffold_8:171852..171876  ( + strand )
CDS scaffold_8:171877..172011  ( + strand )
CDS scaffold_8:172515..172704  ( + strand )
CDS scaffold_8:173030..173088  ( + strand )
CDS scaffold_8:173276..174469  ( + strand )
CDS scaffold_8:174652..174786  ( + strand )
CDS scaffold_8:175003..175314  ( + strand )
CDS scaffold_8:175760..175816  ( + strand )
CDS scaffold_8:176104..176256  ( + strand )
three_prime_UTR scaffold_8:176257..176622  ( + strand )

Sequences:

Gene

>Mapoly0008s0016.1
CACGGAGAGGATGCTGCACTTACGAGAATATTAGTGGGAATAAACAGGTTTAGGAGACTGACGTCGTAGAGCGAGGATTAACGTTTCTTTGTACTCAGGGGCTTGGGCAACAGTTGTTCATCCGTCTCTCTTTGTCTCTGGCTCTCCCTGGCTATGGCCGTTCGTTCTTCTGGATCTTTCTCTGTCATCAGGCGCTGATTTCAGGGGCTCAGATGCAGGGGATGACACTCTTGGGCCTGGAGATGATTGTCAAACTCTGAATTGCGAGGTTCTGTTTAGACTGCAGTGCATGTGGACAGTGCAATCGAGCAGTTGAAAGGGAGGAGGGAGGGAGTCATGTAGGTGGGAAAAGCGCGAGAGCAGTACGACAGGATTTCTATCTTTCTGTGCAGGTTTGTAGTCTTCAGATCCGCTTTGCACTTCTGTGGTGCTGCGTGGGTATGGATCGGTGTAGGATATGTAGCACTGAAGATAGAGGACTGAGAAATTCTTGACGAGGCTGGTGTTTGTAATAGGTCCGCACGCACCTCAATTTGTAGATAGTTGATGAGCACCGTATTTTCTTGGGCTTCGGAGTTTCCGAATTGTATTTCCTTACATGAAAAATTGAAACAAAATTCCTTCTGTGCTCATTGCCAGATCAACTTCTTTGACTTTTTCTCGCGTTTCTTTTTCAATATGCAGATTTGTAAGTTGAGTTTGCTTTTTACATTTCTTCTCTGATATCAGTCTTAGTCTGGAGAAGTCCTGTGCTTTTGATCCTCCAAACATTGCTTCACAGCTTTGGATTTGCTGTGCCAGGTTTCTTTCTTTTGACTTAGCCAATTTTATCTATCTTTTTGTCCGGTCTCACTGCATCCGTGCTGTCTGGTGATGTCCAAAGCCAATGACAATTATATTTCTTGATTTCCTGCAACTTGGGCTGGGATTAGATGATTTTGCTGTGTTTGATTTTATCAGAAGGTTTCAATCGCAGTTTTTCCATTGGCATTACCGCTCTGTGGATTTACTAACGTCCCGTGTCATCATCAAGATCGCTCTTTTTTGCCGCCAATTGCACGGACAAGCATCCAAGCAATGTGATTTGTTGCAATCTCTCCGTTTAGTCATGAGTTTCAAGATGTGAAATCCTCGATGGATGGAGTATTGAAAACTTTCAGACATGTAAATTTAACAAGATATCCGGATTCTCTCAACCATATCTCTTGAGGTAACATGCATGTGTAACATTACAGTGTGAACTTGTATCTAGTATTTCGCTGAAAGGGACAGTTCAATTGAATTGTAATCTTTCAAGCTTGTGCTGATTCAGATTTTGTTTGTGGCAGTATGCAGTTGCACCCTAGATGACTATCGACGCGTTTTCTGGTCGATGAATTGGGCATTCCTGTCTGATTGTTAGATAGGTAGATCGTGAGACATTTTTCCTTCCTATTGGAAAGTCACCCAGCGGTTTCTTTCTTTTGATTGTCAAGGTTGTGCTCTGCCGGTGCAAATGAAATTTTATCTAAACGTTTCATTGCTGGTCTTGAGAGATAGCTGAATAATTTTTAAATTTTAAGAAATATCTAGACCCCTGCATGTGCAAGTCAGTCTAGTGATGAGCTTGATTATTCACAAATGAAAACCTTTGTCTTTCAAGTAATGAGGACGGGATAAATTTGTTGTCTATGCAGCGGACGTATATGCTGGTTGTGAGTTATGCTGGACTCAACACTTCTCGAGAGCAAAGGCACTCCAGGTCAAGTAGCAGGCAAAGATGGAGTGCCGTCACTAACAGCTCCGAAAATCCTTGATGAAGTATTCGTTGATGAGGTCGTGTTGACGACTGTCAAGGTTAGCCCTGTTTAAAATATCCTCTAATTCTTCCTAATCTGACAATTTGTAAATTATGGTTCACCTTTTTGTGCTACAGCTGGCTATCTTAGCTCCTCGAGCAAGCTAGCTACTAGAGGCGCACTCATTTATTTAACACAGAAATTTAAACTTTTGCAGAGATCGCTAACTTGGTAATCTTGTGCAGCACTCCACGTACAAATTAGATTGTTGATTTAATCGGCGTTCGTAGATTTTCGAATTTATACAACATCTAGATTTGGATGATCTGAATATTTTATGATTCCATCGAAGAAACGGACTCGATGGTTCAAGTAGTTATTGGAGTTAACGATCTAAATTGACCTCTATGATAGCCTTGGTTGCTCAGTTTCTCTGTACAGTTAACCTGGCCTTTCCCCATCAGTCTATTTCTCATGACCACTATAATCGGTGACGATAATAGTAACACGCTGACTCCTAGTCACTGCAATAATTATATTTCTTCCAATCGGAGTATGCAGGATAGAGCTGACGAGAAATTTCTGCCTTCAACGGAAGATGCAAATATTGAGATGAACTCGTTGTCAGTTGCGGAAGCAGATCCATCTCAAAACTTTCTGAATGACGACGAGCACATGATTCACTTTGATGGTGACATGGATCAAGAATCAGATACAGATGATGATTCGGATGAGAAAGATGGATCAACAGGTAAAATTTCCTATTCTTCTCTGTCAATTGTACATTAGCATTTTGCGGTACGGTCTGTCTATAATGAAATAAGATTCCACTCTCCTTGAAACGCGTTAACCCATCCATGAAAGAAATTATGACACTATGTCAACATATAAAAAAGATTCATGTAGTCAATTTTTTCTTTCTTTTATGGTCAATACTATTCTGTGTTGCACTGATACATCAAAGGACACCTCTAGGAAAGAGCTATTTATGAATGGCTTGCATAATTTTGTGCTCTTGAAACTGCTGCTGAAGAAAATATTATCAAGTGATTTTTGGCGCTTGTTGCGAAGTGCAGCTCTGCTTGAAGATTCCGATCCAACAGCTCAGAAGAGGAATTTACTTGCACGTTTAAAGGTAGGATGGATGCAACATGTTTGTTTTAGATGACTTTTAGTTAATTCGTACCTCCCACTTAAATACAACATCAACGGTCTCGAGTTACACTGCTTGATTGTGATAATTCTATTTTTAAGAAAAGCTGTTTGTTTAACAGTCATCCACATGTCTTTTGAGTCATAGTCTGAATGGGTTCATTTTACAGGTTGTGGAAGCCATGCTTCAGCAAGTGGCAAAAGAGGAACAATTGCGAACTCAACGAGAAGCCTCATTTACTAAAGCAGGCACCAACAATAGAGTCATCTCTACTTCCCCTGTCCTCGCTGAAAACGGAGTCGATCATAAAAGACAGAGGCGGCCAAATCCGAAGTACTTTGACGCAGAGATAGACGCTGAGTTCCAAATATCTGGAAGCTCTCTACTAGCCCGTGCTTCCTTTGGAGAGGGCGGAACAGGGGTTGTCAACATTCCTGACTCCCAGCCATTGCAAAATGGAGAAAATACTACAACAGCTGCAGTTACAAGCATATCACCACCAGATTACCTGAATCGCATACGTCCACCCATGATTCAGCGAGCTCGGACCGCGCTTGCACAAAAACATCGTGTGTTTTCTCTGTCCGAGAGCTCAACGGTGGCAGTGAAAACTGATAGTAATCTGGATAATTTATCAATTAGAGAGCTACATGAGGCTTACAGGAAAGCTTTTGGTAGAGATACGTCTGTAAAAGATAAGCACTGGTTGAAACGTCAAATCTTCATGGGTTTGAGCAAACAGAATGCAACTAGCAATGGCAAGGAAAATAATCGATCAAAGTCTACGTTGACCGACTCCAACTTGAAATCTAGGGCGGAAAAGATCTCTTCTGCAGAAGCGCCTCTTGTGACGTTCTCCACTGTTGGTGTCAATGGGAAGAGGAAGAGCAAGGGAACCGAGGCAATTTTCAGTCCTCATGAATGTAAGAAGGCACACCGGAAGACACTATCCTTGTCAGGACTATCACCCTTGAATTCTCCAAATCCAGGAATTACTGGGGATTGCAGCGGAGGAACCAATCAAGAGGGAACTCTCAGTGTGGTGCAGACTTCTGGAAGTTTGGTTGGGGAAAAGAGAATTCGAAAACCGAACCGCAGATATATCGAGGATGAAGGAGATGAATCCCTGGGACTCGCTGCTAATGGTAGCAGGTCAGTACTTAGTACACTTCCAGACGCTGGGAATGGGCTTCGGTCTGCTCCGCTAAGATTATCTTGGAAGAATGATGCGGAAGTTGTTGAGGCTGAGAGCAAAATCAACGTAATTAGAAATAAAAGCCTACGAGCTTCGACGCGGTCAACGTCTTCGATCCGATCGACATCTTCTAATGGAAGACGCAGCAAGCATGGCAACAACGGCATCGTAAGTATCTCCCAACAATATAAGGAAATCTTATTATGAAACTTATGATTGTTATAATTTTGCCAGACTAACTTGTATATTACTCAATTATGTACACAACCACAAACTGACCTCTCCTCATGAGATAAAACATGAAACCAATTCACTGCGAGGAATTGACTGTTGTTGGTGTTCTTTCACAGCAAAAGAAAAAGATTGATTCGCGGGCTGCAAAGCTTGTGAAAATAGCACATTCTGCCCGAGCTGCCCGGCTTGATATACAGAAAACAATCCGCAAAGTGAAGTTTAGGTTACCAGCAGCTCCTGGTCAGGAAAAGGTATTTCATTCGAAAAATCCTCACCACCAGGATGGAAGGTTTCATAGTCAAATAGGGAAAGTAAGATGCAATACTAATCGTAACCTTGCTTGACATCTGCATTGCTATTTGACTTGTCTGAAGAACTAGAGTAATCTACCACCTCCTTCGCAGAAAGGTGAAATTTAGAACTAAGATACACTTCCCTAAGGTTCAGATGTTCGTCGTCAATGGCAGGGTGAGGTGTTAAACGGTGGAGATGGAGAACAGGTATCGTGTTTGCTGCCGGTACGAATCGACGAAACCATAGGAGACCATGAACTGCTAAATTCTCAGTATCAAACCAGATCGGAATCAAATGATGAACAGGCTGTGGTGACAGTGCCCACAGCCAATGGCGGCACACGCCGTAAACATCATAGACCTTGGACCCTTCGGGAGGTTCTTACCCTCGTGGAAGGGGTAGCTCGATGTGGGGGTGGGAAATGGGCTGATATAAAGAAGCTGGCATTTTCCACCGTTAGTTATCGTACAGCGGTTGATTTAAAGGTGAGGTCCATCTTGCTCTCAAATTCGTACTCGTTCGTTGTGGATAGGGTGTTGATGGGTGTGTGGATATGATTATATGTTCATGTATTTTGGATTACAAATCTTTGTTCTCTATGGTCTTCTGGATAACAGACTTTATAAAATGGAAGATCATGTTACTCGCCCTCACTGTTTAGATTTGAGTTCTGTTCATATCATTTCATTGATTGATTTCAAGTGATATTGTTATGGGTGGATCTTTTACGAATAGATATGAGACCACCCTGAACGCGGACGGGATTTTAGGCTCTGCCAGGATCAGACTACTAAATAGATAAACATAGAATATACTACCGAGTAATTTCTGTCTATACAGTGAAAGGTTGACAACGTGATGAATATCCATGTTGATGTTGATCCATGTGAATATGTATCTAATTACTTTAGAGCTGTGTCAATATATCAGGATAAATGGCGCAACCTTTTACGAGCGAGTAGAGCCCAGTTACACCCTCCCAAACAGGTAACCTTCGTCAATTTTTTTCATGCATAGCTTCTGCCAGCTTTTAGGAGGTCATCTTGCTCAATTGTTGAGTCTTAACTTGTGTTGTCTGAATGAGCCACTTCTGCTGTTTATCTCATCTGATTCTTGTCCATTAATGTAGTACTATTATCTCAAGAGAGCTCATGTTCTGATTGTATGGAGATTTAAGGGTTGGTGATTCTGCTATTCAAGATAACGTCAATCAACCTTGTGCTCATTTGAAAGCTTACCTACCGAGCTACGTCTGCTTCTGTTTGACAATGCAGGGAGAAACGCGCAAGAAGCAGTTTTCTGCTGCCATACCGTCGCAGCTACTTGCCAGAGTGAGGGAACTAGCTGCTCTCAATAACCAAGCTGTATCAAACGTCAGTGCAGGAAGTAGCACTAGCAGAAGTGGACGAGTTGTACATAGAAGATAACACCTACCTAAAGAGGCGGAGGTCTTAGCAAAGATGTATATGTAGTTCAATCATGTATATGTGTATGTACACTATTCAGCTTCCTCATAAATCACTTACTACAGCATATTTCACTCAAAGATGTAGACCTTATCTTCCACTTGTACTATAATTAGTGTAGTATGGCACCATGTAGCGCCAGGTAGAGCTCGAGGATGCCCGGGAATGATAGATACCCTGCTTTTGGTTTCAGTAAACAGATGACGGACCTCAGTTCCGTACTGTGATGTGCTCAAATTGGTTAGCTTTCATATACAGAAGCCATGTGATACACATCATTTTTGTTTTGATTAGTAAGATATTACTATATCTCTATAAAGTGTCCCA

