Mapoly0011s0122



Description

C2H2-type zinc finger

Reference DB

Database ID Description
OrthoMCL OG5_170424
PFAM PF13912 C2H2-type zinc finger

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-3 transcription factor, C2H2-ZnF Mapoly0011s0122.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0011s0122.1 scaffold_11:1344090..1348109  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0011s0122.1  

Gene structure:

mRNA scaffold_11:1344090..1348109  ( + strand )
five_prime_UTR scaffold_11:1344090..1344281  ( + strand )
CDS scaffold_11:1344282..1346514  ( + strand )
CDS scaffold_11:1346860..1347395  ( + strand )
three_prime_UTR scaffold_11:1347396..1348109  ( + strand )

Sequences:

Gene

>Mapoly0011s0122.1
GGCACTCACTAGCTTAGCTCAGGCGTATATTTGCGCTGTGCTCTACAGTTACGATCTGTCGCTCGCCCGCTGTGAGGCTCAGGTTTGCTTGTCGAGCCGCGCGGCGAGAATTGGCAAATTGAAGCTAGCGCGCGGGCCGCGAGCTGAAGTTGCAGACGCCGCCGGGGTGCTGGGTGCTGGTGGAATAAGGATATGGTGGGCTGCCACGAGCAGGAGGCTCCGAGCGAAACCACAGCGTCCTCGTCGTCGTTCGAGCGAGAGCTGGTGACGGGGTCTTCTTGTGTCATAGATGCGGATGCCAATTACTCAGAAATGGCAGTGAGTGATACTGCAGCAGGCTTAACCGCTCCCACGGCTCGGCAGCGTGTTAGTGACGAGGGCAAGAAGCCAGGGCCGTCGTCGCAGCACCGGCCATCTCCAGATCGTAACTACTCGCAAGCAGTCTCGGAGAATTTGCAAGCAGTTACCTCGAGTTCGAGTGAGCATCGTGGCATCAGCCGGATAGTTCAGCAGCAGCAGCCCGGGCAGCCATTCCATCGCCGCCATACAACTGGTGCCACTTCTCCAGCCATGGGTACTGCTGAGGCTGCTGCTGTTGCTGCTGCTGCTTCTTCTTCTTCAGCTGAAGAAGCAGCTTTGGACGTAGATTGTGTTGAAGGTCATGATGAAGGACTTCATTCCGGTAGAGAGATTCCAAGATGTGGGCTTGACAATCTTGATTCGAGTCCAGATTGTGGTCGTCACGACGCCTCCCAGGGAAATTCGCGCCACACTTGCAAAGTGTGCAAGCGCCCGTTCTCATCCGGGCGAGCTTTGGGAGGCCACATGCGTGCTCACGGCAACGGGGACCCCGGCACTTCATCGAACGCCGATAGGAAATCCGAGAAGCAGCTGATTTCCTCGTCCCCGCGCACCCAGCAGGCCTCGCTGCATGCGTGCAATGGTGTTGCTGAGAACGGCATCGAGCATCCAGGGGCGGACGGGGTCGCCAGGGCGCAGAGTTTGTCGCCCGAGTCCAGAGCTCGAGCCCGGACTCGCGAAATTCAAGTCCGCAGAGCTGTGGGAGCACGCAGGTCAAAGACCAATGGCAAGCGGCGGGGCAGCACCACGCCCAAGAGCTCGGTCGAGGATGCAGCTGCTCTGACCAAGCAGCAGCCGCACGACGAAGACGATAATGCGGCATCGCGCAGGCAGGCCGAACGCAGCAGCACCAGCTGCTCGGATAACAACTCCGATGGAGCTCACGATGATGGCGCGGCGACGGACGATGCTGCCGGGAACATTTGTGACGTATGCAGAGAGGAATTTGAGAATGAGAAGCAACTCAATACCCACAAGAAATCTCACAAGCCCGAGTACAACCTCCGGGAATGTCCGAGAAAAAGCCGGCGTTTCATAGATCAGGACTACACCGAGGTGGCTCCCCCCACCATTCCTACCAAGAAGCCCCCAGCTCCCCAAGAGAAACAGCAATCGGATTCCGGATGCCCTTATCCGGGTTGCACCAAAAAGTTCCACTCGTCCAAGGCCTTGTTCGGACACATGCGGTGCCACCCGGACCGCACCTGGCGAGGAATTCACCCTCCGGACGAGAATGGAGCTAGCACGAGCGCAGCGGGCGAGCGGCAGCACCGCCGGAAGAAGTCGCGCCCCAATTCGCACGTCCCTGCTCGGGTGGTGTCCGATTCAGAGTCGGAGCCAGAACAGAAACAGAGTGGCAAGTCGGCCTCCACTGAGCACGAGAGCGACACGGACAGCATCGAGGCCGCCTACATCCAGGGCCAGGAGGCGCACACGAATGGCGACCGCCAGCAATCTTCCACTCCCGGCTGGTGGGCGTCGGGTGTCACTGGCAAGCGATCCAAGCGCTCGCGCCAGACCGTGCGCTCTTTGCAGGCTGTGCATCATGGCGCCTCGACCAGCAGTGCTGCAGCTCCCGACAATGCCCTGGAGGAGCTGAACGAGACTGCCATGGTCATGATGATGTTGGCGTCCAATCCCAGCGGAGCGCCCAAACATGAAGACCCGGACGAGCATATGGAAGACCTGTTCCGTAATCCCAATTCCGCTGACGAATGCCCCAAGGACGAGCCCACGGAGGGCTGCTTAGAAGCAGCCCTCCGTGCCAAAGATGAAGAGGAGGACGAGGAGGACGAGGAGGAGGACAAAGAAGAGGAAGGAGAGGACGGAGATGAGAAACAGGGAGCAGCAGCAGCAACTGCCGCCGAGGTCGTCGAGGATTTGGAGCAGGGACCCGAGCTGGTTCCCAAGGATGAGTTCATGACAGCTGCTGCCGAGACAGCAGAGGTGCCCATGGAAGTGGATGAGGAGCCTGAGGCCAGCCTTTCGGAGGATGGTGTGCTGCAAGGGGAGGAGGCTGTTCAGCTGGAGGCTGGTCAGCAGGAAGCTAGCTCTTCCAAACATGGTAAGTATCAGTGTGCCACTTGTTTGCGGTTCTTCCGATCTCATCAAGCTCTGGGAGGCCACCGAGCCTCTCACAAGAAGGTCAAGGGGTGCTTCGCCCGCACGAATGTGGGCGATGGTCCCCAGCCGGAGTCCCTTGACGAGGAGCTGAGCGAGGATATGTTGAGGTCGGAAGAGCAGCTCCCGACTGAGCTGCAGGATCTCTCTCACAGTGAGGGAGATGATAAGGACCGCCAAATGACGTCCAATTCAAAGGACGAGAGTAGTACTGACGTAGTACCGCCGACTGGTAGCATCAAGAAAGGTGCTCATAAGTGCACTGAGTGTGGGCGCTGCTTTGATTCAGGCCAAGCCCTAGGGGGCCACAAGCGATGCCATTTCGACCCGACCAAGAAGGATGCTGAGAAGGAAGGTTCCAGCAGTAACAACGGGGGTAAGAATCCTAGATCGAGCAACCCTGCAGGCAGAGCGAGCTACTCGCAGAGCCGCGGGAGACACGAGTCATCCGACGCGCGCGGCCATTCTCCTCGTGCCAAGAGCGACCCCGGACTCCAACAGCAGCAGCAGCAACAAGCAGCAGCGCCTGCGGAGTCAAGGTCGACCGGTTTGTTGAGACCGATAGAAATCGATCTCAACAAACCCCCCACGGTGACATACGACGAGGAGATGGAGATGGCGCCAAGCCCTGCATCGGCTAAATTTTCTGTTGAGAATCATGAAGCCCAGGCGTCGGCTTCAGCGGAGGCGAGTAGCAGCCCCGACGACGGCGAGCCCATGCGAAATCAACCGAGGGATTATCAACTCATATTGCATTTGTCTCCGATTACATTGAATTTGGAGGACCAGCTGCATGCGTACTACAAGCGGGTGACCCCCGCCTAACCGCGCACACGCCTCCAGTCTCTCTCTGTGTGACGGCTCGTGGCCTGCTCGCCTACTGTCTACAGTCAGATACATTTGTCGCTCGCGTGGATGTTTTATCACCCGCCTAGCTTTTGTGATCTCTGTCACGGAACCGAATCAACGCACATTCTGAGGTTCGTGAGAGGTTCCTTCAAATTTTAGATCGAGATTCTGTAATTATAGCTCCTCTCAGTCCAATGTTTTGTTCGCCTTGAACATACGGGAGATCTTCAGTGTAAATAGTCTGATTACCCCAAGATTGGGACCAATAACACATCAAATGCCGGGATCAAATGCATAGGAGGCTGCATTCAAGCCTATACGGGAGTTGCAACATACTCCATCGGATCACACTCAACTCCTGGTCATCAAACGAAGGCGATTTACGTTTGTGATCAGATATCTTTGTCACAGAGGAAGTCACTACTGTCTATACGTCAAGCACAGTCTGGGGTATGGAGCTACCGACAGTAGTCCAGCTCAGCTCAGATTAGTTCGAATCGAGTCAGGTCGAGTCCATTCAGCTCAGTCCAGTTCGGAGATTAGAAAATTAGTCAGCATAGGTAAACAAAATGCAGTGATCTTCTAGCTGATTTAGAAGCACTATTTTGGTACAAGCAATGTGATACCTCACTTGCAGTGCTTCTCATGTACAGGTTCTTTGTCAAAGTAGCAATAAAATCGTTTGTTTTG

