Mapoly0009s0010



Description

CRAMPED PROTEIN

Reference DB

Database ID Description
OrthoMCL OG5_164774
PANTHER PTHR21677 CRAMPED PROTEIN

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB4 transcription factor, MYB Mapoly0009s0010.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0009s0010.1 scaffold_9:112286..121514  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0009s0010.1  

Gene structure:

mRNA scaffold_9:112286..121514  ( - strand )
three_prime_UTR scaffold_9:112286..113074  ( - strand )
CDS scaffold_9:113075..113629  ( - strand )
CDS scaffold_9:114005..114397  ( - strand )
CDS scaffold_9:114947..115520  ( - strand )
CDS scaffold_9:116072..116313  ( - strand )
CDS scaffold_9:116753..117015  ( - strand )
CDS scaffold_9:117154..117312  ( - strand )
CDS scaffold_9:117658..117955  ( - strand )
CDS scaffold_9:118273..118357  ( - strand )
CDS scaffold_9:118682..118791  ( - strand )
CDS scaffold_9:119215..119271  ( - strand )
CDS scaffold_9:119738..119785  ( - strand )
CDS scaffold_9:120300..120382  ( - strand )
CDS scaffold_9:121072..121105  ( - strand )
five_prime_UTR scaffold_9:121106..121514  ( - strand )

Sequences:

Gene

>Mapoly0009s0010.1
ATTTAAGAAAAAATCTTGAACACCGAAAGAAGCGCTTAGGATCTGCAAGGACGGCGTAATCACGGACGGACGGTAAGCGAGCCCGAGAAGTGAGCCGGACGGACCTGGGACGCAAGGACGGGAGAGCGGTGACTGCAGCTGCTCGCGCAGGGAGAGGTTCGATCTACAGGTAAATTGCACGACGGCTATGGCGATTGACCGCGTTCGAGGAAGAATTCACGTTGTTTGGAGGCTCCAATTGGACTAGGGACATGAGTCTTCGCAGCAGGCGAGCGATCGGGGCCAAATTGCGGTAGTTTGGATGGATTTGGGCTTCGATTAGAAGGGTCGTAGGGTGGAGTGTGAGGTCGATCGCTGTTGACATGATTAGACACCCCTTTATGACTTCATCAAACTTTCGTTCCCAGATATGGCTGTCTTCGAGTCAAATGCGTCATTGCCTGGTGAGTATTTGGCCTATTTTTTTTTTCAGCGATGATCAGTTTTGTTGCTGGCTCTGGCATGACGTGAAAATGTTAATTTCCAGTGAAACCTGTCTATCGGTTGCGATTGTGAGGTGACTTTTGAGTTTGTCGTCAGACCTGCTGAAAACTTCTCAATGTTAGGTCTTCAATGTCGTGACCATCGCAGTGTACATACTCTCCTTTAATGCTGTTGGTATCCTGCCGGTCGCAGTCGTCCTTTTTCTTGTGTGTTCTCTTCGAACTTTGCGATTCGGTCGACGTGCTCATACTTGCGGATTCAGTAGAGGCCTCCATTCATATTTTCGCTTTCTCTCTGTTGGAGGTCCTCGTCTAGCAGCGTTTGTCTGTTCAAATTTCTACTGTATGTCGCTTGAATTTACCTTGACTTCAGCACTTCATTTTCGGTCACAATGCGTGGTACAGTTTTACGCAACGAAACCTATTGTGCCTGCATTGCTTACAGAACTGCCTTATGGGATGATAGCTTTAAGATTGAAATTCTTTGACCTGCAGAACGTGTAGAAATCGCTAGACTAAGACTGCTTCTGGTAGCTGTTTTTTCACCGACTTTCAATTCACCTTGTCTGAGATTGGATCAAATGTGGAGTACTAGAGGAATTTGCATAACTCTGATGTTTCCCTATGTTGTATGACATCGATACAAGCAGAAAACAAGCCCACTAGGCAATGGGATGCATGGACACGTGAAGAGGAAGAAAATTTCTTTGGGGCATTACGGCAAGTGGGCAAGGTAAAGTTCAGAAAACGCTTTGCGAGGCATAAAATGTCAAACTTCAAGTAGTGTGTTGGCTTACTACGGAAGATCTTATCTGGGATCTGTTTTAGTCTTGCATTATTTTACCACTAAGCCCGCAAGCTTACAGCTTCCTAGAATATCTTGCTATAGAGTTTTGCTTCGATACGGAGGATTGAGTTAGGGCATTTTCTTAAACTGACGAGTGCATGAGCAGGAAAGTCTCACGATTTACCAGTTTACTTCCTGCTCAATAGTTTCAAGTCAAAAGTTTTCTATGTCCGCGAGTGTTGTAATTTTTTCGTCGGGTTTTATATATTGACTGTCTACCGAGACGTTTCTTTGGCTAGGATATTATACTTTCTCATTGCCAAGCTGAATGTGTTGGATGACTTTCAAGTGGGTGTGTTTGTTTTTTAAACCTGAAATAGAAGTCTGGATTAGCATTTATCATGCAGTGGTACAGGGATGAATACTATTTGCTCTTAAACTCATACAATCTGATGTGCAGAACTTCGAGAAAATCACCAGCCGAGTACAAACAAAGAACAAAGATCAGGTGTGGGTTTGATCCCCTTCGTATCCGCATGAATTTGCATCGACACATTATGTTTCTCTGCACGATGCACATTACTTGCACTCACATTGAAGAGTTCCCCCTTGTTGTTGTTTCAATTGCAAAGTTGTCAACGAAGTTGGGAGAGAATAAAATGAGTCGTCAAGTTCATCTAGGTTTCTTGTGAATAAAAGGTTCAAATCATCTGATCGAAAAGATTACAAACTGCTTGGAGGACTGCAAATGGTTTAGCGTGAGGAACTTATTTCGCGATTACGAGTTTATCATAACAACGGATGGTCCAATAGCAGGTTGTCGGGTAGGTCTTGGTGAACTGTAGGTTCCAGTCTTCGTGATTTTTGAAAGTCGGAGAGAAAGGTTTTTGCTCGATTGATGCACTGTACCTTCTTCTTGAAACCTTCTGTGTCTGAGTCTATCAAAGATGCTTAACAAGTTAAGTTTGACCCAGGTGCTGTGGACTCCACTGCCTGTCCGTCAACCAGACCAACATAAGGCACCAGACTTGGTATTGTGTATTGAGGATTAGTTTTTCATGCCACTACAAAGGATATTATATCATTAGATATCACTTCTACAGTTGCTATGAACCTGAATTTGTAAATCGAAGTACGTAATGTTGACGCCCTTGAATAATATCGAGTTTATATTCAGTTCCATGTTTTTATGACCCATGACGAATATAGTTAAGACGTACTGGAGAGAAATTTTATGATTTGATACAATTCATCACTAACGTCTTGCTTTTAAAGCTCAATATTAAGCCTGAGATTTTGTGCCCGTGTCTTGGAATTCTGAAATCATGTCTTGTAGACAACACATATTTCACTACGATCGCTGCTGTAGCGTGTTGTCTACTTTTGCAAGTATCAGTGCCGCAATTTTGTTGGAACTGTACATCCCCTTTTAATCTCATGGCCTTTTGCTGTAGGTTCGTCATTACTACTATCGCGTCATTAAACGAATGAACAAAATTCTGTCTCCAAGCTTGGTATTAGATGCCAAGAACTCCAGCTATGTGAATAGTGCGATGCTAAGATGGTAAGTGTACCGTCTCTTGCACTTTTCGTTTGTTGTGTGGTTAACTACTTTGACTGAGCAGAACCAGGAACAGGTGGCTTGTGATGTTAGGAATGAGATTTGCGTGTTTAAAAGAATCAGTAGACCTCCGTTTATTCTTCCTCCATCTTCTCCACTTTCGCTCGGTTAATGGCCAACCATTTACTGGTTTGAAAGTTAGCTACCTTATATGTACAGACTATCATTCTCCAGTTCAATGCTTCGTTAAGCAGCAGTGGAGTTAAGAAGGTTATTTGTGCTGTAAAGTCCGTTGTTGTTACTCATTTCGCTGTTTGTCATTGACAGGTGGTCGTTGCTGGAAAAGCATAGTTGCTCAGCTTCTAAACTGCGGTTGAAGCCCAGACGCTTTAAAACATTTGTCACCGCTCTGGTCGGTCTCTTCACTCTACTGTCATACTCCTCCATTTCTTTAAGCTAATGACTTAATATTCTGGTCCCTTTGCCCTCATGGATTCGTTATCTTACTACAGTAACCTTTCCTCTTGGCCTGCGAACTGGTTACTTCCCAGTTTAACTTGCCTTCGAGTGTTTGGTTAGTGCTGAGAGCATGCTCAATATGCGAGGTGAACCTAATGTCACATGTCTCCCTTGGACCACCTGGACCAAGGTAGGCCTGACTAGTATTTCTGCTTATTGGTGTTATCATATGGTGTGATTTTGTTGGTCTTGCTTCTCTCTTTATATCAGGAGCACCAACTTTTGAAAGATAGAAAGAAGCCGAAGAAGAAATCCCCACCATCAGCCTCCTCGAAGAAGCCCACATTACCAACTGAAGCATCTGATGGGATATCGATCGAGTCTGGGGAATGTACTACGAGCGGAGTAGCTTCAAGTAAGGCATCTCTGGAAGAACTCCAAAGCTCCCAATCCGTTGTAGCAAGCCGAAGAACTGCCGTGAAACGTAAAGCCACCAACAATGCATCTAAAAAATCGAGTACGAGGAGCGAAGCAAAGCGTCCTCCTAGGCCTCGTAAAAAACCTTCTGGTATGTGATGCTTAACGAATGTTCACATTTATCTTCTTTTCTTAAGAGAATATCCTACATAAGCTATTGGGGTTTGGAAACAAATGAAACAGTAAATTTACGTTGTGCACATTTGATATGGTTGGTCTGTTGTGTCGGCGTCGTTACATCTTTCTTCACTCGTGATTATTGCATCGCGTCTGGGTCGCCTGCGTTCAAGGTTCATAGGTCCACTTTGGATTCGTATATGTTTTTTTGCAGAAACAAGCACCTCTTATCAGTATATAACATTTGATTATTGAGGACCTTGTGTGCAGTCTTTATGACAAATGTGTATAAGATGGGAATCTCATGTTATTCTGGCAGATGGTAAACGCTCAAAGGCTGCTAACGCTGAGTTGGAGAAAGAAGGAAATCTAGGGGTTGCAAATGCAGTGCCGGAGTTGCTAGAGCGGGATGCTGGAGCTGAGGGCATTTTACCTGATTCTGACTCATCTAATACAAACTGCAAAAGTCATCCAAGAGGTAATGATGTGATTGTGGATCCTCGAACAGGTCAAATTTCTTCAGCAACATCTGCAGCGTTTTCAAAGTTGGTATTACTGGACAAGCTTCCCAGCGATCATCCTTGTTTACGAGGGAGACCTCGGCTTGTGAATGTAGTAGCGTTGGCAGGACCAAGTGGTGCAACATCTGCGACACCTCCGCCATCGTCAAATGCAAAGGATACTTGGCCTCCTTTGGAGATTATTCCAGACTTGAGCTTCGAAGCCCAGAAGTCGCTGGCGTTGCTTGGTACAAGATGCAACAACTGCAGCAGCTTGAGATGTACTGTTGGAGAGGAGATGAAGAGTGACAGTACAGATGCAAAAGTGAAGCTGCAATTGTTCCCATTTGATGATAATATCCGGAAGGCATTAGAGCAGGTACATGTTTCAGCTTTGTCATCAGATTGCCGAGTCGTTCACATGTGCATGGGTTTACTTGAAGGTAGTCTTCATCTTAGATTTCCTATGGCTGGGCGGAAACCTGATTCGATTTGATGATTTATCCTATCTTAGATCCGTTCGATTCCTTTTTCGTTTCTCTCTAGCTTGCTGTTAGCATGTGCACCATCCTGATTCATTTTACGATCGATCTTTGTCTCTAGCACCGTCCTGCTATTGTGAGTTGACTTGGTCGAACGGCTACAACATGAGGAGTCAGATAGAGAACTCAGTTAAAAGCCTAAAAGCCTATACTGGATTGAAAAACTTACTGTTTACCCTCGGACCTTGTTTTAAGATTGTAGGTTCGATCTTCCACTTTTCATCGTTGTGTTTAGCTTCTGTAATATGTTGTGACTTTTGAGTCTTGTTTGTACAGGATGGTCTCAATCCACATCTAGAGTTGACTTTGAAAGCTCGGAAGAGTATATCTTCAGTTTTAAACCATCTGACTCAAAAGTGGGGACGGTCTTCAATCGCTTCTGGGGAGCTACGCCTTTTTCCTTTCAACACTCAATGGTCCAGTTTAGCTTCACGGAAGAGCTGGAGTTATCTTGATTCCAATGTGAGTGCAGCCGAGGTTCATGCCACGCTTGGGAATCCAGCAGTCTTCCGACTCAGGTGAGAACCTCTGATCATATCCTTGGGGGATTCGTGAGGAGTGCTGGACTGGACCTTGAATAGAGTGGCTTATAGGAAAGGTCAACTTTTGTGCACTGCTGTCGAAAAGTAGGGGACCTGATACAATGTAATATCATACGTTGGAATCTCCTGGCCTTATGGCGGCTTAATATCATGTATGGCGTATGGAAGGGAGTTTTTCTTGCGGTCAATTATAATCAGGCGGGTACAAGAAACATAATTCAAGATTGCACGCACGGCCAAGGCGGTGCGATTACAAATGGGATATCTGGGAACAATGACCATCTTAGCGCTGCAAAAAGCATTTGCTCGATTTGGGATAATATTGCGTAATTCGCGCAGTCTAGAGGCATGATTGTTGAAAAACTTTACCCAATATAGAATAATGTGTTCTGTTTGAGGCATCTGCTTTGACGAATATGCCGAAGTCAAGGAAGTTGCCTTACTTCGAAGTACTGTGTGTTATGTTGATTATATGCATGTATTATATCTCTGTGTGAATCACTGAGAAGAGATGCACGTTTGCCCAGATATGCCTGGATCCCAAGCCGTGTGCTTGAGTCGTCTCCTGCAGTTCTTCAGCAAGTCACGGACACGTGTACCGATGTGCTTTGTCCGGTGAAAGTGCTACCTGTTGGAGGTTCTTGTTCTGAGTTCTCAAAATCCGTTCCGGTCTCAGCTGCCACAATTGAAGCCATAGCTCAACTTCCACCTCGGCTTCCTTCAAAGTTTGGTAGCACAATTGGAGAGGACTGTTTGTCCGCTAGGACGGAGATACCCTCCATAGCTCCGGCCTACGCACCAAGCAATGTGAACTCTTCAGACACGTCTGCTATCCCCGTGCTTACTTCTTCAAAATCTCAAGGTGTTGAGGCCGAAGACGATGCTGAGCTGAAGGAGTGTGCCTCCTTTGAGGCTGTGGAGGGAAATTCTGAAATTGGGCGCCGATCAAGTGTTACAAGCGTGTCACCCGTCATTCATGGTGAAGCAGAAGTCATAGTGAAGGCTGCCTCTAAACTTCAAGATGGTGCAGCTCAGCTTTCAGGTTGTGGTTGGATGTATGAAAGCACCGATGGATTTGCCCAGCAGCTCTGGACTCTGGAGGTTTGTTCTTGTCTTCCATGTAATCAATTGTCTTATGTTTCAGCCCTATACTTAGCTTATTGGTTCTCAAGTTTCTAAAGTGGTACATGATGGGATTAGTATTCAAAACCCAGACCGGTCAAGCCTGGTACGACTAACATGGCAGAATTTCTTCCTCTACGTTTTTACCACGTTTCATCTGCTTTGACTCTTATTGTCTATTTCTTTATGGACGTAAAGACCCCGTGTCAAACCTTCCAGTTGCCTTTGATTGTAATTTCCCACTCTTTAAATCACTTTTACTGTCTAAGCTTTTCCATGTTAATGAAAGCATCACTTTTCCATTCTTCCCAGCCTATTTCAAGGATGCCTAACTGCTATTTACCTTTTTCTTTAAACAGCAAGCTGTCGGTAACTTGCTGAACTCAATTGCTGAGCAGCTGGTTGGTTACAACATGGTCCTGGCAAATTAAGCGTTCACATCATTGAATGTTACCCTATTTGGTTGCGGCCTCTCATGTGCTGTTTGTACGCCTCTTCCTGGACATGCCATCCTCGTATTACTTGCAGGATTCATTGCGCAGCAACCATGGAGTTTCGATGGCTCAAATGGATTGGGTAGATAGCCTGACAAACATCAGCGTGAGTGAGTTACTGGGAGACGGAGTATCTCGTCACGACTTCCCAGGATGTGCACAACAAAACGGTGTCGACCAGCCGCATTTAACCTCTCAAATGGATTCTTTTGATATATCACTGTCTGTTCAACAGTCACATATGGAGCAGCCTTCAATAGCAATCTGGGGCGGTGAGGAAACTTGTGACGCTTTTTCATTTCAAAAAGCTATGGTTTCTGATCAAAGCATCAAGCAAACTGTCAACCCTTTGAACCATGAAACGTCTTTGAGCTCCCTTGGGCTGGATATGACCTTTCGAAATATAGCTCCATTATGTTGGAGAGAGGTGAGCTCTTCACCCTACAGCATTACATGTCCATGTATACACGAAGAGTCTTTCTGTACATTTTCAATGCTTATGTTTTTGTTTCTCTTCAGTTAAGTTTAGTAGTGTACCAGTTTTGGCAGAAATAACCATCGAACCGGATATGAACTTATGGATCCTACTGCAAACGTGTCGAGATGTATAGGTTATCAAAAAGATTTTCATTTACATTCTCATTGCTTGTTTTGTCAAGATTGCTCTTTGTGGATGCATCATATCTACCTGTGGTTTGTAGTTGGTGTATATTTGAGTTTTGATATATTTGGTCTTGCTGGATAACATGTTGATCACATATGAAGGAAAAGCTATATTAATGCCCGAAGTTTTTATCTGCAGCAACTTCAAAGCTCTCAAAATCAGGATCTTCTGTTCGGTGGAGAAGCATCCATTGGACTGAGTGGTCTTATCGAAGCACTTGCCGGCAATGGAAGCTTGGATGGATTTCAAACCGAGCCCTTTAGTCAGCTTTCCGACGAACTCAATGTTGACACAAGAGTCAAACAAGAATTCGAAGTTATGGGTAAAACCAAAGAAGGAAACGATGAAGCTTGGGACGTGGCTCCCAAAAGTCTGAGGGTGCAGGTATCACCATCGATTGGCAATGTTGTTGACGATTCTACTTCTCTAGTAGATAACTTTGCTGATATCAGGAGTGACCTGTTGGAAGGGGCCAAGAATGACGAGGGTCAAGAAAACACCGAGTTCTTTGTTGGAACAAAGAGTAGTCCGATTGTTTCTGTTCAAGATGGAGATTCTGATGTACCTACCAGGTCAGCCAGCTGTCGGCCTCAAAGGCAGAAAGACAGACGTCAAGCTTCGGGATCACCTCCAAGACCCTTCAAATTGAATGCTCGTTATACGAATATGCGTTCTCTCAAGCTTCAGACTTAACGTGAGATGCGTACTGAAGTGTCAAGGTATTCTTGAATCGGACAATCCATTTCCAACAAAAGCAGCTCAAAGTATCCTCCTTCAGCGAATAATTGTAACGAGCACGTGGAGGACACGGACTGGCAGGTTTTGTCTTCTACCCTGAGTTTCTTTTATTTCTGGAGGAGCACAGAGCAAGAAGATGCTTTGCTTTTTATGTGAAGCATGAACAAGCTCGGCATGCCGTGTACGGCTCTTTCAAGCACCAAGCAAAAAGCTAGCAGTATGGCCCGTCACAAGCGCAGAGCTGCTGGAACATTTTGTCCAGCGTCTTGGATGCAGGTGAATTACGAAGAGCTGCCCGAGTTTGTTGATTATAATGAAACTCGTCGCTCCTTCACAAGCTGGGAATTGACAAAAGATACCAATATTGAATCGGGAGCGAACAATTACATTTCTTTCATATCTTGGCGTATGAATCCATCAAAAGGTGGAACGCGATCGCGGCCATGGAGATATAATGAGCCGCCAATCTTCCGCCCGGCTACAACATACATGTTCACGTACCTCTGCGTGAGGCTTGAACAAACTGGACTTGGGGCATTCATGATGCCTTCTTGTATCTATTTCCTAAGCCTAAGCTCACGATCAGGAATGTGGTTGGCGCATGTTCGCTACCGAGTAAACATCTTGTTCTTGAGTAGGCATTTGTAACATATATTGTCCAGTACAGAAGAGAACTTGCTAAAGACAGAGCTGAAGCAATCACTAACATACAACTGTTGACGATCAACCTGGGCGATACTGATG