mRNA

>Mapoly0008s0016.1
CACGGAGAGGATGCTGCACTTACGAGAATATTAGTGGGAATAAACAGGTTTAGGAGACTGACGTCGTAGAGCGAGGATTAACGTTTCTTTGTACTCAGGGGCTTGGGCAACAGTTGTTCATCCGTCTCTCTTTGTCTCTGGCTCTCCCTGGCTATGGCCGTTCGTTCTTCTGGATCTTTCTCTGTCATCAGGCGCTGATTTCAGGGGCTCAGATGCAGGGGATGACACTCTTGGGCCTGGAGATGATTGTCAAACTCTGAATTGCGAGGTTCTGTTTAGACTGCAGTGCATGTGGACAGTGCAATCGAGCAGTTGAAAGGGAGGAGGGAGGGAGTCATGTAGGTGGGAAAAGCGCGAGAGCAGTACGACAGGATTTCTATCTTTCTGTGCAGTATGCAGTTGCACCCTAGATGACTATCGACGCGTTTTCTGGTCGATGAATTGGGCATTCCTGTCTGATTGTTAGATAGGTAGATCGTGAGACATTTTTCCTTCCTATTGGAAAGTCACCCAGCGGTTTCTTTCTTTTGATTGTCAAGCGGACGTATATGCTGGTTGTGAGTTATGCTGGACTCAACACTTCTCGAGAGCAAAGGCACTCCAGGTCAAGTAGCAGGCAAAGATGGAGTGCCGTCACTAACAGCTCCGAAAATCCTTGATGAAGTATTCGTTGATGAGGTCGTGTTGACGACTGTCAAGGATAGAGCTGACGAGAAATTTCTGCCTTCAACGGAAGATGCAAATATTGAGATGAACTCGTTGTCAGTTGCGGAAGCAGATCCATCTCAAAACTTTCTGAATGACGACGAGCACATGATTCACTTTGATGGTGACATGGATCAAGAATCAGATACAGATGATGATTCGGATGAGAAAGATGGATCAACAGCTCTGCTTGAAGATTCCGATCCAACAGCTCAGAAGAGGAATTTACTTGCACGTTTAAAGGTTGTGGAAGCCATGCTTCAGCAAGTGGCAAAAGAGGAACAATTGCGAACTCAACGAGAAGCCTCATTTACTAAAGCAGGCACCAACAATAGAGTCATCTCTACTTCCCCTGTCCTCGCTGAAAACGGAGTCGATCATAAAAGACAGAGGCGGCCAAATCCGAAGTACTTTGACGCAGAGATAGACGCTGAGTTCCAAATATCTGGAAGCTCTCTACTAGCCCGTGCTTCCTTTGGAGAGGGCGGAACAGGGGTTGTCAACATTCCTGACTCCCAGCCATTGCAAAATGGAGAAAATACTACAACAGCTGCAGTTACAAGCATATCACCACCAGATTACCTGAATCGCATACGTCCACCCATGATTCAGCGAGCTCGGACCGCGCTTGCACAAAAACATCGTGTGTTTTCTCTGTCCGAGAGCTCAACGGTGGCAGTGAAAACTGATAGTAATCTGGATAATTTATCAATTAGAGAGCTACATGAGGCTTACAGGAAAGCTTTTGGTAGAGATACGTCTGTAAAAGATAAGCACTGGTTGAAACGTCAAATCTTCATGGGTTTGAGCAAACAGAATGCAACTAGCAATGGCAAGGAAAATAATCGATCAAAGTCTACGTTGACCGACTCCAACTTGAAATCTAGGGCGGAAAAGATCTCTTCTGCAGAAGCGCCTCTTGTGACGTTCTCCACTGTTGGTGTCAATGGGAAGAGGAAGAGCAAGGGAACCGAGGCAATTTTCAGTCCTCATGAATGTAAGAAGGCACACCGGAAGACACTATCCTTGTCAGGACTATCACCCTTGAATTCTCCAAATCCAGGAATTACTGGGGATTGCAGCGGAGGAACCAATCAAGAGGGAACTCTCAGTGTGGTGCAGACTTCTGGAAGTTTGGTTGGGGAAAAGAGAATTCGAAAACCGAACCGCAGATATATCGAGGATGAAGGAGATGAATCCCTGGGACTCGCTGCTAATGGTAGCAGGTCAGTACTTAGTACACTTCCAGACGCTGGGAATGGGCTTCGGTCTGCTCCGCTAAGATTATCTTGGAAGAATGATGCGGAAGTTGTTGAGGCTGAGAGCAAAATCAACGTAATTAGAAATAAAAGCCTACGAGCTTCGACGCGGTCAACGTCTTCGATCCGATCGACATCTTCTAATGGAAGACGCAGCAAGCATGGCAACAACGGCATCCAAAAGAAAAAGATTGATTCGCGGGCTGCAAAGCTTGTGAAAATAGCACATTCTGCCCGAGCTGCCCGGCTTGATATACAGAAAACAATCCGCAAAGTGAAGTTTAGGTTACCAGCAGCTCCTGGTCAGGAAAAGGGTGAGGTGTTAAACGGTGGAGATGGAGAACAGGTATCGTGTTTGCTGCCGGTACGAATCGACGAAACCATAGGAGACCATGAACTGCTAAATTCTCAGTATCAAACCAGATCGGAATCAAATGATGAACAGGCTGTGGTGACAGTGCCCACAGCCAATGGCGGCACACGCCGTAAACATCATAGACCTTGGACCCTTCGGGAGGTTCTTACCCTCGTGGAAGGGGTAGCTCGATGTGGGGGTGGGAAATGGGCTGATATAAAGAAGCTGGCATTTTCCACCGTTAGTTATCGTACAGCGGTTGATTTAAAGGATAAATGGCGCAACCTTTTACGAGCGAGTAGAGCCCAGTTACACCCTCCCAAACAGGGAGAAACGCGCAAGAAGCAGTTTTCTGCTGCCATACCGTCGCAGCTACTTGCCAGAGTGAGGGAACTAGCTGCTCTCAATAACCAAGCTGTATCAAACGTCAGTGCAGGAAGTAGCACTAGCAGAAGTGGACGAGTTGTACATAGAAGATAACACCTACCTAAAGAGGCGGAGGTCTTAGCAAAGATGTATATGTAGTTCAATCATGTATATGTGTATGTACACTATTCAGCTTCCTCATAAATCACTTACTACAGCATATTTCACTCAAAGATGTAGACCTTATCTTCCACTTGTACTATAATTAGTGTAGTATGGCACCATGTAGCGCCAGGTAGAGCTCGAGGATGCCCGGGAATGATAGATACCCTGCTTTTGGTTTCAGTAAACAGATGACGGACCTCAGTTCCGTACTGTGATGTGCTCAAATTGGTTAGCTTTCATATACAGAAGCCATGTGATACACATCATTTTTGTTTTGATTAGTAAGATATTACTATATCTCTATAAAGTGTCCCA

