Mapoly0009s0013



Description

AP2 domain

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
OrthoMCL OG5_205582
PFAM PF00847 AP2 domain
PANTHER PTHR32467 FAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpAP2L2 transcription factor, AP2/ERF Mapoly0009s0013.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0009s0013.1 scaffold_9:181261..184601  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0009s0013.2 scaffold_9:181261..184601  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0009s0013.1  

Gene structure:

mRNA scaffold_9:181261..184601  ( + strand )
five_prime_UTR scaffold_9:181261..181313  ( + strand )
CDS scaffold_9:181314..181365  ( + strand )
CDS scaffold_9:181554..181711  ( + strand )
CDS scaffold_9:181825..181898  ( + strand )
CDS scaffold_9:182555..182605  ( + strand )
CDS scaffold_9:182781..182857  ( + strand )
CDS scaffold_9:183006..183853  ( + strand )
three_prime_UTR scaffold_9:183854..184601  ( + strand )

Sequences:

Gene

>Mapoly0009s0013.1
GTCGTGCCTTTGCCTTGTGCTTGTGTTTGTGCTTGTGCTTCCGACATGAACCGATGCGGCTGGCGTCCTCTCCCCTCCATCGACCGGTCCGACCAGTTTATCTCGGTAAGTGCTCGCTCCTCTCGCTACCTCTGGCCGTCAGTCTGTCGAGGGGCTAGGAAGGGGGCTTGTCGTTGACGATCCGCGCTTAGCGAGCTGCAAGTGGCAAATTGGAACTGAAACGTGTCAGTTTGATTGATGATCACGTGGCTGACCAATTGGGGCGTATGTGCTTGGGCTTGTGCTTGTCTCAGGGGCTTACGACGAAGAGGAGGCGGCAGCTCGCGCTTATGATCTCGCTGCTCTCAAGTATTGGGGCCCCGGCACGCTCATCAATTTTCCCGTGAGCACATTCGAGACCGAAGCCATTAGAACGTCGTTTGTAATCTGCCTCGTGCGGTGTGGCAAGCTGGTGCCGTCAATCTCTGTCGTCAGTTCATTGCTGCGCTCGAATGTGCTGGAGTCCGTGGTCTTTTCTGCTCTCTTGTATGTCAATCGGCTGACGGAGCTGTCTGTCGATTGCAGGTGAGCGATTATGCGCGGGACATCGAAGAGATGCAAAATGTCACGCGGGAGGAATACCTCGCGTCGTTGAGGAGGTAATTATAGCTTCGATGATCGACGATCAGTCTCAAGGATGTAGGTCTCGGTCGAATGCCTGTGAAGGTTCTGTTCTGTGTCCATGTGCCCGGTCGCTGCTCGGATGCATGACCAGCAAGGCTAGTCTTGAAGTCTCGCGGTCTGCCGACCATGTCTCATGTCTCGATCGACCGTGCCCTGTCGAGACTGATTTTGCCCAGCGTTTGTCATTCTATTGATCCCTTAGCTCGAGCTAGCGAGCCGTGTTGACTTCATTCTATTCAGTCAGCCTGTAGATGCTGCTGATCGCCGCCTTCTCTCTGCTGCTCATCATGAGCTGAAACTCATCCAGTTGGCTAATGGATTAGACTTTTAGAGTTGCTAAACTAAACTTGCCGTTAATGCTGAGTTCACTAGATTGGGGTTCGCGTGTTCGTGATGTTTGCTGCCAGCAAATTTTTTTTTCTGACTGTGAATCGAAATATACCCCGCAATGCTTGCCCTGAATGTGATGTGGTCCTGAAGGTATGGAGATGGTCGCTCGGTTGTCAGAGGTCGGCTAACACGAGTCAGAACATTAGACGAGCATAAAATCGAATTGCTCACCGACGCAGATACTCAAGCGTCGTCGAGCAACTTGAAATTGATCTCTTGTTCGTCCATCTTCTTCTCGCAGGAAGAGCAGCGGATTCTCCAGAGGCGTATCCAAGTACCGAGGAGTCGCAAGGTAACCAAACCGTCTTCGTATTTTCGTACCGCCAGTCAGTGAGGAAGTCAGTGAGTCAGTGGCAGGGGGAAGATTGCGAGGGAGGCAGTTCGACATGGACATGAAATTCGGTGCTACGTCATAGCAAGCGAGCACCGACGTTCCTGACTAACATTCGAGCCTGCTGTGACCGCAGACACCATCACAATGGTCGCTGGGAGGCCCGTATCGGTCGAGTTTTCGGCAACAAGTATCTCTACTTGGGCACTTACAGTAAGCATCTCGCCTCCTGATAGGACCCACACGCACCTGCTTCTTCTGCTCTCTGGGCCGACTGCAGGCAGGCAGGTAGGCAGGCGTCATGGTGGTGCTGCTGCTGCAGAGTCGAGGAATCTGAGAGATGTGTGGGGGCTGTGTGCAGGTACCCAGGAGGAAGCAGCAGCAGCATACGACATGGCAGCGATCGAGTACCGAGGGCTGAACGCGGTGACCAACTTCGATCTGAGCAGGTACATTCGCTGGCTGCGACCAGGGCAGGGGAACTCGGCGCTGCAGGAGCCGGAGTCGAATTTGAGCCCCGTGCCGGGGGACGAGTCGCAGCTGCTGGTGGACGAGCAATGTCAAGCGGCTGCGGCCGCCGCCGCTGCGGCTGCGGCCGCAGCCGGGGTGGGCGAAGAGCCTCACCCGCCGGTGTGGCCGGCGCAATCCACCGAGCCTTACCAGCTGCCGGCGCTGGGGCTGGCCAGCAATGGCTCGCAGCAGCAACAGCAGCAGCAGCGATCGTCATCCTCGCCCACAGCCCTCAGCCTGCTGCTGCAGTCGTCCATGTTCAAGCAGATGCTCGAGCGAGCCTCGTCCGCCTCGGGCCCGACCGACTGTGACTCCACCACCCCGTCGTCCGACCTGGGCATGGACCCTTCGGGCGCTCCTCAGCAGCTGCAGCAGCAGCATCCGAGCAGTCACTTCTTCTCCACTCACCAAGCCCCTCCTCTGGTGGAGGACGACAGCTCCGAGCACCAGGATGTGTCGTCCTACCTCTTCTCGAACCCCACCTCGTCGTCGAATCACCACCACCACCACCACCATCTGAGCATGTATGGAGACCACCTCACGCCGCAAGATCACCTGTCGCCTTATTCCTCATTTCCTCCCGGGGTCTCCTCGTCGCTGCCGACTGATTCCGAAGGCGTGGCCGCATCTCTCGACGATGGATCAGCGTACTGGAGTTTCGGTGGTGCCCTGCCTCTGAACCCGATCACCAGCTGCTAGTTCGCTAGTCGGTCGGTCGGTCGGTCGGTTGGGGCGGTCTGACAACCCCCCAGCTCGGATTGAGCTCATCGTCAGTGTTCTGGTTCGAAGCGAACAGCGAGGGGGCAGAGCCATCGACAGTGCGAGAAAGCGCGAGCAGCAGCAGAGAGAAGTATGTAACATGAAGCCATACCTTACGCACTCTTAAACTTTCTCTGGCTGCTTCAGCTGCTGCTGCACAGAACACTCATGGACGCATGGATGCATGGATGGGATCGAAGAGGACGACGAGTTCACTCAGGTGAATCTGTCGAACATTCCCAGGAGCCTGAAACCTCTCTGTTTCTAGCTGCACTAATGACTCCATTGGACCACTCTTCTGGAAGAATAAGAAGGTCGGAAGCAGCCTATGTACTAGGAAAACAAACATTTCATAAGAGTGGGGACGGGGAAAGGAGGGGAATCCGAAGGACTGTGCAGGTTTGATTGATTGCAGATGTTGTTCCCGCCCACACAATCATAGAAAAAAACACTGATTCTTAGAGGGGTCGATAAAAGGGTCGAAAAGCCGGGTCGGATGCCCTTGTACCAGTATAAACGTCACCCATCCCTCATTTCATATTCAACATAAGATAAAACAACTTCACACACACACACAAACACACACCTGACAGCTTCAATGTGTACCTCGGTACAGTTGTCTACAGATGTCATTTCAAACGAGCACTTTCAGCTCGATTCTGCATATAATACAAGCAACGATTTCCTA