mRNA

>Mapoly0009s0010.1
ATTTAAGAAAAAATCTTGAACACCGAAAGAAGCGCTTAGGATCTGCAAGGACGGCGTAATCACGGACGGACGGTAAGCGAGCCCGAGAAGTGAGCCGGACGGACCTGGGACGCAAGGACGGGAGAGCGGTGACTGCAGCTGCTCGCGCAGGGAGAGGTTCGATCTACAGGTAAATTGCACGACGGCTATGGCGATTGACCGCGTTCGAGGAAGAATTCACGTTGTTTGGAGGCTCCAATTGGACTAGGGACATGAGTCTTCGCAGCAGGCGAGCGATCGGGGCCAAATTGCGGTAGTTTGGATGGATTTGGGCTTCGATTAGAAGGGTCGTAGGGTGGAGTGTGAGGTCGATCGCTGTTGACATGATTAGACACCCCTTTATGACTTCATCAAACTTTCGTTCCCAGATATGGCTGTCTTCGAGTCAAATGCGTCATTGCCTGAAAACAAGCCCACTAGGCAATGGGATGCATGGACACGTGAAGAGGAAGAAAATTTCTTTGGGGCATTACGGCAAGTGGGCAAGAACTTCGAGAAAATCACCAGCCGAGTACAAACAAAGAACAAAGATCAGGTGCTGTGGACTCCACTGCCTGTCCGTCAACCAGACCAACATAAGGCACCAGACTTGGTTCGTCATTACTACTATCGCGTCATTAAACGAATGAACAAAATTCTGTCTCCAAGCTTGGTATTAGATGCCAAGAACTCCAGCTATGTGAATAGTGCGATGCTAAGATGGTGGTCGTTGCTGGAAAAGCATAGTTGCTCAGCTTCTAAACTGCGGTTGAAGCCCAGACGCTTTAAAACATTTGTCACCGCTCTGGAGCACCAACTTTTGAAAGATAGAAAGAAGCCGAAGAAGAAATCCCCACCATCAGCCTCCTCGAAGAAGCCCACATTACCAACTGAAGCATCTGATGGGATATCGATCGAGTCTGGGGAATGTACTACGAGCGGAGTAGCTTCAAGTAAGGCATCTCTGGAAGAACTCCAAAGCTCCCAATCCGTTGTAGCAAGCCGAAGAACTGCCGTGAAACGTAAAGCCACCAACAATGCATCTAAAAAATCGAGTACGAGGAGCGAAGCAAAGCGTCCTCCTAGGCCTCGTAAAAAACCTTCTGATGGTAAACGCTCAAAGGCTGCTAACGCTGAGTTGGAGAAAGAAGGAAATCTAGGGGTTGCAAATGCAGTGCCGGAGTTGCTAGAGCGGGATGCTGGAGCTGAGGGCATTTTACCTGATTCTGACTCATCTAATACAAACTGCAAAAGTCATCCAAGAGTAGCGTTGGCAGGACCAAGTGGTGCAACATCTGCGACACCTCCGCCATCGTCAAATGCAAAGGATACTTGGCCTCCTTTGGAGATTATTCCAGACTTGAGCTTCGAAGCCCAGAAGTCGCTGGCGTTGCTTGGTACAAGATGCAACAACTGCAGCAGCTTGAGATGTACTGTTGGAGAGGAGATGAAGAGTGACAGTACAGATGCAAAAGTGAAGCTGCAATTGTTCCCATTTGATGATAATATCCGGAAGGCATTAGAGCAGGATGGTCTCAATCCACATCTAGAGTTGACTTTGAAAGCTCGGAAGAGTATATCTTCAGTTTTAAACCATCTGACTCAAAAGTGGGGACGGTCTTCAATCGCTTCTGGGGAGCTACGCCTTTTTCCTTTCAACACTCAATGGTCCAGTTTAGCTTCACGGAAGAGCTGGAGTTATCTTGATTCCAATGTGAGTGCAGCCGAGGTTCATGCCACGCTTGGGAATCCAGCAGTCTTCCGACTCAGATATGCCTGGATCCCAAGCCGTGTGCTTGAGTCGTCTCCTGCAGTTCTTCAGCAAGTCACGGACACGTGTACCGATGTGCTTTGTCCGGTGAAAGTGCTACCTGTTGGAGGTTCTTGTTCTGAGTTCTCAAAATCCGTTCCGGTCTCAGCTGCCACAATTGAAGCCATAGCTCAACTTCCACCTCGGCTTCCTTCAAAGTTTGGTAGCACAATTGGAGAGGACTGTTTGTCCGCTAGGACGGAGATACCCTCCATAGCTCCGGCCTACGCACCAAGCAATGTGAACTCTTCAGACACGTCTGCTATCCCCGTGCTTACTTCTTCAAAATCTCAAGGTGTTGAGGCCGAAGACGATGCTGAGCTGAAGGAGTGTGCCTCCTTTGAGGCTGTGGAGGGAAATTCTGAAATTGGGCGCCGATCAAGTGTTACAAGCGTGTCACCCGTCATTCATGGTGAAGCAGAAGTCATAGTGAAGGCTGCCTCTAAACTTCAAGATGGTGCAGCTCAGCTTTCAGGTTGTGGTTGGATGTATGAAAGCACCGATGGATTTGCCCAGCAGCTCTGGACTCTGGAGGATTCATTGCGCAGCAACCATGGAGTTTCGATGGCTCAAATGGATTGGGTAGATAGCCTGACAAACATCAGCGTGAGTGAGTTACTGGGAGACGGAGTATCTCGTCACGACTTCCCAGGATGTGCACAACAAAACGGTGTCGACCAGCCGCATTTAACCTCTCAAATGGATTCTTTTGATATATCACTGTCTGTTCAACAGTCACATATGGAGCAGCCTTCAATAGCAATCTGGGGCGGTGAGGAAACTTGTGACGCTTTTTCATTTCAAAAAGCTATGGTTTCTGATCAAAGCATCAAGCAAACTGTCAACCCTTTGAACCATGAAACGTCTTTGAGCTCCCTTGGGCTGGATATGACCTTTCGAAATATAGCTCCATTATGTTGGAGAGAGCAACTTCAAAGCTCTCAAAATCAGGATCTTCTGTTCGGTGGAGAAGCATCCATTGGACTGAGTGGTCTTATCGAAGCACTTGCCGGCAATGGAAGCTTGGATGGATTTCAAACCGAGCCCTTTAGTCAGCTTTCCGACGAACTCAATGTTGACACAAGAGTCAAACAAGAATTCGAAGTTATGGGTAAAACCAAAGAAGGAAACGATGAAGCTTGGGACGTGGCTCCCAAAAGTCTGAGGGTGCAGGTATCACCATCGATTGGCAATGTTGTTGACGATTCTACTTCTCTAGTAGATAACTTTGCTGATATCAGGAGTGACCTGTTGGAAGGGGCCAAGAATGACGAGGGTCAAGAAAACACCGAGTTCTTTGTTGGAACAAAGAGTAGTCCGATTGTTTCTGTTCAAGATGGAGATTCTGATGTACCTACCAGGTCAGCCAGCTGTCGGCCTCAAAGGCAGAAAGACAGACGTCAAGCTTCGGGATCACCTCCAAGACCCTTCAAATTGAATGCTCGTTATACGAATATGCGTTCTCTCAAGCTTCAGACTTAACGTGAGATGCGTACTGAAGTGTCAAGGTATTCTTGAATCGGACAATCCATTTCCAACAAAAGCAGCTCAAAGTATCCTCCTTCAGCGAATAATTGTAACGAGCACGTGGAGGACACGGACTGGCAGGTTTTGTCTTCTACCCTGAGTTTCTTTTATTTCTGGAGGAGCACAGAGCAAGAAGATGCTTTGCTTTTTATGTGAAGCATGAACAAGCTCGGCATGCCGTGTACGGCTCTTTCAAGCACCAAGCAAAAAGCTAGCAGTATGGCCCGTCACAAGCGCAGAGCTGCTGGAACATTTTGTCCAGCGTCTTGGATGCAGGTGAATTACGAAGAGCTGCCCGAGTTTGTTGATTATAATGAAACTCGTCGCTCCTTCACAAGCTGGGAATTGACAAAAGATACCAATATTGAATCGGGAGCGAACAATTACATTTCTTTCATATCTTGGCGTATGAATCCATCAAAAGGTGGAACGCGATCGCGGCCATGGAGATATAATGAGCCGCCAATCTTCCGCCCGGCTACAACATACATGTTCACGTACCTCTGCGTGAGGCTTGAACAAACTGGACTTGGGGCATTCATGATGCCTTCTTGTATCTATTTCCTAAGCCTAAGCTCACGATCAGGAATGTGGTTGGCGCATGTTCGCTACCGAGTAAACATCTTGTTCTTGAGTAGGCATTTGTAACATATATTGTCCAGTACAGAAGAGAACTTGCTAAAGACAGAGCTGAAGCAATCACTAACATACAACTGTTGACGATCAACCTGGGCGATACTGATG