mRNA

>Mapoly0011s0122.1
GGCACTCACTAGCTTAGCTCAGGCGTATATTTGCGCTGTGCTCTACAGTTACGATCTGTCGCTCGCCCGCTGTGAGGCTCAGGTTTGCTTGTCGAGCCGCGCGGCGAGAATTGGCAAATTGAAGCTAGCGCGCGGGCCGCGAGCTGAAGTTGCAGACGCCGCCGGGGTGCTGGGTGCTGGTGGAATAAGGATATGGTGGGCTGCCACGAGCAGGAGGCTCCGAGCGAAACCACAGCGTCCTCGTCGTCGTTCGAGCGAGAGCTGGTGACGGGGTCTTCTTGTGTCATAGATGCGGATGCCAATTACTCAGAAATGGCAGTGAGTGATACTGCAGCAGGCTTAACCGCTCCCACGGCTCGGCAGCGTGTTAGTGACGAGGGCAAGAAGCCAGGGCCGTCGTCGCAGCACCGGCCATCTCCAGATCGTAACTACTCGCAAGCAGTCTCGGAGAATTTGCAAGCAGTTACCTCGAGTTCGAGTGAGCATCGTGGCATCAGCCGGATAGTTCAGCAGCAGCAGCCCGGGCAGCCATTCCATCGCCGCCATACAACTGGTGCCACTTCTCCAGCCATGGGTACTGCTGAGGCTGCTGCTGTTGCTGCTGCTGCTTCTTCTTCTTCAGCTGAAGAAGCAGCTTTGGACGTAGATTGTGTTGAAGGTCATGATGAAGGACTTCATTCCGGTAGAGAGATTCCAAGATGTGGGCTTGACAATCTTGATTCGAGTCCAGATTGTGGTCGTCACGACGCCTCCCAGGGAAATTCGCGCCACACTTGCAAAGTGTGCAAGCGCCCGTTCTCATCCGGGCGAGCTTTGGGAGGCCACATGCGTGCTCACGGCAACGGGGACCCCGGCACTTCATCGAACGCCGATAGGAAATCCGAGAAGCAGCTGATTTCCTCGTCCCCGCGCACCCAGCAGGCCTCGCTGCATGCGTGCAATGGTGTTGCTGAGAACGGCATCGAGCATCCAGGGGCGGACGGGGTCGCCAGGGCGCAGAGTTTGTCGCCCGAGTCCAGAGCTCGAGCCCGGACTCGCGAAATTCAAGTCCGCAGAGCTGTGGGAGCACGCAGGTCAAAGACCAATGGCAAGCGGCGGGGCAGCACCACGCCCAAGAGCTCGGTCGAGGATGCAGCTGCTCTGACCAAGCAGCAGCCGCACGACGAAGACGATAATGCGGCATCGCGCAGGCAGGCCGAACGCAGCAGCACCAGCTGCTCGGATAACAACTCCGATGGAGCTCACGATGATGGCGCGGCGACGGACGATGCTGCCGGGAACATTTGTGACGTATGCAGAGAGGAATTTGAGAATGAGAAGCAACTCAATACCCACAAGAAATCTCACAAGCCCGAGTACAACCTCCGGGAATGTCCGAGAAAAAGCCGGCGTTTCATAGATCAGGACTACACCGAGGTGGCTCCCCCCACCATTCCTACCAAGAAGCCCCCAGCTCCCCAAGAGAAACAGCAATCGGATTCCGGATGCCCTTATCCGGGTTGCACCAAAAAGTTCCACTCGTCCAAGGCCTTGTTCGGACACATGCGGTGCCACCCGGACCGCACCTGGCGAGGAATTCACCCTCCGGACGAGAATGGAGCTAGCACGAGCGCAGCGGGCGAGCGGCAGCACCGCCGGAAGAAGTCGCGCCCCAATTCGCACGTCCCTGCTCGGGTGGTGTCCGATTCAGAGTCGGAGCCAGAACAGAAACAGAGTGGCAAGTCGGCCTCCACTGAGCACGAGAGCGACACGGACAGCATCGAGGCCGCCTACATCCAGGGCCAGGAGGCGCACACGAATGGCGACCGCCAGCAATCTTCCACTCCCGGCTGGTGGGCGTCGGGTGTCACTGGCAAGCGATCCAAGCGCTCGCGCCAGACCGTGCGCTCTTTGCAGGCTGTGCATCATGGCGCCTCGACCAGCAGTGCTGCAGCTCCCGACAATGCCCTGGAGGAGCTGAACGAGACTGCCATGGTCATGATGATGTTGGCGTCCAATCCCAGCGGAGCGCCCAAACATGAAGACCCGGACGAGCATATGGAAGACCTGTTCCGTAATCCCAATTCCGCTGACGAATGCCCCAAGGACGAGCCCACGGAGGGCTGCTTAGAAGCAGCCCTCCGTGCCAAAGATGAAGAGGAGGACGAGGAGGACGAGGAGGAGGACAAAGAAGAGGAAGGAGAGGACGGAGATGAGAAACAGGGAGCAGCAGCAGCAACTGCCGCCGAGGTCGTCGAGGATTTGGAGCAGGGACCCGAGCTGGTTCCCAAGGATGAGTTCATGACAGCTGCTGCCGAGACAGCAGAGGTGCCCATGGAAGTGGATGAGGAGCCTGAGGCCAGCCTTTCGGAGGATGGTGTGCTGCAAGGGGAGGAGGCTGTTCAGCTGGAGGCTGGTCAGCAGGAAGCTAGCTCTTCCAAACATGGCCAAGCCCTAGGGGGCCACAAGCGATGCCATTTCGACCCGACCAAGAAGGATGCTGAGAAGGAAGGTTCCAGCAGTAACAACGGGGGTAAGAATCCTAGATCGAGCAACCCTGCAGGCAGAGCGAGCTACTCGCAGAGCCGCGGGAGACACGAGTCATCCGACGCGCGCGGCCATTCTCCTCGTGCCAAGAGCGACCCCGGACTCCAACAGCAGCAGCAGCAACAAGCAGCAGCGCCTGCGGAGTCAAGGTCGACCGGTTTGTTGAGACCGATAGAAATCGATCTCAACAAACCCCCCACGGTGACATACGACGAGGAGATGGAGATGGCGCCAAGCCCTGCATCGGCTAAATTTTCTGTTGAGAATCATGAAGCCCAGGCGTCGGCTTCAGCGGAGGCGAGTAGCAGCCCCGACGACGGCGAGCCCATGCGAAATCAACCGAGGGATTATCAACTCATATTGCATTTGTCTCCGATTACATTGAATTTGGAGGACCAGCTGCATGCGTACTACAAGCGGGTGACCCCCGCCTAACCGCGCACACGCCTCCAGTCTCTCTCTGTGTGACGGCTCGTGGCCTGCTCGCCTACTGTCTACAGTCAGATACATTTGTCGCTCGCGTGGATGTTTTATCACCCGCCTAGCTTTTGTGATCTCTGTCACGGAACCGAATCAACGCACATTCTGAGGTTCGTGAGAGGTTCCTTCAAATTTTAGATCGAGATTCTGTAATTATAGCTCCTCTCAGTCCAATGTTTTGTTCGCCTTGAACATACGGGAGATCTTCAGTGTAAATAGTCTGATTACCCCAAGATTGGGACCAATAACACATCAAATGCCGGGATCAAATGCATAGGAGGCTGCATTCAAGCCTATACGGGAGTTGCAACATACTCCATCGGATCACACTCAACTCCTGGTCATCAAACGAAGGCGATTTACGTTTGTGATCAGATATCTTTGTCACAGAGGAAGTCACTACTGTCTATACGTCAAGCACAGTCTGGGGTATGGAGCTACCGACAGTAGTCCAGCTCAGCTCAGATTAGTTCGAATCGAGTCAGGTCGAGTCCATTCAGCTCAGTCCAGTTCGGAGATTAGAAAATTAGTCAGCATAGGTAAACAAAATGCAGTGATCTTCTAGCTGATTTAGAAGCACTATTTTGGTACAAGCAATGTGATACCTCACTTGCAGTGCTTCTCATGTACAGGTTCTTTGTCAAAGTAGCAATAAAATCGTTTGTTTTG