mRNA

>Mapoly0009s0013.1
GTCGTGCCTTTGCCTTGTGCTTGTGTTTGTGCTTGTGCTTCCGACATGAACCGATGCGGCTGGCGTCCTCTCCCCTCCATCGACCGGTCCGACCAGTTTATCTCGGGGCTTACGACGAAGAGGAGGCGGCAGCTCGCGCTTATGATCTCGCTGCTCTCAAGTATTGGGGCCCCGGCACGCTCATCAATTTTCCCGTGAGCACATTCGAGACCGAAGCCATTAGAACGTCGTTTGTAATCTGCCTCGTGCGGTGTGGCAAGCTGGTGAGCGATTATGCGCGGGACATCGAAGAGATGCAAAATGTCACGCGGGAGGAATACCTCGCGTCGTTGAGGAGGAAGAGCAGCGGATTCTCCAGAGGCGTATCCAAGTACCGAGGAGTCGCAAGACACCATCACAATGGTCGCTGGGAGGCCCGTATCGGTCGAGTTTTCGGCAACAAGTATCTCTACTTGGGCACTTACAGTACCCAGGAGGAAGCAGCAGCAGCATACGACATGGCAGCGATCGAGTACCGAGGGCTGAACGCGGTGACCAACTTCGATCTGAGCAGGTACATTCGCTGGCTGCGACCAGGGCAGGGGAACTCGGCGCTGCAGGAGCCGGAGTCGAATTTGAGCCCCGTGCCGGGGGACGAGTCGCAGCTGCTGGTGGACGAGCAATGTCAAGCGGCTGCGGCCGCCGCCGCTGCGGCTGCGGCCGCAGCCGGGGTGGGCGAAGAGCCTCACCCGCCGGTGTGGCCGGCGCAATCCACCGAGCCTTACCAGCTGCCGGCGCTGGGGCTGGCCAGCAATGGCTCGCAGCAGCAACAGCAGCAGCAGCGATCGTCATCCTCGCCCACAGCCCTCAGCCTGCTGCTGCAGTCGTCCATGTTCAAGCAGATGCTCGAGCGAGCCTCGTCCGCCTCGGGCCCGACCGACTGTGACTCCACCACCCCGTCGTCCGACCTGGGCATGGACCCTTCGGGCGCTCCTCAGCAGCTGCAGCAGCAGCATCCGAGCAGTCACTTCTTCTCCACTCACCAAGCCCCTCCTCTGGTGGAGGACGACAGCTCCGAGCACCAGGATGTGTCGTCCTACCTCTTCTCGAACCCCACCTCGTCGTCGAATCACCACCACCACCACCACCATCTGAGCATGTATGGAGACCACCTCACGCCGCAAGATCACCTGTCGCCTTATTCCTCATTTCCTCCCGGGGTCTCCTCGTCGCTGCCGACTGATTCCGAAGGCGTGGCCGCATCTCTCGACGATGGATCAGCGTACTGGAGTTTCGGTGGTGCCCTGCCTCTGAACCCGATCACCAGCTGCTAGTTCGCTAGTCGGTCGGTCGGTCGGTCGGTTGGGGCGGTCTGACAACCCCCCAGCTCGGATTGAGCTCATCGTCAGTGTTCTGGTTCGAAGCGAACAGCGAGGGGGCAGAGCCATCGACAGTGCGAGAAAGCGCGAGCAGCAGCAGAGAGAAGTATGTAACATGAAGCCATACCTTACGCACTCTTAAACTTTCTCTGGCTGCTTCAGCTGCTGCTGCACAGAACACTCATGGACGCATGGATGCATGGATGGGATCGAAGAGGACGACGAGTTCACTCAGGTGAATCTGTCGAACATTCCCAGGAGCCTGAAACCTCTCTGTTTCTAGCTGCACTAATGACTCCATTGGACCACTCTTCTGGAAGAATAAGAAGGTCGGAAGCAGCCTATGTACTAGGAAAACAAACATTTCATAAGAGTGGGGACGGGGAAAGGAGGGGAATCCGAAGGACTGTGCAGGTTTGATTGATTGCAGATGTTGTTCCCGCCCACACAATCATAGAAAAAAACACTGATTCTTAGAGGGGTCGATAAAAGGGTCGAAAAGCCGGGTCGGATGCCCTTGTACCAGTATAAACGTCACCCATCCCTCATTTCATATTCAACATAAGATAAAACAACTTCACACACACACACAAACACACACCTGACAGCTTCAATGTGTACCTCGGTACAGTTGTCTACAGATGTCATTTCAAACGAGCACTTTCAGCTCGATTCTGCATATAATACAAGCAACGATTTCCTA