CDS

>Mapoly0008s0016.1
ATGCTGGACTCAACACTTCTCGAGAGCAAAGGCACTCCAGGTCAAGTAGCAGGCAAAGATGGAGTGCCGTCACTAACAGCTCCGAAAATCCTTGATGAAGTATTCGTTGATGAGGTCGTGTTGACGACTGTCAAGGATAGAGCTGACGAGAAATTTCTGCCTTCAACGGAAGATGCAAATATTGAGATGAACTCGTTGTCAGTTGCGGAAGCAGATCCATCTCAAAACTTTCTGAATGACGACGAGCACATGATTCACTTTGATGGTGACATGGATCAAGAATCAGATACAGATGATGATTCGGATGAGAAAGATGGATCAACAGCTCTGCTTGAAGATTCCGATCCAACAGCTCAGAAGAGGAATTTACTTGCACGTTTAAAGGTTGTGGAAGCCATGCTTCAGCAAGTGGCAAAAGAGGAACAATTGCGAACTCAACGAGAAGCCTCATTTACTAAAGCAGGCACCAACAATAGAGTCATCTCTACTTCCCCTGTCCTCGCTGAAAACGGAGTCGATCATAAAAGACAGAGGCGGCCAAATCCGAAGTACTTTGACGCAGAGATAGACGCTGAGTTCCAAATATCTGGAAGCTCTCTACTAGCCCGTGCTTCCTTTGGAGAGGGCGGAACAGGGGTTGTCAACATTCCTGACTCCCAGCCATTGCAAAATGGAGAAAATACTACAACAGCTGCAGTTACAAGCATATCACCACCAGATTACCTGAATCGCATACGTCCACCCATGATTCAGCGAGCTCGGACCGCGCTTGCACAAAAACATCGTGTGTTTTCTCTGTCCGAGAGCTCAACGGTGGCAGTGAAAACTGATAGTAATCTGGATAATTTATCAATTAGAGAGCTACATGAGGCTTACAGGAAAGCTTTTGGTAGAGATACGTCTGTAAAAGATAAGCACTGGTTGAAACGTCAAATCTTCATGGGTTTGAGCAAACAGAATGCAACTAGCAATGGCAAGGAAAATAATCGATCAAAGTCTACGTTGACCGACTCCAACTTGAAATCTAGGGCGGAAAAGATCTCTTCTGCAGAAGCGCCTCTTGTGACGTTCTCCACTGTTGGTGTCAATGGGAAGAGGAAGAGCAAGGGAACCGAGGCAATTTTCAGTCCTCATGAATGTAAGAAGGCACACCGGAAGACACTATCCTTGTCAGGACTATCACCCTTGAATTCTCCAAATCCAGGAATTACTGGGGATTGCAGCGGAGGAACCAATCAAGAGGGAACTCTCAGTGTGGTGCAGACTTCTGGAAGTTTGGTTGGGGAAAAGAGAATTCGAAAACCGAACCGCAGATATATCGAGGATGAAGGAGATGAATCCCTGGGACTCGCTGCTAATGGTAGCAGGTCAGTACTTAGTACACTTCCAGACGCTGGGAATGGGCTTCGGTCTGCTCCGCTAAGATTATCTTGGAAGAATGATGCGGAAGTTGTTGAGGCTGAGAGCAAAATCAACGTAATTAGAAATAAAAGCCTACGAGCTTCGACGCGGTCAACGTCTTCGATCCGATCGACATCTTCTAATGGAAGACGCAGCAAGCATGGCAACAACGGCATCCAAAAGAAAAAGATTGATTCGCGGGCTGCAAAGCTTGTGAAAATAGCACATTCTGCCCGAGCTGCCCGGCTTGATATACAGAAAACAATCCGCAAAGTGAAGTTTAGGTTACCAGCAGCTCCTGGTCAGGAAAAGGGTGAGGTGTTAAACGGTGGAGATGGAGAACAGGTATCGTGTTTGCTGCCGGTACGAATCGACGAAACCATAGGAGACCATGAACTGCTAAATTCTCAGTATCAAACCAGATCGGAATCAAATGATGAACAGGCTGTGGTGACAGTGCCCACAGCCAATGGCGGCACACGCCGTAAACATCATAGACCTTGGACCCTTCGGGAGGTTCTTACCCTCGTGGAAGGGGTAGCTCGATGTGGGGGTGGGAAATGGGCTGATATAAAGAAGCTGGCATTTTCCACCGTTAGTTATCGTACAGCGGTTGATTTAAAGGATAAATGGCGCAACCTTTTACGAGCGAGTAGAGCCCAGTTACACCCTCCCAAACAGGGAGAAACGCGCAAGAAGCAGTTTTCTGCTGCCATACCGTCGCAGCTACTTGCCAGAGTGAGGGAACTAGCTGCTCTCAATAACCAAGCTGTATCAAACGTCAGTGCAGGAAGTAGCACTAGCAGAAGTGGACGAGTTGTACATAGAAGATAA

Protein

>Mapoly0008s0016.1
MLDSTLLESKGTPGQVAGKDGVPSLTAPKILDEVFVDEVVLTTVKDRADEKFLPSTEDANIEMNSLSVAEADPSQNFLNDDEHMIHFDGDMDQESDTDDDSDEKDGSTALLEDSDPTAQKRNLLARLKVVEAMLQQVAKEEQLRTQREASFTKAGTNNRVISTSPVLAENGVDHKRQRRPNPKYFDAEIDAEFQISGSSLLARASFGEGGTGVVNIPDSQPLQNGENTTTAAVTSISPPDYLNRIRPPMIQRARTALAQKHRVFSLSESSTVAVKTDSNLDNLSIRELHEAYRKAFGRDTSVKDKHWLKRQIFMGLSKQNATSNGKENNRSKSTLTDSNLKSRAEKISSAEAPLVTFSTVGVNGKRKSKGTEAIFSPHECKKAHRKTLSLSGLSPLNSPNPGITGDCSGGTNQEGTLSVVQTSGSLVGEKRIRKPNRRYIEDEGDESLGLAANGSRSVLSTLPDAGNGLRSAPLRLSWKNDAEVVEAESKINVIRNKSLRASTRSTSSIRSTSSNGRRSKHGNNGIQKKKIDSRAAKLVKIAHSARAARLDIQKTIRKVKFRLPAAPGQEKGEVLNGGDGEQVSCLLPVRIDETIGDHELLNSQYQTRSESNDEQAVVTVPTANGGTRRKHHRPWTLREVLTLVEGVARCGGGKWADIKKLAFSTVSYRTAVDLKDKWRNLLRASRAQLHPPKQGETRKKQFSAAIPSQLLARVRELAALNNQAVSNVSAGSSTSRSGRVVHRR

Mapoly0008s0016.2  

Gene structure:

mRNA scaffold_8:170176..176622  ( + strand )
five_prime_UTR scaffold_8:170176..170567  ( + strand )
five_prime_UTR scaffold_8:171852..171876  ( + strand )
CDS scaffold_8:171877..172011  ( + strand )
CDS scaffold_8:172515..172704  ( + strand )
CDS scaffold_8:173030..173088  ( + strand )
CDS scaffold_8:173276..174469  ( + strand )
CDS scaffold_8:174652..174786  ( + strand )
CDS scaffold_8:175003..175314  ( + strand )
CDS scaffold_8:175760..175816  ( + strand )
CDS scaffold_8:176104..176256  ( + strand )
three_prime_UTR scaffold_8:176257..176622  ( + strand )

Sequences:

Gene

>Mapoly0008s0016.2
CACGGAGAGGATGCTGCACTTACGAGAATATTAGTGGGAATAAACAGGTTTAGGAGACTGACGTCGTAGAGCGAGGATTAACGTTTCTTTGTACTCAGGGGCTTGGGCAACAGTTGTTCATCCGTCTCTCTTTGTCTCTGGCTCTCCCTGGCTATGGCCGTTCGTTCTTCTGGATCTTTCTCTGTCATCAGGCGCTGATTTCAGGGGCTCAGATGCAGGGGATGACACTCTTGGGCCTGGAGATGATTGTCAAACTCTGAATTGCGAGGTTCTGTTTAGACTGCAGTGCATGTGGACAGTGCAATCGAGCAGTTGAAAGGGAGGAGGGAGGGAGTCATGTAGGTGGGAAAAGCGCGAGAGCAGTACGACAGGATTTCTATCTTTCTGTGCAGGTTTGTAGTCTTCAGATCCGCTTTGCACTTCTGTGGTGCTGCGTGGGTATGGATCGGTGTAGGATATGTAGCACTGAAGATAGAGGACTGAGAAATTCTTGACGAGGCTGGTGTTTGTAATAGGTCCGCACGCACCTCAATTTGTAGATAGTTGATGAGCACCGTATTTTCTTGGGCTTCGGAGTTTCCGAATTGTATTTCCTTACATGAAAAATTGAAACAAAATTCCTTCTGTGCTCATTGCCAGATCAACTTCTTTGACTTTTTCTCGCGTTTCTTTTTCAATATGCAGATTTGTAAGTTGAGTTTGCTTTTTACATTTCTTCTCTGATATCAGTCTTAGTCTGGAGAAGTCCTGTGCTTTTGATCCTCCAAACATTGCTTCACAGCTTTGGATTTGCTGTGCCAGGTTTCTTTCTTTTGACTTAGCCAATTTTATCTATCTTTTTGTCCGGTCTCACTGCATCCGTGCTGTCTGGTGATGTCCAAAGCCAATGACAATTATATTTCTTGATTTCCTGCAACTTGGGCTGGGATTAGATGATTTTGCTGTGTTTGATTTTATCAGAAGGTTTCAATCGCAGTTTTTCCATTGGCATTACCGCTCTGTGGATTTACTAACGTCCCGTGTCATCATCAAGATCGCTCTTTTTTGCCGCCAATTGCACGGACAAGCATCCAAGCAATGTGATTTGTTGCAATCTCTCCGTTTAGTCATGAGTTTCAAGATGTGAAATCCTCGATGGATGGAGTATTGAAAACTTTCAGACATGTAAATTTAACAAGATATCCGGATTCTCTCAACCATATCTCTTGAGGTAACATGCATGTGTAACATTACAGTGTGAACTTGTATCTAGTATTTCGCTGAAAGGGACAGTTCAATTGAATTGTAATCTTTCAAGCTTGTGCTGATTCAGATTTTGTTTGTGGCAGTATGCAGTTGCACCCTAGATGACTATCGACGCGTTTTCTGGTCGATGAATTGGGCATTCCTGTCTGATTGTTAGATAGGTAGATCGTGAGACATTTTTCCTTCCTATTGGAAAGTCACCCAGCGGTTTCTTTCTTTTGATTGTCAAGGTTGTGCTCTGCCGGTGCAAATGAAATTTTATCTAAACGTTTCATTGCTGGTCTTGAGAGATAGCTGAATAATTTTTAAATTTTAAGAAATATCTAGACCCCTGCATGTGCAAGTCAGTCTAGTGATGAGCTTGATTATTCACAAATGAAAACCTTTGTCTTTCAAGTAATGAGGACGGGATAAATTTGTTGTCTATGCAGCGGACGTATATGCTGGTTGTGAGTTATGCTGGACTCAACACTTCTCGAGAGCAAAGGCACTCCAGGTCAAGTAGCAGGCAAAGATGGAGTGCCGTCACTAACAGCTCCGAAAATCCTTGATGAAGTATTCGTTGATGAGGTCGTGTTGACGACTGTCAAGGTTAGCCCTGTTTAAAATATCCTCTAATTCTTCCTAATCTGACAATTTGTAAATTATGGTTCACCTTTTTGTGCTACAGCTGGCTATCTTAGCTCCTCGAGCAAGCTAGCTACTAGAGGCGCACTCATTTATTTAACACAGAAATTTAAACTTTTGCAGAGATCGCTAACTTGGTAATCTTGTGCAGCACTCCACGTACAAATTAGATTGTTGATTTAATCGGCGTTCGTAGATTTTCGAATTTATACAACATCTAGATTTGGATGATCTGAATATTTTATGATTCCATCGAAGAAACGGACTCGATGGTTCAAGTAGTTATTGGAGTTAACGATCTAAATTGACCTCTATGATAGCCTTGGTTGCTCAGTTTCTCTGTACAGTTAACCTGGCCTTTCCCCATCAGTCTATTTCTCATGACCACTATAATCGGTGACGATAATAGTAACACGCTGACTCCTAGTCACTGCAATAATTATATTTCTTCCAATCGGAGTATGCAGGATAGAGCTGACGAGAAATTTCTGCCTTCAACGGAAGATGCAAATATTGAGATGAACTCGTTGTCAGTTGCGGAAGCAGATCCATCTCAAAACTTTCTGAATGACGACGAGCACATGATTCACTTTGATGGTGACATGGATCAAGAATCAGATACAGATGATGATTCGGATGAGAAAGATGGATCAACAGGTAAAATTTCCTATTCTTCTCTGTCAATTGTACATTAGCATTTTGCGGTACGGTCTGTCTATAATGAAATAAGATTCCACTCTCCTTGAAACGCGTTAACCCATCCATGAAAGAAATTATGACACTATGTCAACATATAAAAAAGATTCATGTAGTCAATTTTTTCTTTCTTTTATGGTCAATACTATTCTGTGTTGCACTGATACATCAAAGGACACCTCTAGGAAAGAGCTATTTATGAATGGCTTGCATAATTTTGTGCTCTTGAAACTGCTGCTGAAGAAAATATTATCAAGTGATTTTTGGCGCTTGTTGCGAAGTGCAGCTCTGCTTGAAGATTCCGATCCAACAGCTCAGAAGAGGAATTTACTTGCACGTTTAAAGGTAGGATGGATGCAACATGTTTGTTTTAGATGACTTTTAGTTAATTCGTACCTCCCACTTAAATACAACATCAACGGTCTCGAGTTACACTGCTTGATTGTGATAATTCTATTTTTAAGAAAAGCTGTTTGTTTAACAGTCATCCACATGTCTTTTGAGTCATAGTCTGAATGGGTTCATTTTACAGGTTGTGGAAGCCATGCTTCAGCAAGTGGCAAAAGAGGAACAATTGCGAACTCAACGAGAAGCCTCATTTACTAAAGCAGGCACCAACAATAGAGTCATCTCTACTTCCCCTGTCCTCGCTGAAAACGGAGTCGATCATAAAAGACAGAGGCGGCCAAATCCGAAGTACTTTGACGCAGAGATAGACGCTGAGTTCCAAATATCTGGAAGCTCTCTACTAGCCCGTGCTTCCTTTGGAGAGGGCGGAACAGGGGTTGTCAACATTCCTGACTCCCAGCCATTGCAAAATGGAGAAAATACTACAACAGCTGCAGTTACAAGCATATCACCACCAGATTACCTGAATCGCATACGTCCACCCATGATTCAGCGAGCTCGGACCGCGCTTGCACAAAAACATCGTGTGTTTTCTCTGTCCGAGAGCTCAACGGTGGCAGTGAAAACTGATAGTAATCTGGATAATTTATCAATTAGAGAGCTACATGAGGCTTACAGGAAAGCTTTTGGTAGAGATACGTCTGTAAAAGATAAGCACTGGTTGAAACGTCAAATCTTCATGGGTTTGAGCAAACAGAATGCAACTAGCAATGGCAAGGAAAATAATCGATCAAAGTCTACGTTGACCGACTCCAACTTGAAATCTAGGGCGGAAAAGATCTCTTCTGCAGAAGCGCCTCTTGTGACGTTCTCCACTGTTGGTGTCAATGGGAAGAGGAAGAGCAAGGGAACCGAGGCAATTTTCAGTCCTCATGAATGTAAGAAGGCACACCGGAAGACACTATCCTTGTCAGGACTATCACCCTTGAATTCTCCAAATCCAGGAATTACTGGGGATTGCAGCGGAGGAACCAATCAAGAGGGAACTCTCAGTGTGGTGCAGACTTCTGGAAGTTTGGTTGGGGAAAAGAGAATTCGAAAACCGAACCGCAGATATATCGAGGATGAAGGAGATGAATCCCTGGGACTCGCTGCTAATGGTAGCAGGTCAGTACTTAGTACACTTCCAGACGCTGGGAATGGGCTTCGGTCTGCTCCGCTAAGATTATCTTGGAAGAATGATGCGGAAGTTGTTGAGGCTGAGAGCAAAATCAACGTAATTAGAAATAAAAGCCTACGAGCTTCGACGCGGTCAACGTCTTCGATCCGATCGACATCTTCTAATGGAAGACGCAGCAAGCATGGCAACAACGGCATCGTAAGTATCTCCCAACAATATAAGGAAATCTTATTATGAAACTTATGATTGTTATAATTTTGCCAGACTAACTTGTATATTACTCAATTATGTACACAACCACAAACTGACCTCTCCTCATGAGATAAAACATGAAACCAATTCACTGCGAGGAATTGACTGTTGTTGGTGTTCTTTCACAGCAAAAGAAAAAGATTGATTCGCGGGCTGCAAAGCTTGTGAAAATAGCACATTCTGCCCGAGCTGCCCGGCTTGATATACAGAAAACAATCCGCAAAGTGAAGTTTAGGTTACCAGCAGCTCCTGGTCAGGAAAAGGTATTTCATTCGAAAAATCCTCACCACCAGGATGGAAGGTTTCATAGTCAAATAGGGAAAGTAAGATGCAATACTAATCGTAACCTTGCTTGACATCTGCATTGCTATTTGACTTGTCTGAAGAACTAGAGTAATCTACCACCTCCTTCGCAGAAAGGTGAAATTTAGAACTAAGATACACTTCCCTAAGGTTCAGATGTTCGTCGTCAATGGCAGGGTGAGGTGTTAAACGGTGGAGATGGAGAACAGGTATCGTGTTTGCTGCCGGTACGAATCGACGAAACCATAGGAGACCATGAACTGCTAAATTCTCAGTATCAAACCAGATCGGAATCAAATGATGAACAGGCTGTGGTGACAGTGCCCACAGCCAATGGCGGCACACGCCGTAAACATCATAGACCTTGGACCCTTCGGGAGGTTCTTACCCTCGTGGAAGGGGTAGCTCGATGTGGGGGTGGGAAATGGGCTGATATAAAGAAGCTGGCATTTTCCACCGTTAGTTATCGTACAGCGGTTGATTTAAAGGTGAGGTCCATCTTGCTCTCAAATTCGTACTCGTTCGTTGTGGATAGGGTGTTGATGGGTGTGTGGATATGATTATATGTTCATGTATTTTGGATTACAAATCTTTGTTCTCTATGGTCTTCTGGATAACAGACTTTATAAAATGGAAGATCATGTTACTCGCCCTCACTGTTTAGATTTGAGTTCTGTTCATATCATTTCATTGATTGATTTCAAGTGATATTGTTATGGGTGGATCTTTTACGAATAGATATGAGACCACCCTGAACGCGGACGGGATTTTAGGCTCTGCCAGGATCAGACTACTAAATAGATAAACATAGAATATACTACCGAGTAATTTCTGTCTATACAGTGAAAGGTTGACAACGTGATGAATATCCATGTTGATGTTGATCCATGTGAATATGTATCTAATTACTTTAGAGCTGTGTCAATATATCAGGATAAATGGCGCAACCTTTTACGAGCGAGTAGAGCCCAGTTACACCCTCCCAAACAGGTAACCTTCGTCAATTTTTTTCATGCATAGCTTCTGCCAGCTTTTAGGAGGTCATCTTGCTCAATTGTTGAGTCTTAACTTGTGTTGTCTGAATGAGCCACTTCTGCTGTTTATCTCATCTGATTCTTGTCCATTAATGTAGTACTATTATCTCAAGAGAGCTCATGTTCTGATTGTATGGAGATTTAAGGGTTGGTGATTCTGCTATTCAAGATAACGTCAATCAACCTTGTGCTCATTTGAAAGCTTACCTACCGAGCTACGTCTGCTTCTGTTTGACAATGCAGGGAGAAACGCGCAAGAAGCAGTTTTCTGCTGCCATACCGTCGCAGCTACTTGCCAGAGTGAGGGAACTAGCTGCTCTCAATAACCAAGCTGTATCAAACGTCAGTGCAGGAAGTAGCACTAGCAGAAGTGGACGAGTTGTACATAGAAGATAACACCTACCTAAAGAGGCGGAGGTCTTAGCAAAGATGTATATGTAGTTCAATCATGTATATGTGTATGTACACTATTCAGCTTCCTCATAAATCACTTACTACAGCATATTTCACTCAAAGATGTAGACCTTATCTTCCACTTGTACTATAATTAGTGTAGTATGGCACCATGTAGCGCCAGGTAGAGCTCGAGGATGCCCGGGAATGATAGATACCCTGCTTTTGGTTTCAGTAAACAGATGACGGACCTCAGTTCCGTACTGTGATGTGCTCAAATTGGTTAGCTTTCATATACAGAAGCCATGTGATACACATCATTTTTGTTTTGATTAGTAAGATATTACTATATCTCTATAAAGTGTCCCA