CDS

>Mapoly0011s0122.1
ATGGTGGGCTGCCACGAGCAGGAGGCTCCGAGCGAAACCACAGCGTCCTCGTCGTCGTTCGAGCGAGAGCTGGTGACGGGGTCTTCTTGTGTCATAGATGCGGATGCCAATTACTCAGAAATGGCAGTGAGTGATACTGCAGCAGGCTTAACCGCTCCCACGGCTCGGCAGCGTGTTAGTGACGAGGGCAAGAAGCCAGGGCCGTCGTCGCAGCACCGGCCATCTCCAGATCGTAACTACTCGCAAGCAGTCTCGGAGAATTTGCAAGCAGTTACCTCGAGTTCGAGTGAGCATCGTGGCATCAGCCGGATAGTTCAGCAGCAGCAGCCCGGGCAGCCATTCCATCGCCGCCATACAACTGGTGCCACTTCTCCAGCCATGGGTACTGCTGAGGCTGCTGCTGTTGCTGCTGCTGCTTCTTCTTCTTCAGCTGAAGAAGCAGCTTTGGACGTAGATTGTGTTGAAGGTCATGATGAAGGACTTCATTCCGGTAGAGAGATTCCAAGATGTGGGCTTGACAATCTTGATTCGAGTCCAGATTGTGGTCGTCACGACGCCTCCCAGGGAAATTCGCGCCACACTTGCAAAGTGTGCAAGCGCCCGTTCTCATCCGGGCGAGCTTTGGGAGGCCACATGCGTGCTCACGGCAACGGGGACCCCGGCACTTCATCGAACGCCGATAGGAAATCCGAGAAGCAGCTGATTTCCTCGTCCCCGCGCACCCAGCAGGCCTCGCTGCATGCGTGCAATGGTGTTGCTGAGAACGGCATCGAGCATCCAGGGGCGGACGGGGTCGCCAGGGCGCAGAGTTTGTCGCCCGAGTCCAGAGCTCGAGCCCGGACTCGCGAAATTCAAGTCCGCAGAGCTGTGGGAGCACGCAGGTCAAAGACCAATGGCAAGCGGCGGGGCAGCACCACGCCCAAGAGCTCGGTCGAGGATGCAGCTGCTCTGACCAAGCAGCAGCCGCACGACGAAGACGATAATGCGGCATCGCGCAGGCAGGCCGAACGCAGCAGCACCAGCTGCTCGGATAACAACTCCGATGGAGCTCACGATGATGGCGCGGCGACGGACGATGCTGCCGGGAACATTTGTGACGTATGCAGAGAGGAATTTGAGAATGAGAAGCAACTCAATACCCACAAGAAATCTCACAAGCCCGAGTACAACCTCCGGGAATGTCCGAGAAAAAGCCGGCGTTTCATAGATCAGGACTACACCGAGGTGGCTCCCCCCACCATTCCTACCAAGAAGCCCCCAGCTCCCCAAGAGAAACAGCAATCGGATTCCGGATGCCCTTATCCGGGTTGCACCAAAAAGTTCCACTCGTCCAAGGCCTTGTTCGGACACATGCGGTGCCACCCGGACCGCACCTGGCGAGGAATTCACCCTCCGGACGAGAATGGAGCTAGCACGAGCGCAGCGGGCGAGCGGCAGCACCGCCGGAAGAAGTCGCGCCCCAATTCGCACGTCCCTGCTCGGGTGGTGTCCGATTCAGAGTCGGAGCCAGAACAGAAACAGAGTGGCAAGTCGGCCTCCACTGAGCACGAGAGCGACACGGACAGCATCGAGGCCGCCTACATCCAGGGCCAGGAGGCGCACACGAATGGCGACCGCCAGCAATCTTCCACTCCCGGCTGGTGGGCGTCGGGTGTCACTGGCAAGCGATCCAAGCGCTCGCGCCAGACCGTGCGCTCTTTGCAGGCTGTGCATCATGGCGCCTCGACCAGCAGTGCTGCAGCTCCCGACAATGCCCTGGAGGAGCTGAACGAGACTGCCATGGTCATGATGATGTTGGCGTCCAATCCCAGCGGAGCGCCCAAACATGAAGACCCGGACGAGCATATGGAAGACCTGTTCCGTAATCCCAATTCCGCTGACGAATGCCCCAAGGACGAGCCCACGGAGGGCTGCTTAGAAGCAGCCCTCCGTGCCAAAGATGAAGAGGAGGACGAGGAGGACGAGGAGGAGGACAAAGAAGAGGAAGGAGAGGACGGAGATGAGAAACAGGGAGCAGCAGCAGCAACTGCCGCCGAGGTCGTCGAGGATTTGGAGCAGGGACCCGAGCTGGTTCCCAAGGATGAGTTCATGACAGCTGCTGCCGAGACAGCAGAGGTGCCCATGGAAGTGGATGAGGAGCCTGAGGCCAGCCTTTCGGAGGATGGTGTGCTGCAAGGGGAGGAGGCTGTTCAGCTGGAGGCTGGTCAGCAGGAAGCTAGCTCTTCCAAACATGGCCAAGCCCTAGGGGGCCACAAGCGATGCCATTTCGACCCGACCAAGAAGGATGCTGAGAAGGAAGGTTCCAGCAGTAACAACGGGGGTAAGAATCCTAGATCGAGCAACCCTGCAGGCAGAGCGAGCTACTCGCAGAGCCGCGGGAGACACGAGTCATCCGACGCGCGCGGCCATTCTCCTCGTGCCAAGAGCGACCCCGGACTCCAACAGCAGCAGCAGCAACAAGCAGCAGCGCCTGCGGAGTCAAGGTCGACCGGTTTGTTGAGACCGATAGAAATCGATCTCAACAAACCCCCCACGGTGACATACGACGAGGAGATGGAGATGGCGCCAAGCCCTGCATCGGCTAAATTTTCTGTTGAGAATCATGAAGCCCAGGCGTCGGCTTCAGCGGAGGCGAGTAGCAGCCCCGACGACGGCGAGCCCATGCGAAATCAACCGAGGGATTATCAACTCATATTGCATTTGTCTCCGATTACATTGAATTTGGAGGACCAGCTGCATGCGTACTACAAGCGGGTGACCCCCGCCTAA