CDS

>Mapoly0009s0013.1
ATGCGGCTGGCGTCCTCTCCCCTCCATCGACCGGTCCGACCAGTTTATCTCGGGGCTTACGACGAAGAGGAGGCGGCAGCTCGCGCTTATGATCTCGCTGCTCTCAAGTATTGGGGCCCCGGCACGCTCATCAATTTTCCCGTGAGCACATTCGAGACCGAAGCCATTAGAACGTCGTTTGTAATCTGCCTCGTGCGGTGTGGCAAGCTGGTGAGCGATTATGCGCGGGACATCGAAGAGATGCAAAATGTCACGCGGGAGGAATACCTCGCGTCGTTGAGGAGGAAGAGCAGCGGATTCTCCAGAGGCGTATCCAAGTACCGAGGAGTCGCAAGACACCATCACAATGGTCGCTGGGAGGCCCGTATCGGTCGAGTTTTCGGCAACAAGTATCTCTACTTGGGCACTTACAGTACCCAGGAGGAAGCAGCAGCAGCATACGACATGGCAGCGATCGAGTACCGAGGGCTGAACGCGGTGACCAACTTCGATCTGAGCAGGTACATTCGCTGGCTGCGACCAGGGCAGGGGAACTCGGCGCTGCAGGAGCCGGAGTCGAATTTGAGCCCCGTGCCGGGGGACGAGTCGCAGCTGCTGGTGGACGAGCAATGTCAAGCGGCTGCGGCCGCCGCCGCTGCGGCTGCGGCCGCAGCCGGGGTGGGCGAAGAGCCTCACCCGCCGGTGTGGCCGGCGCAATCCACCGAGCCTTACCAGCTGCCGGCGCTGGGGCTGGCCAGCAATGGCTCGCAGCAGCAACAGCAGCAGCAGCGATCGTCATCCTCGCCCACAGCCCTCAGCCTGCTGCTGCAGTCGTCCATGTTCAAGCAGATGCTCGAGCGAGCCTCGTCCGCCTCGGGCCCGACCGACTGTGACTCCACCACCCCGTCGTCCGACCTGGGCATGGACCCTTCGGGCGCTCCTCAGCAGCTGCAGCAGCAGCATCCGAGCAGTCACTTCTTCTCCACTCACCAAGCCCCTCCTCTGGTGGAGGACGACAGCTCCGAGCACCAGGATGTGTCGTCCTACCTCTTCTCGAACCCCACCTCGTCGTCGAATCACCACCACCACCACCACCATCTGAGCATGTATGGAGACCACCTCACGCCGCAAGATCACCTGTCGCCTTATTCCTCATTTCCTCCCGGGGTCTCCTCGTCGCTGCCGACTGATTCCGAAGGCGTGGCCGCATCTCTCGACGATGGATCAGCGTACTGGAGTTTCGGTGGTGCCCTGCCTCTGAACCCGATCACCAGCTGCTAG

Protein

>Mapoly0009s0013.1
MRLASSPLHRPVRPVYLGAYDEEEAAARAYDLAALKYWGPGTLINFPVSTFETEAIRTSFVICLVRCGKLVSDYARDIEEMQNVTREEYLASLRRKSSGFSRGVSKYRGVARHHHNGRWEARIGRVFGNKYLYLGTYSTQEEAAAAYDMAAIEYRGLNAVTNFDLSRYIRWLRPGQGNSALQEPESNLSPVPGDESQLLVDEQCQAAAAAAAAAAAAAGVGEEPHPPVWPAQSTEPYQLPALGLASNGSQQQQQQQRSSSSPTALSLLLQSSMFKQMLERASSASGPTDCDSTTPSSDLGMDPSGAPQQLQQQHPSSHFFSTHQAPPLVEDDSSEHQDVSSYLFSNPTSSSNHHHHHHHLSMYGDHLTPQDHLSPYSSFPPGVSSSLPTDSEGVAASLDDGSAYWSFGGALPLNPITSC

