Mapoly0011s0167



Description

AUX/IAA family // B3 DNA binding domain // Auxin response factor

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0005634 Nucleus
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0009725 Response to hormone stimulus
OrthoMCL OG5_134025
PFAM PF02309 AUX/IAA family
PFAM PF02362 B3 DNA binding domain
PFAM PF06507 Auxin response factor
PANTHER PTHR31384 FAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpB3-1 transcription factor, B3 Mapoly0011s0167.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0011s0167.1 scaffold_11:1859127..1866228  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0011s0167.1  

Gene structure:

mRNA scaffold_11:1859127..1866228  ( - strand )
three_prime_UTR scaffold_11:1859127..1860343  ( - strand )
CDS scaffold_11:1860344..1860512  ( - strand )
CDS scaffold_11:1860732..1860919  ( - strand )
CDS scaffold_11:1861137..1862149  ( - strand )
CDS scaffold_11:1862251..1862398  ( - strand )
CDS scaffold_11:1862514..1862589  ( - strand )
CDS scaffold_11:1862693..1862812  ( - strand )
CDS scaffold_11:1863064..1863225  ( - strand )
CDS scaffold_11:1863336..1863426  ( - strand )
CDS scaffold_11:1863560..1863644  ( - strand )
CDS scaffold_11:1863768..1863977  ( - strand )
CDS scaffold_11:1864125..1864220  ( - strand )
CDS scaffold_11:1864386..1864495  ( - strand )
CDS scaffold_11:1864605..1864773  ( - strand )
five_prime_UTR scaffold_11:1864774..1865195  ( - strand )
five_prime_UTR scaffold_11:1865417..1866228  ( - strand )

Sequences:

Gene

>Mapoly0011s0167.1
GCTCGCCTCTCGGCCCCCGCGCGTTGGTTGCATGTTTGCAGGGCCTGCTGTATTTCATCATCGTCATTTGCTCCCATACCGTCGCAATGACCCGCCGAGAGCCCCAGCCCCTTTTCCCCGACCTTCCTTCCGGGCCTGCGCCGGGGCTCCGGTCCGGTTCCTCTTCTGTCGCGTGCCTGCTTTGCCTTTCTCCTGCCCCTGGCTGGGGCTTGCCTCCCGAGTCCCGTCCCCTTCCCGTCTTCCGGCCCCCGCCCCGCGCAGCTCTCTTGCCGCCGCTCGCCTCGCAAGGTAACTTACCCCGCCCCGCCTCGCTCTCCCCCTTCCTCGCCACCCTAGCTTCCGACAACTCTCTGATGTTGTGAAGGACGGACTTCCCAATTTCTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTACCTCTCCCCCAGCCCCAGCCCCACCCCCCTCCCCACATCCCACTCCCCCTCGGTCCCCGCCTGCCTGTCCCTGCCCCCTCTTCTTCTGCCGCTGGCTTCTGTTCTGTTCTGTTGTTCTGTTGCGCGAATACTAGACGCGCTCCACTTCTTCTTCTGCTGGCTCGCTCTGACCCTTTTTCTTCTTCCTCCTCACCTCCTCCTGCACCTTCTCCTCCCTCCCCTCCTCCCCTCCCCGCTCCATCCTTCGCAAGCGAGAGAGCCGAGACTGCACCGCGTCTCCTCCTCCTCACCCCGCTCCTCGTCGCTGCGATTTCTCGGGTGCTCGGGCTCGGGCCTGTGCTCCCCTTCTGCTGCTGCTGCTGCTGCTGTTGGCACCCACCGCACCTGCGAGTGTGGAGGTAATCTCACCCCTCCCCGACGCGCCCTCAAACCTGTCTGTCTGCCCGACTGCCGAGCCCTCGTACGCCCGTCGAGCGATGCGTTACTGCTCTCCTCGTTCTGCGCTGCAATTGGTGCTCGCCTTGTGCGCGTCTGCGCGTGCCGTTGTTTCTTGAGAGCAAGAGGGCCCCGTCCGCCTGCAGTCTTTCCAACCCGCTCGTCTGTCGTTGCTTTCTTGCAGGACACCGCTTCGCGCATCGTCCGCCCGGAGGCCGTTCGCTCGCCTCCTCGCCTGCCTCGACCTCGACAGCGACCGGCTCTCGTGGAGCGCTGGAGTGTGCAGGTCGTAGTTGTGATTGGGAACAGGTTGGAAATACAGAGCTCGCACGGGGAAGTAGTTTACTCGTGCGCCAGGGGGGACAGGAAGTTCAAAGGACAGGCTCGGGAGCAAAAGCCTCGACCAGGACTCGGATTTAGGTGATTCTTGGAATTCGCTGCGGCCGGAGGACTAGTGGCGCAGTAGACCTCTCCCGGAAGGCACCCCAGGCAGGCAGCCTCGGGCGGAAATCTGCGGAACTGAGGTTCCGAGAGGGCATGGGGAAAGGAGCTCCAAGATGTGGTAATCAGCTGCGTAGTCTAGCATTTTAGACAGAAGTTCCGACCATGTCAGAAGCATCTTCCATCACTCGTCACCCCTACAAGGCAAACACCGGGCCCCTGCTGAAGTTCCAGCAATCGTCGGATGCTTCATCCTTGCCGCCAATGGCACGTCCCATGGCGAGCAGACAGCTTGCTACATCTCACACCGCTGCCTCCAACGTCTCCGTAGCAGGTGCGTCGTCCTGAACGCCCGCCCTCTTGATAACCCCGAGCGCCTGTCGCGTGCCTCGCGTTTCCTCGTTCTCAAACTTCTCGTTCGTTCGTGATGCTTTCGTTGGCAGGCGATGATGGCATCGATGCCGAGCTGTGGTACGCCTGTGCTGGTCCTCAGAAGGCATTACCACCCGTAGGCAGCGTCGTGGCCTACTTGCCTCAAGGTCACATAGAGCAGGTAATCACAGCTGACCTCCCCTTCCCTTCCCTTCCCCTCCTCTCCCCTCGCAACATCGGTTCTGTGTCTGCTGATTCTCAGGCTGGTCTCCTAAATGGAGCACATCGTGCGAGGAAGTCTTGGCAAGTGACGGTTCCCGAGGCCTGACGCTTCTCTGCCTTGCAGGTCGCGTCTTTCAATAATCAAGAACTCGACGCCCAAATTCCTCGGTATAATCTGCCCGCAGTGATACCATGTATGCTCAACGACATACAACTCAGCGTGAGTGTTTCCTTGTCTGTCGAAGCTGCCCCCTTCTTCGCTTCCTTCCGCTGAAATGCCAATCCGTCGGTCTGTCGGTCGGTCGGTCAGCTCCTCGGTCGGGCCGTCTTGACGCCAACTCACGTGAGCTAAGTTTATGCCTCGCAGGCGGATCCTGATTCCGACGAGGTCTATGCGACTCTCACCCTGTGTCCCATGAGCGAGCAACACGAAGACTCGTCCGACTGCGCCGAGCCCCCGCCACCTCCCAAGAGGAAGTCCCGCAGTTTTACCAAAACCCTCACTGTCTCTGATACCAGCACGCATGGAGGCTTCTCGGTGCCCCGACGCGCTGCCGATGACTGCTTGCCGAAATTGGTATGCGCATGTGGAAAATGTCTGGATTGTGGAAGCTAAAGTGTTTCGCTATCCAGCGTACGGGCTTCCGTACCCGGAGCACTGTCGATGTTTGACTGACACTCAGCTCGTCGTCCATCACAGGATATGAGTCTCAACCCTCCAAATCAGGAATTAGTGGCCAAGGATCTTCATGGCAACGAATGGCGATTTCGTCACATATTTCGAGGTAAGCAAGTATCCCCTACACGTTCTGGCAAAGGGCATGGAGTCGCGTCGTTCGACGATCTGCATTACAATCCTATCGTGCCTGCGGTTCCCACACTGCTGTCTAATCGACCTTCATGTTTCTCGTCGCGCAGGTCAACCTAAACGCCACCTTCTCACTACGGGATGGAGCGTATTTGTGAGCCAAAAGAGGCTCGTCGCCGGAGACGCGGTGCTGTTTCTCAGGTGGCTATTGTGTCTTTTAACAACATACTGCTTTCTGTTCCCTCTGTACGGTTCACTGGGAGCTCGTGAGGCCCAACGCACTGCGACTGACCGATGTGACTTGTCTTCAGGGGTGAGAATGGCCAGCTCAGAGTAGGAGTCCGGCGTGCTCCTCGCCAGCAACAACTGCAACCCAAAGTGTTGACGTCTCCAACGATGCACATCGGGGTTCTCGCGGCCGCTGCCCATGCGGCAACGGAGAAATCTCGATTCTCTCTAATTTACAACCCTCGGTATGCGTCTCACCACGAGGGAAGAGAGCTGTCGTTGAAACCTCGGCGTTTTGAGAAGTTCTTTTCTTCGCACAGTGGCAGATGTTCGAGATTAGTGATCTCTGGGTCCATCGAGTCGTGAACTACGGGCAGTCACCCTGTCTTTCCTGTCTGTACATGCAATTTCTCTTGCCACGTTATGGACGTCGGCGAGAATTTGTAGCACCAGGCCTTAATCCGTCTGAGTTTCTGGATCCTTCTCGTGTGCTCAGATCTTGCCCTTCGGAGTTCGTTATTCCGTACTCTAAGTACCTCAAGGCTGTGAAAAGCAACTTCAACGTTGGCCAGCGTTTTAAAATGAAGTTCGAATCGGAGGACCCTTCAGATAGGAGGTTGGTTTTCTAACGTGAGAGTTTCGTAAGTTCTTTCGTTAATTTGGGTTCTCAGTCTTCCGTAGTACGTAGTTTCAAAGTCTGATACTTCCTTCACATACAGGCATACGGGAACTATCACCGGAATTTGTGATTTCGACCCTGCCAGGTGGCCTGGCTCAGAGTGGAGATCCCTCCAGGTCGGTAATCGACTCCCCACAGCTGTTCATTCTCACATAGCAATTATCTCGCCGATTTTCTTTGAGCGGATGAGCGGGTCGTGTGGTCTTCTTACTTCCATATTCTCACGTGCAGGTTAATTGGGACGAATCGTCCTCGAGCGAGAGACAGGAGAGGGTCTCACCATGGGAAGTGGAGCCCTTCTCTCCCTCCACGACCATCACTCCGTCGGTCAGTACTAGAAAGCGATTGAGGCCGGTCACCCAACCACATTCTGAGTCAGGTACAGTCCCAACTACTAATTCCAGATGCCACCGATGTAAAAGTTATTAGAGATGGTGATGAGTGTCTTATTCGACGGGCGTGGCTCTTTGTTCGCAGCAGTGAACAGGAATGCCGTCGAGACAAGTAAGGCGCAAACTCAAACGATGAGGCTAGCGAGAGCTTTCCACGGCGGTCATGAAATGCTGCCGTCATCAGCCGAGGAGGAGGATGCGGAATCTCTTTCTGCCAAAATGTCTTGGATTAAGAGAGAGGACAACTTCAAGAGCGAAGCGCAGAGCGTTGGCTCTAGACAGGGCCCGGATAGTTGGATGTCTATCAGGAGACCCGACCCAGTGCAGGTCCCTGACATGTTTAGAAATCTCCCGGCTTCGGGAGTGCCGGATCTTCGAGGTATGATTGGCATCGAGAGGCGCCAGCAGGAACACTTAAAGTTCTGCGTCAAGCAATATCGGGAAAACAAGGATGAAATCTCGGGAACTACTCTGCAGCTGTCAAGTCCCCGACCTCCGAACTTGCAGAATTACGTCAAGTCATCCACAGATCTGAATCTCTCCGTGTCCTCGCCTGCGTCGAGCAACAAGGGATCGAGCCTTCTTTGGTCCAATTCTCAGTCTGTAACGTTGCCATCGTATAATGGTCACGAGTCGACGAACGCATCCTCTTGGCTCTCGTTTAGACCGGGACAGAGCGATGTTGCCGCCTCTTCGCCTCACTGCACTACATTGTCAATGAGCAATCTGCCTCCAGCTGATTCTGAAACGTCAAGCCATCCTTCGACTCCGAAGAGTTATCTATGGGAGAAGAGGATAAGGATGGAGCCGGACACGAACCGAGCAGCTGCTCCCGTTCAGAGTGAGCAAAAATGTAAAATTTTCGGGGTGCCTCTCGACAAGCCAACTCCGATCGTGATTCCTTCTCAAGTGCCAGGATCTAAGGCAGTGAGGAGCACGGACGATGGATCAGGACCGAGCAGCAGTCGTGGGCTGGAGAAAGTCGTGTCTCCCAGTCCGACTTCTTCCGCAGTCGGAGGACAGGAGCAGGATAAGGGTCCCCAGAGATCCAATAAGACGTCGCAAAATTTCCAACAAGGTCCAGTTCGTAGCTACACGAAGGTAAGCCTCCTGTCACGCGATGACGATGCGTGAGTTTTGAAGCTTTCATGGGTGAACCTGGATTACACGTATCAGGGTCGGGAAGATCAGGCCTCGTCCGGGGGCTGACTTCTCGTCGTGGTCAGTCATCTGTTTAGTCAGTTTGTTCGTACGAGCCAGATGTTCGTTCTAGAGTGTGAAGACGGAAGCTGACAGAGCGGGCACCTATCACGTGCAGATTCACAAGCAGGGATCGTTCGGAAGATCGATCGACGTCCAAAGTTATGACGGCTACACCGACTTGTTAAGAAAGGTAGAAAACATGTTCGAGCTGAACGGAGAGCTGTTCGACAAGAAGTCCGGGTGGCAGCTCGTGTACACAGACCACGAAGACGACGTCCTCCTCGTGGGAGACGATCCCTGGATGTAAGTCGCCCCTAGTACATGGTTTCTTGTGCATGCGAGTCCACGAAGGGGGGTTGCAAGTGCACGTGGGGGTAGGGCAAGGGGGGTGGGGCGTTATGGAAGGGGAGGGGAGGAGGAGACTCGTACCACGGGGAGGAATGGGAAGGGGCTGGGATGGGCTTGGGCTTGGGGATGGGTGGATAGCAATTCTGACGAGGTCGAACGTTGACGCGTGCGCAGGGAGTTTGTGAGTTGCGTGAGGACGCTGAGACTGCTGAGCCCGGGCGAGGCGTCGTCGTCGGGCAAGAGCGGGCAGTCGCACGACGAGGACGCGGGCGCGGGCAAGGACGGGGCCAAGCGGTGCGACTCGTCCTCGCCGTCGGCGGGGGCGCGCGGCGACGACATGTAGGAGGCGCGAGCGCGCCGGGGGGCGAGAGCGCGGATGGCTGGCCGCTGGCCGCGGCCGCACACGCGCCTGTGCACGGGGCCTGCGGCCGGGGGCCGGGGGCCGGCGCTAGGAAGTGATTTTTTTGGCGAGCAGTTGCGGATATATGATGATGATCTTTTTTTCTTTCTTTAATTGTAAAGGGGGTTTTTGGGTTTCAGCATTGGTGTACATGGATAGAAGGAAGACTCGCTCGCTGGGGCTGCCCCCGCGCGGACTCGGGCCGTCGCGAGAGCCTGCCAGCGTTAGATAATGTGCCGGATGTCTTGGCGTTCTATTCCCCGCGGTCCTCGTGGCAGGGATTTTGGATGGAACCATCGGCTGGTAACAGTACTTTATAAGGGGAAATTTTTTGGTCGCTCTTGTGTTGTGGTTAGAAAGGGGAGTCGTCGTCGTCCTCGTCCACGTCGTCGTCCTCGTCGTCGTCGTCGATGAGCTGCTGTGAAAATGTTTCATTTGGTGTCCGCATACCTTGGCAGGACCCGCCCGAACGCACCGTCGCTGGCCCCTTGCGAAAGAGTCTGCCGCTGCCCTTTTCTGCGGGGTTGGTTACCTCCGGCTCAACAAACAGCCTTATGTATTTTTAGATGTGTCATCCCTTGTTTTGAAGTGGTGTTGATGGGTTCGTTCCTGATCCATGCGTTGGCACTCAGGCAGGATGTCGCATCCAGTTTTGTAGAACGCTTTGTAGGAAGGATGGAGGAGGGGAGGGGAGGAGGAGGGACGGGAGGATGGATGGAAGGGAGGAAGGGAGGAAGCAAGTTCTCGGGGGAATCGAGAAGTCGGTGGGAAAGGGGAGAGGGATGAATAACGTGACTGGGCTCCTGTGTGACTCGAGAAGTGCTCGCTCACTTCGTGTACAAGTTAGCCTTGGCGTGTTTGTGGCCACGAATCCGCTGGGGATAGAGACCAATGTTTCTGGGGGGCACCCATTTCTGGGTGTATAGAAGGAGTTGATGATTTTAGTCAGTCATGTGCGTTCAGTTCAGTTTATGGTCGGTGATGGAGCATTTAGTTGGTCTCATCCGTCTCCTCTTTCTGAGGACGAGGCTGCTGAACTAAACTGCCGCCTTATATCATTCATGTAAAAAGAGATTTGTGCAATTGAGGAGAAAAAAATTGGCGCAATAGAGTTTGTAGAGCCAAGCTACCATGTCTTGTGCCTGGCCTGCCTTTCATCG