Protein

>Mapoly0011s0122.1
MVGCHEQEAPSETTASSSSFERELVTGSSCVIDADANYSEMAVSDTAAGLTAPTARQRVSDEGKKPGPSSQHRPSPDRNYSQAVSENLQAVTSSSSEHRGISRIVQQQQPGQPFHRRHTTGATSPAMGTAEAAAVAAAASSSSAEEAALDVDCVEGHDEGLHSGREIPRCGLDNLDSSPDCGRHDASQGNSRHTCKVCKRPFSSGRALGGHMRAHGNGDPGTSSNADRKSEKQLISSSPRTQQASLHACNGVAENGIEHPGADGVARAQSLSPESRARARTREIQVRRAVGARRSKTNGKRRGSTTPKSSVEDAAALTKQQPHDEDDNAASRRQAERSSTSCSDNNSDGAHDDGAATDDAAGNICDVCREEFENEKQLNTHKKSHKPEYNLRECPRKSRRFIDQDYTEVAPPTIPTKKPPAPQEKQQSDSGCPYPGCTKKFHSSKALFGHMRCHPDRTWRGIHPPDENGASTSAAGERQHRRKKSRPNSHVPARVVSDSESEPEQKQSGKSASTEHESDTDSIEAAYIQGQEAHTNGDRQQSSTPGWWASGVTGKRSKRSRQTVRSLQAVHHGASTSSAAAPDNALEELNETAMVMMMLASNPSGAPKHEDPDEHMEDLFRNPNSADECPKDEPTEGCLEAALRAKDEEEDEEDEEEDKEEEGEDGDEKQGAAAATAAEVVEDLEQGPELVPKDEFMTAAAETAEVPMEVDEEPEASLSEDGVLQGEEAVQLEAGQQEASSSKHGQALGGHKRCHFDPTKKDAEKEGSSSNNGGKNPRSSNPAGRASYSQSRGRHESSDARGHSPRAKSDPGLQQQQQQQAAAPAESRSTGLLRPIEIDLNKPPTVTYDEEMEMAPSPASAKFSVENHEAQASASAEASSSPDDGEPMRNQPRDYQLILHLSPITLNLEDQLHAYYKRVTPA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>