Mapoly0009s0013.2  

Gene structure:

mRNA scaffold_9:181261..184601  ( + strand )
five_prime_UTR scaffold_9:181261..181313  ( + strand )
CDS scaffold_9:181314..181365  ( + strand )
CDS scaffold_9:181554..181642  ( + strand )
CDS scaffold_9:181825..181898  ( + strand )
CDS scaffold_9:182555..182605  ( + strand )
CDS scaffold_9:182781..182857  ( + strand )
CDS scaffold_9:183006..183853  ( + strand )
three_prime_UTR scaffold_9:183854..184601  ( + strand )

Sequences:

Gene

>Mapoly0009s0013.2
GTCGTGCCTTTGCCTTGTGCTTGTGTTTGTGCTTGTGCTTCCGACATGAACCGATGCGGCTGGCGTCCTCTCCCCTCCATCGACCGGTCCGACCAGTTTATCTCGGTAAGTGCTCGCTCCTCTCGCTACCTCTGGCCGTCAGTCTGTCGAGGGGCTAGGAAGGGGGCTTGTCGTTGACGATCCGCGCTTAGCGAGCTGCAAGTGGCAAATTGGAACTGAAACGTGTCAGTTTGATTGATGATCACGTGGCTGACCAATTGGGGCGTATGTGCTTGGGCTTGTGCTTGTCTCAGGGGCTTACGACGAAGAGGAGGCGGCAGCTCGCGCTTATGATCTCGCTGCTCTCAAGTATTGGGGCCCCGGCACGCTCATCAATTTTCCCGTGAGCACATTCGAGACCGAAGCCATTAGAACGTCGTTTGTAATCTGCCTCGTGCGGTGTGGCAAGCTGGTGCCGTCAATCTCTGTCGTCAGTTCATTGCTGCGCTCGAATGTGCTGGAGTCCGTGGTCTTTTCTGCTCTCTTGTATGTCAATCGGCTGACGGAGCTGTCTGTCGATTGCAGGTGAGCGATTATGCGCGGGACATCGAAGAGATGCAAAATGTCACGCGGGAGGAATACCTCGCGTCGTTGAGGAGGTAATTATAGCTTCGATGATCGACGATCAGTCTCAAGGATGTAGGTCTCGGTCGAATGCCTGTGAAGGTTCTGTTCTGTGTCCATGTGCCCGGTCGCTGCTCGGATGCATGACCAGCAAGGCTAGTCTTGAAGTCTCGCGGTCTGCCGACCATGTCTCATGTCTCGATCGACCGTGCCCTGTCGAGACTGATTTTGCCCAGCGTTTGTCATTCTATTGATCCCTTAGCTCGAGCTAGCGAGCCGTGTTGACTTCATTCTATTCAGTCAGCCTGTAGATGCTGCTGATCGCCGCCTTCTCTCTGCTGCTCATCATGAGCTGAAACTCATCCAGTTGGCTAATGGATTAGACTTTTAGAGTTGCTAAACTAAACTTGCCGTTAATGCTGAGTTCACTAGATTGGGGTTCGCGTGTTCGTGATGTTTGCTGCCAGCAAATTTTTTTTTCTGACTGTGAATCGAAATATACCCCGCAATGCTTGCCCTGAATGTGATGTGGTCCTGAAGGTATGGAGATGGTCGCTCGGTTGTCAGAGGTCGGCTAACACGAGTCAGAACATTAGACGAGCATAAAATCGAATTGCTCACCGACGCAGATACTCAAGCGTCGTCGAGCAACTTGAAATTGATCTCTTGTTCGTCCATCTTCTTCTCGCAGGAAGAGCAGCGGATTCTCCAGAGGCGTATCCAAGTACCGAGGAGTCGCAAGGTAACCAAACCGTCTTCGTATTTTCGTACCGCCAGTCAGTGAGGAAGTCAGTGAGTCAGTGGCAGGGGGAAGATTGCGAGGGAGGCAGTTCGACATGGACATGAAATTCGGTGCTACGTCATAGCAAGCGAGCACCGACGTTCCTGACTAACATTCGAGCCTGCTGTGACCGCAGACACCATCACAATGGTCGCTGGGAGGCCCGTATCGGTCGAGTTTTCGGCAACAAGTATCTCTACTTGGGCACTTACAGTAAGCATCTCGCCTCCTGATAGGACCCACACGCACCTGCTTCTTCTGCTCTCTGGGCCGACTGCAGGCAGGCAGGTAGGCAGGCGTCATGGTGGTGCTGCTGCTGCAGAGTCGAGGAATCTGAGAGATGTGTGGGGGCTGTGTGCAGGTACCCAGGAGGAAGCAGCAGCAGCATACGACATGGCAGCGATCGAGTACCGAGGGCTGAACGCGGTGACCAACTTCGATCTGAGCAGGTACATTCGCTGGCTGCGACCAGGGCAGGGGAACTCGGCGCTGCAGGAGCCGGAGTCGAATTTGAGCCCCGTGCCGGGGGACGAGTCGCAGCTGCTGGTGGACGAGCAATGTCAAGCGGCTGCGGCCGCCGCCGCTGCGGCTGCGGCCGCAGCCGGGGTGGGCGAAGAGCCTCACCCGCCGGTGTGGCCGGCGCAATCCACCGAGCCTTACCAGCTGCCGGCGCTGGGGCTGGCCAGCAATGGCTCGCAGCAGCAACAGCAGCAGCAGCGATCGTCATCCTCGCCCACAGCCCTCAGCCTGCTGCTGCAGTCGTCCATGTTCAAGCAGATGCTCGAGCGAGCCTCGTCCGCCTCGGGCCCGACCGACTGTGACTCCACCACCCCGTCGTCCGACCTGGGCATGGACCCTTCGGGCGCTCCTCAGCAGCTGCAGCAGCAGCATCCGAGCAGTCACTTCTTCTCCACTCACCAAGCCCCTCCTCTGGTGGAGGACGACAGCTCCGAGCACCAGGATGTGTCGTCCTACCTCTTCTCGAACCCCACCTCGTCGTCGAATCACCACCACCACCACCACCATCTGAGCATGTATGGAGACCACCTCACGCCGCAAGATCACCTGTCGCCTTATTCCTCATTTCCTCCCGGGGTCTCCTCGTCGCTGCCGACTGATTCCGAAGGCGTGGCCGCATCTCTCGACGATGGATCAGCGTACTGGAGTTTCGGTGGTGCCCTGCCTCTGAACCCGATCACCAGCTGCTAGTTCGCTAGTCGGTCGGTCGGTCGGTCGGTTGGGGCGGTCTGACAACCCCCCAGCTCGGATTGAGCTCATCGTCAGTGTTCTGGTTCGAAGCGAACAGCGAGGGGGCAGAGCCATCGACAGTGCGAGAAAGCGCGAGCAGCAGCAGAGAGAAGTATGTAACATGAAGCCATACCTTACGCACTCTTAAACTTTCTCTGGCTGCTTCAGCTGCTGCTGCACAGAACACTCATGGACGCATGGATGCATGGATGGGATCGAAGAGGACGACGAGTTCACTCAGGTGAATCTGTCGAACATTCCCAGGAGCCTGAAACCTCTCTGTTTCTAGCTGCACTAATGACTCCATTGGACCACTCTTCTGGAAGAATAAGAAGGTCGGAAGCAGCCTATGTACTAGGAAAACAAACATTTCATAAGAGTGGGGACGGGGAAAGGAGGGGAATCCGAAGGACTGTGCAGGTTTGATTGATTGCAGATGTTGTTCCCGCCCACACAATCATAGAAAAAAACACTGATTCTTAGAGGGGTCGATAAAAGGGTCGAAAAGCCGGGTCGGATGCCCTTGTACCAGTATAAACGTCACCCATCCCTCATTTCATATTCAACATAAGATAAAACAACTTCACACACACACACAAACACACACCTGACAGCTTCAATGTGTACCTCGGTACAGTTGTCTACAGATGTCATTTCAAACGAGCACTTTCAGCTCGATTCTGCATATAATACAAGCAACGATTTCCTA