mRNA

>Mapoly0008s0016.2
CACGGAGAGGATGCTGCACTTACGAGAATATTAGTGGGAATAAACAGGTTTAGGAGACTGACGTCGTAGAGCGAGGATTAACGTTTCTTTGTACTCAGGGGCTTGGGCAACAGTTGTTCATCCGTCTCTCTTTGTCTCTGGCTCTCCCTGGCTATGGCCGTTCGTTCTTCTGGATCTTTCTCTGTCATCAGGCGCTGATTTCAGGGGCTCAGATGCAGGGGATGACACTCTTGGGCCTGGAGATGATTGTCAAACTCTGAATTGCGAGGTTCTGTTTAGACTGCAGTGCATGTGGACAGTGCAATCGAGCAGTTGAAAGGGAGGAGGGAGGGAGTCATGTAGGTGGGAAAAGCGCGAGAGCAGTACGACAGGATTTCTATCTTTCTGTGCAGCGGACGTATATGCTGGTTGTGAGTTATGCTGGACTCAACACTTCTCGAGAGCAAAGGCACTCCAGGTCAAGTAGCAGGCAAAGATGGAGTGCCGTCACTAACAGCTCCGAAAATCCTTGATGAAGTATTCGTTGATGAGGTCGTGTTGACGACTGTCAAGGATAGAGCTGACGAGAAATTTCTGCCTTCAACGGAAGATGCAAATATTGAGATGAACTCGTTGTCAGTTGCGGAAGCAGATCCATCTCAAAACTTTCTGAATGACGACGAGCACATGATTCACTTTGATGGTGACATGGATCAAGAATCAGATACAGATGATGATTCGGATGAGAAAGATGGATCAACAGCTCTGCTTGAAGATTCCGATCCAACAGCTCAGAAGAGGAATTTACTTGCACGTTTAAAGGTTGTGGAAGCCATGCTTCAGCAAGTGGCAAAAGAGGAACAATTGCGAACTCAACGAGAAGCCTCATTTACTAAAGCAGGCACCAACAATAGAGTCATCTCTACTTCCCCTGTCCTCGCTGAAAACGGAGTCGATCATAAAAGACAGAGGCGGCCAAATCCGAAGTACTTTGACGCAGAGATAGACGCTGAGTTCCAAATATCTGGAAGCTCTCTACTAGCCCGTGCTTCCTTTGGAGAGGGCGGAACAGGGGTTGTCAACATTCCTGACTCCCAGCCATTGCAAAATGGAGAAAATACTACAACAGCTGCAGTTACAAGCATATCACCACCAGATTACCTGAATCGCATACGTCCACCCATGATTCAGCGAGCTCGGACCGCGCTTGCACAAAAACATCGTGTGTTTTCTCTGTCCGAGAGCTCAACGGTGGCAGTGAAAACTGATAGTAATCTGGATAATTTATCAATTAGAGAGCTACATGAGGCTTACAGGAAAGCTTTTGGTAGAGATACGTCTGTAAAAGATAAGCACTGGTTGAAACGTCAAATCTTCATGGGTTTGAGCAAACAGAATGCAACTAGCAATGGCAAGGAAAATAATCGATCAAAGTCTACGTTGACCGACTCCAACTTGAAATCTAGGGCGGAAAAGATCTCTTCTGCAGAAGCGCCTCTTGTGACGTTCTCCACTGTTGGTGTCAATGGGAAGAGGAAGAGCAAGGGAACCGAGGCAATTTTCAGTCCTCATGAATGTAAGAAGGCACACCGGAAGACACTATCCTTGTCAGGACTATCACCCTTGAATTCTCCAAATCCAGGAATTACTGGGGATTGCAGCGGAGGAACCAATCAAGAGGGAACTCTCAGTGTGGTGCAGACTTCTGGAAGTTTGGTTGGGGAAAAGAGAATTCGAAAACCGAACCGCAGATATATCGAGGATGAAGGAGATGAATCCCTGGGACTCGCTGCTAATGGTAGCAGGTCAGTACTTAGTACACTTCCAGACGCTGGGAATGGGCTTCGGTCTGCTCCGCTAAGATTATCTTGGAAGAATGATGCGGAAGTTGTTGAGGCTGAGAGCAAAATCAACGTAATTAGAAATAAAAGCCTACGAGCTTCGACGCGGTCAACGTCTTCGATCCGATCGACATCTTCTAATGGAAGACGCAGCAAGCATGGCAACAACGGCATCCAAAAGAAAAAGATTGATTCGCGGGCTGCAAAGCTTGTGAAAATAGCACATTCTGCCCGAGCTGCCCGGCTTGATATACAGAAAACAATCCGCAAAGTGAAGTTTAGGTTACCAGCAGCTCCTGGTCAGGAAAAGGGTGAGGTGTTAAACGGTGGAGATGGAGAACAGGTATCGTGTTTGCTGCCGGTACGAATCGACGAAACCATAGGAGACCATGAACTGCTAAATTCTCAGTATCAAACCAGATCGGAATCAAATGATGAACAGGCTGTGGTGACAGTGCCCACAGCCAATGGCGGCACACGCCGTAAACATCATAGACCTTGGACCCTTCGGGAGGTTCTTACCCTCGTGGAAGGGGTAGCTCGATGTGGGGGTGGGAAATGGGCTGATATAAAGAAGCTGGCATTTTCCACCGTTAGTTATCGTACAGCGGTTGATTTAAAGGATAAATGGCGCAACCTTTTACGAGCGAGTAGAGCCCAGTTACACCCTCCCAAACAGGGAGAAACGCGCAAGAAGCAGTTTTCTGCTGCCATACCGTCGCAGCTACTTGCCAGAGTGAGGGAACTAGCTGCTCTCAATAACCAAGCTGTATCAAACGTCAGTGCAGGAAGTAGCACTAGCAGAAGTGGACGAGTTGTACATAGAAGATAACACCTACCTAAAGAGGCGGAGGTCTTAGCAAAGATGTATATGTAGTTCAATCATGTATATGTGTATGTACACTATTCAGCTTCCTCATAAATCACTTACTACAGCATATTTCACTCAAAGATGTAGACCTTATCTTCCACTTGTACTATAATTAGTGTAGTATGGCACCATGTAGCGCCAGGTAGAGCTCGAGGATGCCCGGGAATGATAGATACCCTGCTTTTGGTTTCAGTAAACAGATGACGGACCTCAGTTCCGTACTGTGATGTGCTCAAATTGGTTAGCTTTCATATACAGAAGCCATGTGATACACATCATTTTTGTTTTGATTAGTAAGATATTACTATATCTCTATAAAGTGTCCCA

CDS

>Mapoly0008s0016.2
ATGCTGGACTCAACACTTCTCGAGAGCAAAGGCACTCCAGGTCAAGTAGCAGGCAAAGATGGAGTGCCGTCACTAACAGCTCCGAAAATCCTTGATGAAGTATTCGTTGATGAGGTCGTGTTGACGACTGTCAAGGATAGAGCTGACGAGAAATTTCTGCCTTCAACGGAAGATGCAAATATTGAGATGAACTCGTTGTCAGTTGCGGAAGCAGATCCATCTCAAAACTTTCTGAATGACGACGAGCACATGATTCACTTTGATGGTGACATGGATCAAGAATCAGATACAGATGATGATTCGGATGAGAAAGATGGATCAACAGCTCTGCTTGAAGATTCCGATCCAACAGCTCAGAAGAGGAATTTACTTGCACGTTTAAAGGTTGTGGAAGCCATGCTTCAGCAAGTGGCAAAAGAGGAACAATTGCGAACTCAACGAGAAGCCTCATTTACTAAAGCAGGCACCAACAATAGAGTCATCTCTACTTCCCCTGTCCTCGCTGAAAACGGAGTCGATCATAAAAGACAGAGGCGGCCAAATCCGAAGTACTTTGACGCAGAGATAGACGCTGAGTTCCAAATATCTGGAAGCTCTCTACTAGCCCGTGCTTCCTTTGGAGAGGGCGGAACAGGGGTTGTCAACATTCCTGACTCCCAGCCATTGCAAAATGGAGAAAATACTACAACAGCTGCAGTTACAAGCATATCACCACCAGATTACCTGAATCGCATACGTCCACCCATGATTCAGCGAGCTCGGACCGCGCTTGCACAAAAACATCGTGTGTTTTCTCTGTCCGAGAGCTCAACGGTGGCAGTGAAAACTGATAGTAATCTGGATAATTTATCAATTAGAGAGCTACATGAGGCTTACAGGAAAGCTTTTGGTAGAGATACGTCTGTAAAAGATAAGCACTGGTTGAAACGTCAAATCTTCATGGGTTTGAGCAAACAGAATGCAACTAGCAATGGCAAGGAAAATAATCGATCAAAGTCTACGTTGACCGACTCCAACTTGAAATCTAGGGCGGAAAAGATCTCTTCTGCAGAAGCGCCTCTTGTGACGTTCTCCACTGTTGGTGTCAATGGGAAGAGGAAGAGCAAGGGAACCGAGGCAATTTTCAGTCCTCATGAATGTAAGAAGGCACACCGGAAGACACTATCCTTGTCAGGACTATCACCCTTGAATTCTCCAAATCCAGGAATTACTGGGGATTGCAGCGGAGGAACCAATCAAGAGGGAACTCTCAGTGTGGTGCAGACTTCTGGAAGTTTGGTTGGGGAAAAGAGAATTCGAAAACCGAACCGCAGATATATCGAGGATGAAGGAGATGAATCCCTGGGACTCGCTGCTAATGGTAGCAGGTCAGTACTTAGTACACTTCCAGACGCTGGGAATGGGCTTCGGTCTGCTCCGCTAAGATTATCTTGGAAGAATGATGCGGAAGTTGTTGAGGCTGAGAGCAAAATCAACGTAATTAGAAATAAAAGCCTACGAGCTTCGACGCGGTCAACGTCTTCGATCCGATCGACATCTTCTAATGGAAGACGCAGCAAGCATGGCAACAACGGCATCCAAAAGAAAAAGATTGATTCGCGGGCTGCAAAGCTTGTGAAAATAGCACATTCTGCCCGAGCTGCCCGGCTTGATATACAGAAAACAATCCGCAAAGTGAAGTTTAGGTTACCAGCAGCTCCTGGTCAGGAAAAGGGTGAGGTGTTAAACGGTGGAGATGGAGAACAGGTATCGTGTTTGCTGCCGGTACGAATCGACGAAACCATAGGAGACCATGAACTGCTAAATTCTCAGTATCAAACCAGATCGGAATCAAATGATGAACAGGCTGTGGTGACAGTGCCCACAGCCAATGGCGGCACACGCCGTAAACATCATAGACCTTGGACCCTTCGGGAGGTTCTTACCCTCGTGGAAGGGGTAGCTCGATGTGGGGGTGGGAAATGGGCTGATATAAAGAAGCTGGCATTTTCCACCGTTAGTTATCGTACAGCGGTTGATTTAAAGGATAAATGGCGCAACCTTTTACGAGCGAGTAGAGCCCAGTTACACCCTCCCAAACAGGGAGAAACGCGCAAGAAGCAGTTTTCTGCTGCCATACCGTCGCAGCTACTTGCCAGAGTGAGGGAACTAGCTGCTCTCAATAACCAAGCTGTATCAAACGTCAGTGCAGGAAGTAGCACTAGCAGAAGTGGACGAGTTGTACATAGAAGATAA