CDS

>Mapoly0009s0010.1
ATGGCTGTCTTCGAGTCAAATGCGTCATTGCCTGAAAACAAGCCCACTAGGCAATGGGATGCATGGACACGTGAAGAGGAAGAAAATTTCTTTGGGGCATTACGGCAAGTGGGCAAGAACTTCGAGAAAATCACCAGCCGAGTACAAACAAAGAACAAAGATCAGGTGCTGTGGACTCCACTGCCTGTCCGTCAACCAGACCAACATAAGGCACCAGACTTGGTTCGTCATTACTACTATCGCGTCATTAAACGAATGAACAAAATTCTGTCTCCAAGCTTGGTATTAGATGCCAAGAACTCCAGCTATGTGAATAGTGCGATGCTAAGATGGTGGTCGTTGCTGGAAAAGCATAGTTGCTCAGCTTCTAAACTGCGGTTGAAGCCCAGACGCTTTAAAACATTTGTCACCGCTCTGGAGCACCAACTTTTGAAAGATAGAAAGAAGCCGAAGAAGAAATCCCCACCATCAGCCTCCTCGAAGAAGCCCACATTACCAACTGAAGCATCTGATGGGATATCGATCGAGTCTGGGGAATGTACTACGAGCGGAGTAGCTTCAAGTAAGGCATCTCTGGAAGAACTCCAAAGCTCCCAATCCGTTGTAGCAAGCCGAAGAACTGCCGTGAAACGTAAAGCCACCAACAATGCATCTAAAAAATCGAGTACGAGGAGCGAAGCAAAGCGTCCTCCTAGGCCTCGTAAAAAACCTTCTGATGGTAAACGCTCAAAGGCTGCTAACGCTGAGTTGGAGAAAGAAGGAAATCTAGGGGTTGCAAATGCAGTGCCGGAGTTGCTAGAGCGGGATGCTGGAGCTGAGGGCATTTTACCTGATTCTGACTCATCTAATACAAACTGCAAAAGTCATCCAAGAGTAGCGTTGGCAGGACCAAGTGGTGCAACATCTGCGACACCTCCGCCATCGTCAAATGCAAAGGATACTTGGCCTCCTTTGGAGATTATTCCAGACTTGAGCTTCGAAGCCCAGAAGTCGCTGGCGTTGCTTGGTACAAGATGCAACAACTGCAGCAGCTTGAGATGTACTGTTGGAGAGGAGATGAAGAGTGACAGTACAGATGCAAAAGTGAAGCTGCAATTGTTCCCATTTGATGATAATATCCGGAAGGCATTAGAGCAGGATGGTCTCAATCCACATCTAGAGTTGACTTTGAAAGCTCGGAAGAGTATATCTTCAGTTTTAAACCATCTGACTCAAAAGTGGGGACGGTCTTCAATCGCTTCTGGGGAGCTACGCCTTTTTCCTTTCAACACTCAATGGTCCAGTTTAGCTTCACGGAAGAGCTGGAGTTATCTTGATTCCAATGTGAGTGCAGCCGAGGTTCATGCCACGCTTGGGAATCCAGCAGTCTTCCGACTCAGATATGCCTGGATCCCAAGCCGTGTGCTTGAGTCGTCTCCTGCAGTTCTTCAGCAAGTCACGGACACGTGTACCGATGTGCTTTGTCCGGTGAAAGTGCTACCTGTTGGAGGTTCTTGTTCTGAGTTCTCAAAATCCGTTCCGGTCTCAGCTGCCACAATTGAAGCCATAGCTCAACTTCCACCTCGGCTTCCTTCAAAGTTTGGTAGCACAATTGGAGAGGACTGTTTGTCCGCTAGGACGGAGATACCCTCCATAGCTCCGGCCTACGCACCAAGCAATGTGAACTCTTCAGACACGTCTGCTATCCCCGTGCTTACTTCTTCAAAATCTCAAGGTGTTGAGGCCGAAGACGATGCTGAGCTGAAGGAGTGTGCCTCCTTTGAGGCTGTGGAGGGAAATTCTGAAATTGGGCGCCGATCAAGTGTTACAAGCGTGTCACCCGTCATTCATGGTGAAGCAGAAGTCATAGTGAAGGCTGCCTCTAAACTTCAAGATGGTGCAGCTCAGCTTTCAGGTTGTGGTTGGATGTATGAAAGCACCGATGGATTTGCCCAGCAGCTCTGGACTCTGGAGGATTCATTGCGCAGCAACCATGGAGTTTCGATGGCTCAAATGGATTGGGTAGATAGCCTGACAAACATCAGCGTGAGTGAGTTACTGGGAGACGGAGTATCTCGTCACGACTTCCCAGGATGTGCACAACAAAACGGTGTCGACCAGCCGCATTTAACCTCTCAAATGGATTCTTTTGATATATCACTGTCTGTTCAACAGTCACATATGGAGCAGCCTTCAATAGCAATCTGGGGCGGTGAGGAAACTTGTGACGCTTTTTCATTTCAAAAAGCTATGGTTTCTGATCAAAGCATCAAGCAAACTGTCAACCCTTTGAACCATGAAACGTCTTTGAGCTCCCTTGGGCTGGATATGACCTTTCGAAATATAGCTCCATTATGTTGGAGAGAGCAACTTCAAAGCTCTCAAAATCAGGATCTTCTGTTCGGTGGAGAAGCATCCATTGGACTGAGTGGTCTTATCGAAGCACTTGCCGGCAATGGAAGCTTGGATGGATTTCAAACCGAGCCCTTTAGTCAGCTTTCCGACGAACTCAATGTTGACACAAGAGTCAAACAAGAATTCGAAGTTATGGGTAAAACCAAAGAAGGAAACGATGAAGCTTGGGACGTGGCTCCCAAAAGTCTGAGGGTGCAGGTATCACCATCGATTGGCAATGTTGTTGACGATTCTACTTCTCTAGTAGATAACTTTGCTGATATCAGGAGTGACCTGTTGGAAGGGGCCAAGAATGACGAGGGTCAAGAAAACACCGAGTTCTTTGTTGGAACAAAGAGTAGTCCGATTGTTTCTGTTCAAGATGGAGATTCTGATGTACCTACCAGGTCAGCCAGCTGTCGGCCTCAAAGGCAGAAAGACAGACGTCAAGCTTCGGGATCACCTCCAAGACCCTTCAAATTGAATGCTCGTTATACGAATATGCGTTCTCTCAAGCTTCAGACTTAA