mRNA

>Mapoly0009s0013.2
GTCGTGCCTTTGCCTTGTGCTTGTGTTTGTGCTTGTGCTTCCGACATGAACCGATGCGGCTGGCGTCCTCTCCCCTCCATCGACCGGTCCGACCAGTTTATCTCGGGGCTTACGACGAAGAGGAGGCGGCAGCTCGCGCTTATGATCTCGCTGCTCTCAAGTATTGGGGCCCCGGCACGCTCATCAATTTTCCCGTGAGCGATTATGCGCGGGACATCGAAGAGATGCAAAATGTCACGCGGGAGGAATACCTCGCGTCGTTGAGGAGGAAGAGCAGCGGATTCTCCAGAGGCGTATCCAAGTACCGAGGAGTCGCAAGACACCATCACAATGGTCGCTGGGAGGCCCGTATCGGTCGAGTTTTCGGCAACAAGTATCTCTACTTGGGCACTTACAGTACCCAGGAGGAAGCAGCAGCAGCATACGACATGGCAGCGATCGAGTACCGAGGGCTGAACGCGGTGACCAACTTCGATCTGAGCAGGTACATTCGCTGGCTGCGACCAGGGCAGGGGAACTCGGCGCTGCAGGAGCCGGAGTCGAATTTGAGCCCCGTGCCGGGGGACGAGTCGCAGCTGCTGGTGGACGAGCAATGTCAAGCGGCTGCGGCCGCCGCCGCTGCGGCTGCGGCCGCAGCCGGGGTGGGCGAAGAGCCTCACCCGCCGGTGTGGCCGGCGCAATCCACCGAGCCTTACCAGCTGCCGGCGCTGGGGCTGGCCAGCAATGGCTCGCAGCAGCAACAGCAGCAGCAGCGATCGTCATCCTCGCCCACAGCCCTCAGCCTGCTGCTGCAGTCGTCCATGTTCAAGCAGATGCTCGAGCGAGCCTCGTCCGCCTCGGGCCCGACCGACTGTGACTCCACCACCCCGTCGTCCGACCTGGGCATGGACCCTTCGGGCGCTCCTCAGCAGCTGCAGCAGCAGCATCCGAGCAGTCACTTCTTCTCCACTCACCAAGCCCCTCCTCTGGTGGAGGACGACAGCTCCGAGCACCAGGATGTGTCGTCCTACCTCTTCTCGAACCCCACCTCGTCGTCGAATCACCACCACCACCACCACCATCTGAGCATGTATGGAGACCACCTCACGCCGCAAGATCACCTGTCGCCTTATTCCTCATTTCCTCCCGGGGTCTCCTCGTCGCTGCCGACTGATTCCGAAGGCGTGGCCGCATCTCTCGACGATGGATCAGCGTACTGGAGTTTCGGTGGTGCCCTGCCTCTGAACCCGATCACCAGCTGCTAGTTCGCTAGTCGGTCGGTCGGTCGGTCGGTTGGGGCGGTCTGACAACCCCCCAGCTCGGATTGAGCTCATCGTCAGTGTTCTGGTTCGAAGCGAACAGCGAGGGGGCAGAGCCATCGACAGTGCGAGAAAGCGCGAGCAGCAGCAGAGAGAAGTATGTAACATGAAGCCATACCTTACGCACTCTTAAACTTTCTCTGGCTGCTTCAGCTGCTGCTGCACAGAACACTCATGGACGCATGGATGCATGGATGGGATCGAAGAGGACGACGAGTTCACTCAGGTGAATCTGTCGAACATTCCCAGGAGCCTGAAACCTCTCTGTTTCTAGCTGCACTAATGACTCCATTGGACCACTCTTCTGGAAGAATAAGAAGGTCGGAAGCAGCCTATGTACTAGGAAAACAAACATTTCATAAGAGTGGGGACGGGGAAAGGAGGGGAATCCGAAGGACTGTGCAGGTTTGATTGATTGCAGATGTTGTTCCCGCCCACACAATCATAGAAAAAAACACTGATTCTTAGAGGGGTCGATAAAAGGGTCGAAAAGCCGGGTCGGATGCCCTTGTACCAGTATAAACGTCACCCATCCCTCATTTCATATTCAACATAAGATAAAACAACTTCACACACACACACAAACACACACCTGACAGCTTCAATGTGTACCTCGGTACAGTTGTCTACAGATGTCATTTCAAACGAGCACTTTCAGCTCGATTCTGCATATAATACAAGCAACGATTTCCTA