Protein

>Mapoly0008s0016.2
MLDSTLLESKGTPGQVAGKDGVPSLTAPKILDEVFVDEVVLTTVKDRADEKFLPSTEDANIEMNSLSVAEADPSQNFLNDDEHMIHFDGDMDQESDTDDDSDEKDGSTALLEDSDPTAQKRNLLARLKVVEAMLQQVAKEEQLRTQREASFTKAGTNNRVISTSPVLAENGVDHKRQRRPNPKYFDAEIDAEFQISGSSLLARASFGEGGTGVVNIPDSQPLQNGENTTTAAVTSISPPDYLNRIRPPMIQRARTALAQKHRVFSLSESSTVAVKTDSNLDNLSIRELHEAYRKAFGRDTSVKDKHWLKRQIFMGLSKQNATSNGKENNRSKSTLTDSNLKSRAEKISSAEAPLVTFSTVGVNGKRKSKGTEAIFSPHECKKAHRKTLSLSGLSPLNSPNPGITGDCSGGTNQEGTLSVVQTSGSLVGEKRIRKPNRRYIEDEGDESLGLAANGSRSVLSTLPDAGNGLRSAPLRLSWKNDAEVVEAESKINVIRNKSLRASTRSTSSIRSTSSNGRRSKHGNNGIQKKKIDSRAAKLVKIAHSARAARLDIQKTIRKVKFRLPAAPGQEKGEVLNGGDGEQVSCLLPVRIDETIGDHELLNSQYQTRSESNDEQAVVTVPTANGGTRRKHHRPWTLREVLTLVEGVARCGGGKWADIKKLAFSTVSYRTAVDLKDKWRNLLRASRAQLHPPKQGETRKKQFSAAIPSQLLARVRELAALNNQAVSNVSAGSSTSRSGRVVHRR

Mapoly0008s0016.3  

Gene structure:

mRNA scaffold_8:170176..176622  ( + strand )
five_prime_UTR scaffold_8:170176..170567  ( + strand )
five_prime_UTR scaffold_8:171504..171581  ( + strand )
five_prime_UTR scaffold_8:171852..171876  ( + strand )
CDS scaffold_8:171877..172011  ( + strand )
CDS scaffold_8:172515..172704  ( + strand )
CDS scaffold_8:173030..173088  ( + strand )
CDS scaffold_8:173276..174469  ( + strand )
CDS scaffold_8:174652..174786  ( + strand )
CDS scaffold_8:175003..175314  ( + strand )
CDS scaffold_8:175760..175816  ( + strand )
CDS scaffold_8:176104..176256  ( + strand )
three_prime_UTR scaffold_8:176257..176622  ( + strand )

Sequences:

Gene

>Mapoly0008s0016.3
CACGGAGAGGATGCTGCACTTACGAGAATATTAGTGGGAATAAACAGGTTTAGGAGACTGACGTCGTAGAGCGAGGATTAACGTTTCTTTGTACTCAGGGGCTTGGGCAACAGTTGTTCATCCGTCTCTCTTTGTCTCTGGCTCTCCCTGGCTATGGCCGTTCGTTCTTCTGGATCTTTCTCTGTCATCAGGCGCTGATTTCAGGGGCTCAGATGCAGGGGATGACACTCTTGGGCCTGGAGATGATTGTCAAACTCTGAATTGCGAGGTTCTGTTTAGACTGCAGTGCATGTGGACAGTGCAATCGAGCAGTTGAAAGGGAGGAGGGAGGGAGTCATGTAGGTGGGAAAAGCGCGAGAGCAGTACGACAGGATTTCTATCTTTCTGTGCAGGTTTGTAGTCTTCAGATCCGCTTTGCACTTCTGTGGTGCTGCGTGGGTATGGATCGGTGTAGGATATGTAGCACTGAAGATAGAGGACTGAGAAATTCTTGACGAGGCTGGTGTTTGTAATAGGTCCGCACGCACCTCAATTTGTAGATAGTTGATGAGCACCGTATTTTCTTGGGCTTCGGAGTTTCCGAATTGTATTTCCTTACATGAAAAATTGAAACAAAATTCCTTCTGTGCTCATTGCCAGATCAACTTCTTTGACTTTTTCTCGCGTTTCTTTTTCAATATGCAGATTTGTAAGTTGAGTTTGCTTTTTACATTTCTTCTCTGATATCAGTCTTAGTCTGGAGAAGTCCTGTGCTTTTGATCCTCCAAACATTGCTTCACAGCTTTGGATTTGCTGTGCCAGGTTTCTTTCTTTTGACTTAGCCAATTTTATCTATCTTTTTGTCCGGTCTCACTGCATCCGTGCTGTCTGGTGATGTCCAAAGCCAATGACAATTATATTTCTTGATTTCCTGCAACTTGGGCTGGGATTAGATGATTTTGCTGTGTTTGATTTTATCAGAAGGTTTCAATCGCAGTTTTTCCATTGGCATTACCGCTCTGTGGATTTACTAACGTCCCGTGTCATCATCAAGATCGCTCTTTTTTGCCGCCAATTGCACGGACAAGCATCCAAGCAATGTGATTTGTTGCAATCTCTCCGTTTAGTCATGAGTTTCAAGATGTGAAATCCTCGATGGATGGAGTATTGAAAACTTTCAGACATGTAAATTTAACAAGATATCCGGATTCTCTCAACCATATCTCTTGAGGTAACATGCATGTGTAACATTACAGTGTGAACTTGTATCTAGTATTTCGCTGAAAGGGACAGTTCAATTGAATTGTAATCTTTCAAGCTTGTGCTGATTCAGATTTTGTTTGTGGCAGTATGCAGTTGCACCCTAGATGACTATCGACGCGTTTTCTGGTCGATGAATTGGGCATTCCTGTCTGATTGTTAGATAGGTAGATCGTGAGACATTTTTCCTTCCTATTGGAAAGTCACCCAGCGGTTTCTTTCTTTTGATTGTCAAGGTTGTGCTCTGCCGGTGCAAATGAAATTTTATCTAAACGTTTCATTGCTGGTCTTGAGAGATAGCTGAATAATTTTTAAATTTTAAGAAATATCTAGACCCCTGCATGTGCAAGTCAGTCTAGTGATGAGCTTGATTATTCACAAATGAAAACCTTTGTCTTTCAAGTAATGAGGACGGGATAAATTTGTTGTCTATGCAGCGGACGTATATGCTGGTTGTGAGTTATGCTGGACTCAACACTTCTCGAGAGCAAAGGCACTCCAGGTCAAGTAGCAGGCAAAGATGGAGTGCCGTCACTAACAGCTCCGAAAATCCTTGATGAAGTATTCGTTGATGAGGTCGTGTTGACGACTGTCAAGGTTAGCCCTGTTTAAAATATCCTCTAATTCTTCCTAATCTGACAATTTGTAAATTATGGTTCACCTTTTTGTGCTACAGCTGGCTATCTTAGCTCCTCGAGCAAGCTAGCTACTAGAGGCGCACTCATTTATTTAACACAGAAATTTAAACTTTTGCAGAGATCGCTAACTTGGTAATCTTGTGCAGCACTCCACGTACAAATTAGATTGTTGATTTAATCGGCGTTCGTAGATTTTCGAATTTATACAACATCTAGATTTGGATGATCTGAATATTTTATGATTCCATCGAAGAAACGGACTCGATGGTTCAAGTAGTTATTGGAGTTAACGATCTAAATTGACCTCTATGATAGCCTTGGTTGCTCAGTTTCTCTGTACAGTTAACCTGGCCTTTCCCCATCAGTCTATTTCTCATGACCACTATAATCGGTGACGATAATAGTAACACGCTGACTCCTAGTCACTGCAATAATTATATTTCTTCCAATCGGAGTATGCAGGATAGAGCTGACGAGAAATTTCTGCCTTCAACGGAAGATGCAAATATTGAGATGAACTCGTTGTCAGTTGCGGAAGCAGATCCATCTCAAAACTTTCTGAATGACGACGAGCACATGATTCACTTTGATGGTGACATGGATCAAGAATCAGATACAGATGATGATTCGGATGAGAAAGATGGATCAACAGGTAAAATTTCCTATTCTTCTCTGTCAATTGTACATTAGCATTTTGCGGTACGGTCTGTCTATAATGAAATAAGATTCCACTCTCCTTGAAACGCGTTAACCCATCCATGAAAGAAATTATGACACTATGTCAACATATAAAAAAGATTCATGTAGTCAATTTTTTCTTTCTTTTATGGTCAATACTATTCTGTGTTGCACTGATACATCAAAGGACACCTCTAGGAAAGAGCTATTTATGAATGGCTTGCATAATTTTGTGCTCTTGAAACTGCTGCTGAAGAAAATATTATCAAGTGATTTTTGGCGCTTGTTGCGAAGTGCAGCTCTGCTTGAAGATTCCGATCCAACAGCTCAGAAGAGGAATTTACTTGCACGTTTAAAGGTAGGATGGATGCAACATGTTTGTTTTAGATGACTTTTAGTTAATTCGTACCTCCCACTTAAATACAACATCAACGGTCTCGAGTTACACTGCTTGATTGTGATAATTCTATTTTTAAGAAAAGCTGTTTGTTTAACAGTCATCCACATGTCTTTTGAGTCATAGTCTGAATGGGTTCATTTTACAGGTTGTGGAAGCCATGCTTCAGCAAGTGGCAAAAGAGGAACAATTGCGAACTCAACGAGAAGCCTCATTTACTAAAGCAGGCACCAACAATAGAGTCATCTCTACTTCCCCTGTCCTCGCTGAAAACGGAGTCGATCATAAAAGACAGAGGCGGCCAAATCCGAAGTACTTTGACGCAGAGATAGACGCTGAGTTCCAAATATCTGGAAGCTCTCTACTAGCCCGTGCTTCCTTTGGAGAGGGCGGAACAGGGGTTGTCAACATTCCTGACTCCCAGCCATTGCAAAATGGAGAAAATACTACAACAGCTGCAGTTACAAGCATATCACCACCAGATTACCTGAATCGCATACGTCCACCCATGATTCAGCGAGCTCGGACCGCGCTTGCACAAAAACATCGTGTGTTTTCTCTGTCCGAGAGCTCAACGGTGGCAGTGAAAACTGATAGTAATCTGGATAATTTATCAATTAGAGAGCTACATGAGGCTTACAGGAAAGCTTTTGGTAGAGATACGTCTGTAAAAGATAAGCACTGGTTGAAACGTCAAATCTTCATGGGTTTGAGCAAACAGAATGCAACTAGCAATGGCAAGGAAAATAATCGATCAAAGTCTACGTTGACCGACTCCAACTTGAAATCTAGGGCGGAAAAGATCTCTTCTGCAGAAGCGCCTCTTGTGACGTTCTCCACTGTTGGTGTCAATGGGAAGAGGAAGAGCAAGGGAACCGAGGCAATTTTCAGTCCTCATGAATGTAAGAAGGCACACCGGAAGACACTATCCTTGTCAGGACTATCACCCTTGAATTCTCCAAATCCAGGAATTACTGGGGATTGCAGCGGAGGAACCAATCAAGAGGGAACTCTCAGTGTGGTGCAGACTTCTGGAAGTTTGGTTGGGGAAAAGAGAATTCGAAAACCGAACCGCAGATATATCGAGGATGAAGGAGATGAATCCCTGGGACTCGCTGCTAATGGTAGCAGGTCAGTACTTAGTACACTTCCAGACGCTGGGAATGGGCTTCGGTCTGCTCCGCTAAGATTATCTTGGAAGAATGATGCGGAAGTTGTTGAGGCTGAGAGCAAAATCAACGTAATTAGAAATAAAAGCCTACGAGCTTCGACGCGGTCAACGTCTTCGATCCGATCGACATCTTCTAATGGAAGACGCAGCAAGCATGGCAACAACGGCATCGTAAGTATCTCCCAACAATATAAGGAAATCTTATTATGAAACTTATGATTGTTATAATTTTGCCAGACTAACTTGTATATTACTCAATTATGTACACAACCACAAACTGACCTCTCCTCATGAGATAAAACATGAAACCAATTCACTGCGAGGAATTGACTGTTGTTGGTGTTCTTTCACAGCAAAAGAAAAAGATTGATTCGCGGGCTGCAAAGCTTGTGAAAATAGCACATTCTGCCCGAGCTGCCCGGCTTGATATACAGAAAACAATCCGCAAAGTGAAGTTTAGGTTACCAGCAGCTCCTGGTCAGGAAAAGGTATTTCATTCGAAAAATCCTCACCACCAGGATGGAAGGTTTCATAGTCAAATAGGGAAAGTAAGATGCAATACTAATCGTAACCTTGCTTGACATCTGCATTGCTATTTGACTTGTCTGAAGAACTAGAGTAATCTACCACCTCCTTCGCAGAAAGGTGAAATTTAGAACTAAGATACACTTCCCTAAGGTTCAGATGTTCGTCGTCAATGGCAGGGTGAGGTGTTAAACGGTGGAGATGGAGAACAGGTATCGTGTTTGCTGCCGGTACGAATCGACGAAACCATAGGAGACCATGAACTGCTAAATTCTCAGTATCAAACCAGATCGGAATCAAATGATGAACAGGCTGTGGTGACAGTGCCCACAGCCAATGGCGGCACACGCCGTAAACATCATAGACCTTGGACCCTTCGGGAGGTTCTTACCCTCGTGGAAGGGGTAGCTCGATGTGGGGGTGGGAAATGGGCTGATATAAAGAAGCTGGCATTTTCCACCGTTAGTTATCGTACAGCGGTTGATTTAAAGGTGAGGTCCATCTTGCTCTCAAATTCGTACTCGTTCGTTGTGGATAGGGTGTTGATGGGTGTGTGGATATGATTATATGTTCATGTATTTTGGATTACAAATCTTTGTTCTCTATGGTCTTCTGGATAACAGACTTTATAAAATGGAAGATCATGTTACTCGCCCTCACTGTTTAGATTTGAGTTCTGTTCATATCATTTCATTGATTGATTTCAAGTGATATTGTTATGGGTGGATCTTTTACGAATAGATATGAGACCACCCTGAACGCGGACGGGATTTTAGGCTCTGCCAGGATCAGACTACTAAATAGATAAACATAGAATATACTACCGAGTAATTTCTGTCTATACAGTGAAAGGTTGACAACGTGATGAATATCCATGTTGATGTTGATCCATGTGAATATGTATCTAATTACTTTAGAGCTGTGTCAATATATCAGGATAAATGGCGCAACCTTTTACGAGCGAGTAGAGCCCAGTTACACCCTCCCAAACAGGTAACCTTCGTCAATTTTTTTCATGCATAGCTTCTGCCAGCTTTTAGGAGGTCATCTTGCTCAATTGTTGAGTCTTAACTTGTGTTGTCTGAATGAGCCACTTCTGCTGTTTATCTCATCTGATTCTTGTCCATTAATGTAGTACTATTATCTCAAGAGAGCTCATGTTCTGATTGTATGGAGATTTAAGGGTTGGTGATTCTGCTATTCAAGATAACGTCAATCAACCTTGTGCTCATTTGAAAGCTTACCTACCGAGCTACGTCTGCTTCTGTTTGACAATGCAGGGAGAAACGCGCAAGAAGCAGTTTTCTGCTGCCATACCGTCGCAGCTACTTGCCAGAGTGAGGGAACTAGCTGCTCTCAATAACCAAGCTGTATCAAACGTCAGTGCAGGAAGTAGCACTAGCAGAAGTGGACGAGTTGTACATAGAAGATAACACCTACCTAAAGAGGCGGAGGTCTTAGCAAAGATGTATATGTAGTTCAATCATGTATATGTGTATGTACACTATTCAGCTTCCTCATAAATCACTTACTACAGCATATTTCACTCAAAGATGTAGACCTTATCTTCCACTTGTACTATAATTAGTGTAGTATGGCACCATGTAGCGCCAGGTAGAGCTCGAGGATGCCCGGGAATGATAGATACCCTGCTTTTGGTTTCAGTAAACAGATGACGGACCTCAGTTCCGTACTGTGATGTGCTCAAATTGGTTAGCTTTCATATACAGAAGCCATGTGATACACATCATTTTTGTTTTGATTAGTAAGATATTACTATATCTCTATAAAGTGTCCCA