Protein

>Mapoly0009s0010.1
MAVFESNASLPENKPTRQWDAWTREEEENFFGALRQVGKNFEKITSRVQTKNKDQVLWTPLPVRQPDQHKAPDLVRHYYYRVIKRMNKILSPSLVLDAKNSSYVNSAMLRWWSLLEKHSCSASKLRLKPRRFKTFVTALEHQLLKDRKKPKKKSPPSASSKKPTLPTEASDGISIESGECTTSGVASSKASLEELQSSQSVVASRRTAVKRKATNNASKKSSTRSEAKRPPRPRKKPSDGKRSKAANAELEKEGNLGVANAVPELLERDAGAEGILPDSDSSNTNCKSHPRVALAGPSGATSATPPPSSNAKDTWPPLEIIPDLSFEAQKSLALLGTRCNNCSSLRCTVGEEMKSDSTDAKVKLQLFPFDDNIRKALEQDGLNPHLELTLKARKSISSVLNHLTQKWGRSSIASGELRLFPFNTQWSSLASRKSWSYLDSNVSAAEVHATLGNPAVFRLRYAWIPSRVLESSPAVLQQVTDTCTDVLCPVKVLPVGGSCSEFSKSVPVSAATIEAIAQLPPRLPSKFGSTIGEDCLSARTEIPSIAPAYAPSNVNSSDTSAIPVLTSSKSQGVEAEDDAELKECASFEAVEGNSEIGRRSSVTSVSPVIHGEAEVIVKAASKLQDGAAQLSGCGWMYESTDGFAQQLWTLEDSLRSNHGVSMAQMDWVDSLTNISVSELLGDGVSRHDFPGCAQQNGVDQPHLTSQMDSFDISLSVQQSHMEQPSIAIWGGEETCDAFSFQKAMVSDQSIKQTVNPLNHETSLSSLGLDMTFRNIAPLCWREQLQSSQNQDLLFGGEASIGLSGLIEALAGNGSLDGFQTEPFSQLSDELNVDTRVKQEFEVMGKTKEGNDEAWDVAPKSLRVQVSPSIGNVVDDSTSLVDNFADIRSDLLEGAKNDEGQENTEFFVGTKSSPIVSVQDGDSDVPTRSASCRPQRQKDRRQASGSPPRPFKLNARYTNMRSLKLQT

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>