CDS

>Mapoly0009s0013.2
ATGCGGCTGGCGTCCTCTCCCCTCCATCGACCGGTCCGACCAGTTTATCTCGGGGCTTACGACGAAGAGGAGGCGGCAGCTCGCGCTTATGATCTCGCTGCTCTCAAGTATTGGGGCCCCGGCACGCTCATCAATTTTCCCGTGAGCGATTATGCGCGGGACATCGAAGAGATGCAAAATGTCACGCGGGAGGAATACCTCGCGTCGTTGAGGAGGAAGAGCAGCGGATTCTCCAGAGGCGTATCCAAGTACCGAGGAGTCGCAAGACACCATCACAATGGTCGCTGGGAGGCCCGTATCGGTCGAGTTTTCGGCAACAAGTATCTCTACTTGGGCACTTACAGTACCCAGGAGGAAGCAGCAGCAGCATACGACATGGCAGCGATCGAGTACCGAGGGCTGAACGCGGTGACCAACTTCGATCTGAGCAGGTACATTCGCTGGCTGCGACCAGGGCAGGGGAACTCGGCGCTGCAGGAGCCGGAGTCGAATTTGAGCCCCGTGCCGGGGGACGAGTCGCAGCTGCTGGTGGACGAGCAATGTCAAGCGGCTGCGGCCGCCGCCGCTGCGGCTGCGGCCGCAGCCGGGGTGGGCGAAGAGCCTCACCCGCCGGTGTGGCCGGCGCAATCCACCGAGCCTTACCAGCTGCCGGCGCTGGGGCTGGCCAGCAATGGCTCGCAGCAGCAACAGCAGCAGCAGCGATCGTCATCCTCGCCCACAGCCCTCAGCCTGCTGCTGCAGTCGTCCATGTTCAAGCAGATGCTCGAGCGAGCCTCGTCCGCCTCGGGCCCGACCGACTGTGACTCCACCACCCCGTCGTCCGACCTGGGCATGGACCCTTCGGGCGCTCCTCAGCAGCTGCAGCAGCAGCATCCGAGCAGTCACTTCTTCTCCACTCACCAAGCCCCTCCTCTGGTGGAGGACGACAGCTCCGAGCACCAGGATGTGTCGTCCTACCTCTTCTCGAACCCCACCTCGTCGTCGAATCACCACCACCACCACCACCATCTGAGCATGTATGGAGACCACCTCACGCCGCAAGATCACCTGTCGCCTTATTCCTCATTTCCTCCCGGGGTCTCCTCGTCGCTGCCGACTGATTCCGAAGGCGTGGCCGCATCTCTCGACGATGGATCAGCGTACTGGAGTTTCGGTGGTGCCCTGCCTCTGAACCCGATCACCAGCTGCTAG

Protein

>Mapoly0009s0013.2
MRLASSPLHRPVRPVYLGAYDEEEAAARAYDLAALKYWGPGTLINFPVSDYARDIEEMQNVTREEYLASLRRKSSGFSRGVSKYRGVARHHHNGRWEARIGRVFGNKYLYLGTYSTQEEAAAAYDMAAIEYRGLNAVTNFDLSRYIRWLRPGQGNSALQEPESNLSPVPGDESQLLVDEQCQAAAAAAAAAAAAAGVGEEPHPPVWPAQSTEPYQLPALGLASNGSQQQQQQQRSSSSPTALSLLLQSSMFKQMLERASSASGPTDCDSTTPSSDLGMDPSGAPQQLQQQHPSSHFFSTHQAPPLVEDDSSEHQDVSSYLFSNPTSSSNHHHHHHHLSMYGDHLTPQDHLSPYSSFPPGVSSSLPTDSEGVAASLDDGSAYWSFGGALPLNPITSC

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>