mRNA

>Mapoly0008s0016.3
CACGGAGAGGATGCTGCACTTACGAGAATATTAGTGGGAATAAACAGGTTTAGGAGACTGACGTCGTAGAGCGAGGATTAACGTTTCTTTGTACTCAGGGGCTTGGGCAACAGTTGTTCATCCGTCTCTCTTTGTCTCTGGCTCTCCCTGGCTATGGCCGTTCGTTCTTCTGGATCTTTCTCTGTCATCAGGCGCTGATTTCAGGGGCTCAGATGCAGGGGATGACACTCTTGGGCCTGGAGATGATTGTCAAACTCTGAATTGCGAGGTTCTGTTTAGACTGCAGTGCATGTGGACAGTGCAATCGAGCAGTTGAAAGGGAGGAGGGAGGGAGTCATGTAGGTGGGAAAAGCGCGAGAGCAGTACGACAGGATTTCTATCTTTCTGTGCAGTATGCAGTTGCACCCTAGATGACTATCGACGCGTTTTCTGGTCGATGAATTGGGCATTCCTGTCTGATTGTTAGATAGCGGACGTATATGCTGGTTGTGAGTTATGCTGGACTCAACACTTCTCGAGAGCAAAGGCACTCCAGGTCAAGTAGCAGGCAAAGATGGAGTGCCGTCACTAACAGCTCCGAAAATCCTTGATGAAGTATTCGTTGATGAGGTCGTGTTGACGACTGTCAAGGATAGAGCTGACGAGAAATTTCTGCCTTCAACGGAAGATGCAAATATTGAGATGAACTCGTTGTCAGTTGCGGAAGCAGATCCATCTCAAAACTTTCTGAATGACGACGAGCACATGATTCACTTTGATGGTGACATGGATCAAGAATCAGATACAGATGATGATTCGGATGAGAAAGATGGATCAACAGCTCTGCTTGAAGATTCCGATCCAACAGCTCAGAAGAGGAATTTACTTGCACGTTTAAAGGTTGTGGAAGCCATGCTTCAGCAAGTGGCAAAAGAGGAACAATTGCGAACTCAACGAGAAGCCTCATTTACTAAAGCAGGCACCAACAATAGAGTCATCTCTACTTCCCCTGTCCTCGCTGAAAACGGAGTCGATCATAAAAGACAGAGGCGGCCAAATCCGAAGTACTTTGACGCAGAGATAGACGCTGAGTTCCAAATATCTGGAAGCTCTCTACTAGCCCGTGCTTCCTTTGGAGAGGGCGGAACAGGGGTTGTCAACATTCCTGACTCCCAGCCATTGCAAAATGGAGAAAATACTACAACAGCTGCAGTTACAAGCATATCACCACCAGATTACCTGAATCGCATACGTCCACCCATGATTCAGCGAGCTCGGACCGCGCTTGCACAAAAACATCGTGTGTTTTCTCTGTCCGAGAGCTCAACGGTGGCAGTGAAAACTGATAGTAATCTGGATAATTTATCAATTAGAGAGCTACATGAGGCTTACAGGAAAGCTTTTGGTAGAGATACGTCTGTAAAAGATAAGCACTGGTTGAAACGTCAAATCTTCATGGGTTTGAGCAAACAGAATGCAACTAGCAATGGCAAGGAAAATAATCGATCAAAGTCTACGTTGACCGACTCCAACTTGAAATCTAGGGCGGAAAAGATCTCTTCTGCAGAAGCGCCTCTTGTGACGTTCTCCACTGTTGGTGTCAATGGGAAGAGGAAGAGCAAGGGAACCGAGGCAATTTTCAGTCCTCATGAATGTAAGAAGGCACACCGGAAGACACTATCCTTGTCAGGACTATCACCCTTGAATTCTCCAAATCCAGGAATTACTGGGGATTGCAGCGGAGGAACCAATCAAGAGGGAACTCTCAGTGTGGTGCAGACTTCTGGAAGTTTGGTTGGGGAAAAGAGAATTCGAAAACCGAACCGCAGATATATCGAGGATGAAGGAGATGAATCCCTGGGACTCGCTGCTAATGGTAGCAGGTCAGTACTTAGTACACTTCCAGACGCTGGGAATGGGCTTCGGTCTGCTCCGCTAAGATTATCTTGGAAGAATGATGCGGAAGTTGTTGAGGCTGAGAGCAAAATCAACGTAATTAGAAATAAAAGCCTACGAGCTTCGACGCGGTCAACGTCTTCGATCCGATCGACATCTTCTAATGGAAGACGCAGCAAGCATGGCAACAACGGCATCCAAAAGAAAAAGATTGATTCGCGGGCTGCAAAGCTTGTGAAAATAGCACATTCTGCCCGAGCTGCCCGGCTTGATATACAGAAAACAATCCGCAAAGTGAAGTTTAGGTTACCAGCAGCTCCTGGTCAGGAAAAGGGTGAGGTGTTAAACGGTGGAGATGGAGAACAGGTATCGTGTTTGCTGCCGGTACGAATCGACGAAACCATAGGAGACCATGAACTGCTAAATTCTCAGTATCAAACCAGATCGGAATCAAATGATGAACAGGCTGTGGTGACAGTGCCCACAGCCAATGGCGGCACACGCCGTAAACATCATAGACCTTGGACCCTTCGGGAGGTTCTTACCCTCGTGGAAGGGGTAGCTCGATGTGGGGGTGGGAAATGGGCTGATATAAAGAAGCTGGCATTTTCCACCGTTAGTTATCGTACAGCGGTTGATTTAAAGGATAAATGGCGCAACCTTTTACGAGCGAGTAGAGCCCAGTTACACCCTCCCAAACAGGGAGAAACGCGCAAGAAGCAGTTTTCTGCTGCCATACCGTCGCAGCTACTTGCCAGAGTGAGGGAACTAGCTGCTCTCAATAACCAAGCTGTATCAAACGTCAGTGCAGGAAGTAGCACTAGCAGAAGTGGACGAGTTGTACATAGAAGATAACACCTACCTAAAGAGGCGGAGGTCTTAGCAAAGATGTATATGTAGTTCAATCATGTATATGTGTATGTACACTATTCAGCTTCCTCATAAATCACTTACTACAGCATATTTCACTCAAAGATGTAGACCTTATCTTCCACTTGTACTATAATTAGTGTAGTATGGCACCATGTAGCGCCAGGTAGAGCTCGAGGATGCCCGGGAATGATAGATACCCTGCTTTTGGTTTCAGTAAACAGATGACGGACCTCAGTTCCGTACTGTGATGTGCTCAAATTGGTTAGCTTTCATATACAGAAGCCATGTGATACACATCATTTTTGTTTTGATTAGTAAGATATTACTATATCTCTATAAAGTGTCCCA

CDS

>Mapoly0008s0016.3
ATGCTGGACTCAACACTTCTCGAGAGCAAAGGCACTCCAGGTCAAGTAGCAGGCAAAGATGGAGTGCCGTCACTAACAGCTCCGAAAATCCTTGATGAAGTATTCGTTGATGAGGTCGTGTTGACGACTGTCAAGGATAGAGCTGACGAGAAATTTCTGCCTTCAACGGAAGATGCAAATATTGAGATGAACTCGTTGTCAGTTGCGGAAGCAGATCCATCTCAAAACTTTCTGAATGACGACGAGCACATGATTCACTTTGATGGTGACATGGATCAAGAATCAGATACAGATGATGATTCGGATGAGAAAGATGGATCAACAGCTCTGCTTGAAGATTCCGATCCAACAGCTCAGAAGAGGAATTTACTTGCACGTTTAAAGGTTGTGGAAGCCATGCTTCAGCAAGTGGCAAAAGAGGAACAATTGCGAACTCAACGAGAAGCCTCATTTACTAAAGCAGGCACCAACAATAGAGTCATCTCTACTTCCCCTGTCCTCGCTGAAAACGGAGTCGATCATAAAAGACAGAGGCGGCCAAATCCGAAGTACTTTGACGCAGAGATAGACGCTGAGTTCCAAATATCTGGAAGCTCTCTACTAGCCCGTGCTTCCTTTGGAGAGGGCGGAACAGGGGTTGTCAACATTCCTGACTCCCAGCCATTGCAAAATGGAGAAAATACTACAACAGCTGCAGTTACAAGCATATCACCACCAGATTACCTGAATCGCATACGTCCACCCATGATTCAGCGAGCTCGGACCGCGCTTGCACAAAAACATCGTGTGTTTTCTCTGTCCGAGAGCTCAACGGTGGCAGTGAAAACTGATAGTAATCTGGATAATTTATCAATTAGAGAGCTACATGAGGCTTACAGGAAAGCTTTTGGTAGAGATACGTCTGTAAAAGATAAGCACTGGTTGAAACGTCAAATCTTCATGGGTTTGAGCAAACAGAATGCAACTAGCAATGGCAAGGAAAATAATCGATCAAAGTCTACGTTGACCGACTCCAACTTGAAATCTAGGGCGGAAAAGATCTCTTCTGCAGAAGCGCCTCTTGTGACGTTCTCCACTGTTGGTGTCAATGGGAAGAGGAAGAGCAAGGGAACCGAGGCAATTTTCAGTCCTCATGAATGTAAGAAGGCACACCGGAAGACACTATCCTTGTCAGGACTATCACCCTTGAATTCTCCAAATCCAGGAATTACTGGGGATTGCAGCGGAGGAACCAATCAAGAGGGAACTCTCAGTGTGGTGCAGACTTCTGGAAGTTTGGTTGGGGAAAAGAGAATTCGAAAACCGAACCGCAGATATATCGAGGATGAAGGAGATGAATCCCTGGGACTCGCTGCTAATGGTAGCAGGTCAGTACTTAGTACACTTCCAGACGCTGGGAATGGGCTTCGGTCTGCTCCGCTAAGATTATCTTGGAAGAATGATGCGGAAGTTGTTGAGGCTGAGAGCAAAATCAACGTAATTAGAAATAAAAGCCTACGAGCTTCGACGCGGTCAACGTCTTCGATCCGATCGACATCTTCTAATGGAAGACGCAGCAAGCATGGCAACAACGGCATCCAAAAGAAAAAGATTGATTCGCGGGCTGCAAAGCTTGTGAAAATAGCACATTCTGCCCGAGCTGCCCGGCTTGATATACAGAAAACAATCCGCAAAGTGAAGTTTAGGTTACCAGCAGCTCCTGGTCAGGAAAAGGGTGAGGTGTTAAACGGTGGAGATGGAGAACAGGTATCGTGTTTGCTGCCGGTACGAATCGACGAAACCATAGGAGACCATGAACTGCTAAATTCTCAGTATCAAACCAGATCGGAATCAAATGATGAACAGGCTGTGGTGACAGTGCCCACAGCCAATGGCGGCACACGCCGTAAACATCATAGACCTTGGACCCTTCGGGAGGTTCTTACCCTCGTGGAAGGGGTAGCTCGATGTGGGGGTGGGAAATGGGCTGATATAAAGAAGCTGGCATTTTCCACCGTTAGTTATCGTACAGCGGTTGATTTAAAGGATAAATGGCGCAACCTTTTACGAGCGAGTAGAGCCCAGTTACACCCTCCCAAACAGGGAGAAACGCGCAAGAAGCAGTTTTCTGCTGCCATACCGTCGCAGCTACTTGCCAGAGTGAGGGAACTAGCTGCTCTCAATAACCAAGCTGTATCAAACGTCAGTGCAGGAAGTAGCACTAGCAGAAGTGGACGAGTTGTACATAGAAGATAA

Protein

>Mapoly0008s0016.3
MLDSTLLESKGTPGQVAGKDGVPSLTAPKILDEVFVDEVVLTTVKDRADEKFLPSTEDANIEMNSLSVAEADPSQNFLNDDEHMIHFDGDMDQESDTDDDSDEKDGSTALLEDSDPTAQKRNLLARLKVVEAMLQQVAKEEQLRTQREASFTKAGTNNRVISTSPVLAENGVDHKRQRRPNPKYFDAEIDAEFQISGSSLLARASFGEGGTGVVNIPDSQPLQNGENTTTAAVTSISPPDYLNRIRPPMIQRARTALAQKHRVFSLSESSTVAVKTDSNLDNLSIRELHEAYRKAFGRDTSVKDKHWLKRQIFMGLSKQNATSNGKENNRSKSTLTDSNLKSRAEKISSAEAPLVTFSTVGVNGKRKSKGTEAIFSPHECKKAHRKTLSLSGLSPLNSPNPGITGDCSGGTNQEGTLSVVQTSGSLVGEKRIRKPNRRYIEDEGDESLGLAANGSRSVLSTLPDAGNGLRSAPLRLSWKNDAEVVEAESKINVIRNKSLRASTRSTSSIRSTSSNGRRSKHGNNGIQKKKIDSRAAKLVKIAHSARAARLDIQKTIRKVKFRLPAAPGQEKGEVLNGGDGEQVSCLLPVRIDETIGDHELLNSQYQTRSESNDEQAVVTVPTANGGTRRKHHRPWTLREVLTLVEGVARCGGGKWADIKKLAFSTVSYRTAVDLKDKWRNLLRASRAQLHPPKQGETRKKQFSAAIPSQLLARVRELAALNNQAVSNVSAGSSTSRSGRVVHRR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>