mRNA

>Mapoly0011s0167.1
GCTCGCCTCTCGGCCCCCGCGCGTTGGTTGCATGTTTGCAGGGCCTGCTGTATTTCATCATCGTCATTTGCTCCCATACCGTCGCAATGACCCGCCGAGAGCCCCAGCCCCTTTTCCCCGACCTTCCTTCCGGGCCTGCGCCGGGGCTCCGGTCCGGTTCCTCTTCTGTCGCGTGCCTGCTTTGCCTTTCTCCTGCCCCTGGCTGGGGCTTGCCTCCCGAGTCCCGTCCCCTTCCCGTCTTCCGGCCCCCGCCCCGCGCAGCTCTCTTGCCGCCGCTCGCCTCGCAAGGTAACTTACCCCGCCCCGCCTCGCTCTCCCCCTTCCTCGCCACCCTAGCTTCCGACAACTCTCTGATGTTGTGAAGGACGGACTTCCCAATTTCTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTACCTCTCCCCCAGCCCCAGCCCCACCCCCCTCCCCACATCCCACTCCCCCTCGGTCCCCGCCTGCCTGTCCCTGCCCCCTCTTCTTCTGCCGCTGGCTTCTGTTCTGTTCTGTTGTTCTGTTGCGCGAATACTAGACGCGCTCCACTTCTTCTTCTGCTGGCTCGCTCTGACCCTTTTTCTTCTTCCTCCTCACCTCCTCCTGCACCTTCTCCTCCCTCCCCTCCTCCCCTCCCCGCTCCATCCTTCGCAAGCGAGAGAGCCGAGACTGCACCGCGTCTCCTCCTCCTCACCCCGCTCCTCGTCGCTGCGATTTCTCGGGTGCTCGGGCTCGGGCCTGTGCTCCCCTTCTGCTGCTGCTGCTGCTGCTGTTGGCACCCACCGCACCTGCGAGTGTGGAGGACACCGCTTCGCGCATCGTCCGCCCGGAGGCCGTTCGCTCGCCTCCTCGCCTGCCTCGACCTCGACAGCGACCGGCTCTCGTGGAGCGCTGGAGTGTGCAGGTCGTAGTTGTGATTGGGAACAGGTTGGAAATACAGAGCTCGCACGGGGAAGTAGTTTACTCGTGCGCCAGGGGGGACAGGAAGTTCAAAGGACAGGCTCGGGAGCAAAAGCCTCGACCAGGACTCGGATTTAGGTGATTCTTGGAATTCGCTGCGGCCGGAGGACTAGTGGCGCAGTAGACCTCTCCCGGAAGGCACCCCAGGCAGGCAGCCTCGGGCGGAAATCTGCGGAACTGAGGTTCCGAGAGGGCATGGGGAAAGGAGCTCCAAGATGTGGTAATCAGCTGCGTAGTCTAGCATTTTAGACAGAAGTTCCGACCATGTCAGAAGCATCTTCCATCACTCGTCACCCCTACAAGGCAAACACCGGGCCCCTGCTGAAGTTCCAGCAATCGTCGGATGCTTCATCCTTGCCGCCAATGGCACGTCCCATGGCGAGCAGACAGCTTGCTACATCTCACACCGCTGCCTCCAACGTCTCCGTAGCAGGCGATGATGGCATCGATGCCGAGCTGTGGTACGCCTGTGCTGGTCCTCAGAAGGCATTACCACCCGTAGGCAGCGTCGTGGCCTACTTGCCTCAAGGTCACATAGAGCAGGTCGCGTCTTTCAATAATCAAGAACTCGACGCCCAAATTCCTCGGTATAATCTGCCCGCAGTGATACCATGTATGCTCAACGACATACAACTCAGCGCGGATCCTGATTCCGACGAGGTCTATGCGACTCTCACCCTGTGTCCCATGAGCGAGCAACACGAAGACTCGTCCGACTGCGCCGAGCCCCCGCCACCTCCCAAGAGGAAGTCCCGCAGTTTTACCAAAACCCTCACTGTCTCTGATACCAGCACGCATGGAGGCTTCTCGGTGCCCCGACGCGCTGCCGATGACTGCTTGCCGAAATTGGATATGAGTCTCAACCCTCCAAATCAGGAATTAGTGGCCAAGGATCTTCATGGCAACGAATGGCGATTTCGTCACATATTTCGAGGTCAACCTAAACGCCACCTTCTCACTACGGGATGGAGCGTATTTGTGAGCCAAAAGAGGCTCGTCGCCGGAGACGCGGTGCTGTTTCTCAGGGGTGAGAATGGCCAGCTCAGAGTAGGAGTCCGGCGTGCTCCTCGCCAGCAACAACTGCAACCCAAAGTGTTGACGTCTCCAACGATGCACATCGGGGTTCTCGCGGCCGCTGCCCATGCGGCAACGGAGAAATCTCGATTCTCTCTAATTTACAACCCTCGATCTTGCCCTTCGGAGTTCGTTATTCCGTACTCTAAGTACCTCAAGGCTGTGAAAAGCAACTTCAACGTTGGCCAGCGTTTTAAAATGAAGTTCGAATCGGAGGACCCTTCAGATAGGAGGCATACGGGAACTATCACCGGAATTTGTGATTTCGACCCTGCCAGGTGGCCTGGCTCAGAGTGGAGATCCCTCCAGGTTAATTGGGACGAATCGTCCTCGAGCGAGAGACAGGAGAGGGTCTCACCATGGGAAGTGGAGCCCTTCTCTCCCTCCACGACCATCACTCCGTCGGTCAGTACTAGAAAGCGATTGAGGCCGGTCACCCAACCACATTCTGAGTCAGTGAACAGGAATGCCGTCGAGACAAGTAAGGCGCAAACTCAAACGATGAGGCTAGCGAGAGCTTTCCACGGCGGTCATGAAATGCTGCCGTCATCAGCCGAGGAGGAGGATGCGGAATCTCTTTCTGCCAAAATGTCTTGGATTAAGAGAGAGGACAACTTCAAGAGCGAAGCGCAGAGCGTTGGCTCTAGACAGGGCCCGGATAGTTGGATGTCTATCAGGAGACCCGACCCAGTGCAGGTCCCTGACATGTTTAGAAATCTCCCGGCTTCGGGAGTGCCGGATCTTCGAGGTATGATTGGCATCGAGAGGCGCCAGCAGGAACACTTAAAGTTCTGCGTCAAGCAATATCGGGAAAACAAGGATGAAATCTCGGGAACTACTCTGCAGCTGTCAAGTCCCCGACCTCCGAACTTGCAGAATTACGTCAAGTCATCCACAGATCTGAATCTCTCCGTGTCCTCGCCTGCGTCGAGCAACAAGGGATCGAGCCTTCTTTGGTCCAATTCTCAGTCTGTAACGTTGCCATCGTATAATGGTCACGAGTCGACGAACGCATCCTCTTGGCTCTCGTTTAGACCGGGACAGAGCGATGTTGCCGCCTCTTCGCCTCACTGCACTACATTGTCAATGAGCAATCTGCCTCCAGCTGATTCTGAAACGTCAAGCCATCCTTCGACTCCGAAGAGTTATCTATGGGAGAAGAGGATAAGGATGGAGCCGGACACGAACCGAGCAGCTGCTCCCGTTCAGAGTGAGCAAAAATGTAAAATTTTCGGGGTGCCTCTCGACAAGCCAACTCCGATCGTGATTCCTTCTCAAGTGCCAGGATCTAAGGCAGTGAGGAGCACGGACGATGGATCAGGACCGAGCAGCAGTCGTGGGCTGGAGAAAGTCGTGTCTCCCAGTCCGACTTCTTCCGCAGTCGGAGGACAGGAGCAGGATAAGGGTCCCCAGAGATCCAATAAGACGTCGCAAAATTTCCAACAAGGTCCAGTTCGTAGCTACACGAAGATTCACAAGCAGGGATCGTTCGGAAGATCGATCGACGTCCAAAGTTATGACGGCTACACCGACTTGTTAAGAAAGGTAGAAAACATGTTCGAGCTGAACGGAGAGCTGTTCGACAAGAAGTCCGGGTGGCAGCTCGTGTACACAGACCACGAAGACGACGTCCTCCTCGTGGGAGACGATCCCTGGATGGAGTTTGTGAGTTGCGTGAGGACGCTGAGACTGCTGAGCCCGGGCGAGGCGTCGTCGTCGGGCAAGAGCGGGCAGTCGCACGACGAGGACGCGGGCGCGGGCAAGGACGGGGCCAAGCGGTGCGACTCGTCCTCGCCGTCGGCGGGGGCGCGCGGCGACGACATGTAGGAGGCGCGAGCGCGCCGGGGGGCGAGAGCGCGGATGGCTGGCCGCTGGCCGCGGCCGCACACGCGCCTGTGCACGGGGCCTGCGGCCGGGGGCCGGGGGCCGGCGCTAGGAAGTGATTTTTTTGGCGAGCAGTTGCGGATATATGATGATGATCTTTTTTTCTTTCTTTAATTGTAAAGGGGGTTTTTGGGTTTCAGCATTGGTGTACATGGATAGAAGGAAGACTCGCTCGCTGGGGCTGCCCCCGCGCGGACTCGGGCCGTCGCGAGAGCCTGCCAGCGTTAGATAATGTGCCGGATGTCTTGGCGTTCTATTCCCCGCGGTCCTCGTGGCAGGGATTTTGGATGGAACCATCGGCTGGTAACAGTACTTTATAAGGGGAAATTTTTTGGTCGCTCTTGTGTTGTGGTTAGAAAGGGGAGTCGTCGTCGTCCTCGTCCACGTCGTCGTCCTCGTCGTCGTCGTCGATGAGCTGCTGTGAAAATGTTTCATTTGGTGTCCGCATACCTTGGCAGGACCCGCCCGAACGCACCGTCGCTGGCCCCTTGCGAAAGAGTCTGCCGCTGCCCTTTTCTGCGGGGTTGGTTACCTCCGGCTCAACAAACAGCCTTATGTATTTTTAGATGTGTCATCCCTTGTTTTGAAGTGGTGTTGATGGGTTCGTTCCTGATCCATGCGTTGGCACTCAGGCAGGATGTCGCATCCAGTTTTGTAGAACGCTTTGTAGGAAGGATGGAGGAGGGGAGGGGAGGAGGAGGGACGGGAGGATGGATGGAAGGGAGGAAGGGAGGAAGCAAGTTCTCGGGGGAATCGAGAAGTCGGTGGGAAAGGGGAGAGGGATGAATAACGTGACTGGGCTCCTGTGTGACTCGAGAAGTGCTCGCTCACTTCGTGTACAAGTTAGCCTTGGCGTGTTTGTGGCCACGAATCCGCTGGGGATAGAGACCAATGTTTCTGGGGGGCACCCATTTCTGGGTGTATAGAAGGAGTTGATGATTTTAGTCAGTCATGTGCGTTCAGTTCAGTTTATGGTCGGTGATGGAGCATTTAGTTGGTCTCATCCGTCTCCTCTTTCTGAGGACGAGGCTGCTGAACTAAACTGCCGCCTTATATCATTCATGTAAAAAGAGATTTGTGCAATTGAGGAGAAAAAAATTGGCGCAATAGAGTTTGTAGAGCCAAGCTACCATGTCTTGTGCCTGGCCTGCCTTTCATCG

CDS

>Mapoly0011s0167.1
ATGTCAGAAGCATCTTCCATCACTCGTCACCCCTACAAGGCAAACACCGGGCCCCTGCTGAAGTTCCAGCAATCGTCGGATGCTTCATCCTTGCCGCCAATGGCACGTCCCATGGCGAGCAGACAGCTTGCTACATCTCACACCGCTGCCTCCAACGTCTCCGTAGCAGGCGATGATGGCATCGATGCCGAGCTGTGGTACGCCTGTGCTGGTCCTCAGAAGGCATTACCACCCGTAGGCAGCGTCGTGGCCTACTTGCCTCAAGGTCACATAGAGCAGGTCGCGTCTTTCAATAATCAAGAACTCGACGCCCAAATTCCTCGGTATAATCTGCCCGCAGTGATACCATGTATGCTCAACGACATACAACTCAGCGCGGATCCTGATTCCGACGAGGTCTATGCGACTCTCACCCTGTGTCCCATGAGCGAGCAACACGAAGACTCGTCCGACTGCGCCGAGCCCCCGCCACCTCCCAAGAGGAAGTCCCGCAGTTTTACCAAAACCCTCACTGTCTCTGATACCAGCACGCATGGAGGCTTCTCGGTGCCCCGACGCGCTGCCGATGACTGCTTGCCGAAATTGGATATGAGTCTCAACCCTCCAAATCAGGAATTAGTGGCCAAGGATCTTCATGGCAACGAATGGCGATTTCGTCACATATTTCGAGGTCAACCTAAACGCCACCTTCTCACTACGGGATGGAGCGTATTTGTGAGCCAAAAGAGGCTCGTCGCCGGAGACGCGGTGCTGTTTCTCAGGGGTGAGAATGGCCAGCTCAGAGTAGGAGTCCGGCGTGCTCCTCGCCAGCAACAACTGCAACCCAAAGTGTTGACGTCTCCAACGATGCACATCGGGGTTCTCGCGGCCGCTGCCCATGCGGCAACGGAGAAATCTCGATTCTCTCTAATTTACAACCCTCGATCTTGCCCTTCGGAGTTCGTTATTCCGTACTCTAAGTACCTCAAGGCTGTGAAAAGCAACTTCAACGTTGGCCAGCGTTTTAAAATGAAGTTCGAATCGGAGGACCCTTCAGATAGGAGGCATACGGGAACTATCACCGGAATTTGTGATTTCGACCCTGCCAGGTGGCCTGGCTCAGAGTGGAGATCCCTCCAGGTTAATTGGGACGAATCGTCCTCGAGCGAGAGACAGGAGAGGGTCTCACCATGGGAAGTGGAGCCCTTCTCTCCCTCCACGACCATCACTCCGTCGGTCAGTACTAGAAAGCGATTGAGGCCGGTCACCCAACCACATTCTGAGTCAGTGAACAGGAATGCCGTCGAGACAAGTAAGGCGCAAACTCAAACGATGAGGCTAGCGAGAGCTTTCCACGGCGGTCATGAAATGCTGCCGTCATCAGCCGAGGAGGAGGATGCGGAATCTCTTTCTGCCAAAATGTCTTGGATTAAGAGAGAGGACAACTTCAAGAGCGAAGCGCAGAGCGTTGGCTCTAGACAGGGCCCGGATAGTTGGATGTCTATCAGGAGACCCGACCCAGTGCAGGTCCCTGACATGTTTAGAAATCTCCCGGCTTCGGGAGTGCCGGATCTTCGAGGTATGATTGGCATCGAGAGGCGCCAGCAGGAACACTTAAAGTTCTGCGTCAAGCAATATCGGGAAAACAAGGATGAAATCTCGGGAACTACTCTGCAGCTGTCAAGTCCCCGACCTCCGAACTTGCAGAATTACGTCAAGTCATCCACAGATCTGAATCTCTCCGTGTCCTCGCCTGCGTCGAGCAACAAGGGATCGAGCCTTCTTTGGTCCAATTCTCAGTCTGTAACGTTGCCATCGTATAATGGTCACGAGTCGACGAACGCATCCTCTTGGCTCTCGTTTAGACCGGGACAGAGCGATGTTGCCGCCTCTTCGCCTCACTGCACTACATTGTCAATGAGCAATCTGCCTCCAGCTGATTCTGAAACGTCAAGCCATCCTTCGACTCCGAAGAGTTATCTATGGGAGAAGAGGATAAGGATGGAGCCGGACACGAACCGAGCAGCTGCTCCCGTTCAGAGTGAGCAAAAATGTAAAATTTTCGGGGTGCCTCTCGACAAGCCAACTCCGATCGTGATTCCTTCTCAAGTGCCAGGATCTAAGGCAGTGAGGAGCACGGACGATGGATCAGGACCGAGCAGCAGTCGTGGGCTGGAGAAAGTCGTGTCTCCCAGTCCGACTTCTTCCGCAGTCGGAGGACAGGAGCAGGATAAGGGTCCCCAGAGATCCAATAAGACGTCGCAAAATTTCCAACAAGGTCCAGTTCGTAGCTACACGAAGATTCACAAGCAGGGATCGTTCGGAAGATCGATCGACGTCCAAAGTTATGACGGCTACACCGACTTGTTAAGAAAGGTAGAAAACATGTTCGAGCTGAACGGAGAGCTGTTCGACAAGAAGTCCGGGTGGCAGCTCGTGTACACAGACCACGAAGACGACGTCCTCCTCGTGGGAGACGATCCCTGGATGGAGTTTGTGAGTTGCGTGAGGACGCTGAGACTGCTGAGCCCGGGCGAGGCGTCGTCGTCGGGCAAGAGCGGGCAGTCGCACGACGAGGACGCGGGCGCGGGCAAGGACGGGGCCAAGCGGTGCGACTCGTCCTCGCCGTCGGCGGGGGCGCGCGGCGACGACATGTAG

Protein

>Mapoly0011s0167.1
MSEASSITRHPYKANTGPLLKFQQSSDASSLPPMARPMASRQLATSHTAASNVSVAGDDGIDAELWYACAGPQKALPPVGSVVAYLPQGHIEQVASFNNQELDAQIPRYNLPAVIPCMLNDIQLSADPDSDEVYATLTLCPMSEQHEDSSDCAEPPPPPKRKSRSFTKTLTVSDTSTHGGFSVPRRAADDCLPKLDMSLNPPNQELVAKDLHGNEWRFRHIFRGQPKRHLLTTGWSVFVSQKRLVAGDAVLFLRGENGQLRVGVRRAPRQQQLQPKVLTSPTMHIGVLAAAAHAATEKSRFSLIYNPRSCPSEFVIPYSKYLKAVKSNFNVGQRFKMKFESEDPSDRRHTGTITGICDFDPARWPGSEWRSLQVNWDESSSSERQERVSPWEVEPFSPSTTITPSVSTRKRLRPVTQPHSESVNRNAVETSKAQTQTMRLARAFHGGHEMLPSSAEEEDAESLSAKMSWIKREDNFKSEAQSVGSRQGPDSWMSIRRPDPVQVPDMFRNLPASGVPDLRGMIGIERRQQEHLKFCVKQYRENKDEISGTTLQLSSPRPPNLQNYVKSSTDLNLSVSSPASSNKGSSLLWSNSQSVTLPSYNGHESTNASSWLSFRPGQSDVAASSPHCTTLSMSNLPPADSETSSHPSTPKSYLWEKRIRMEPDTNRAAAPVQSEQKCKIFGVPLDKPTPIVIPSQVPGSKAVRSTDDGSGPSSSRGLEKVVSPSPTSSAVGGQEQDKGPQRSNKTSQNFQQGPVRSYTKIHKQGSFGRSIDVQSYDGYTDLLRKVENMFELNGELFDKKSGWQLVYTDHEDDVLLVGDDPWMEFVSCVRTLRLLSPGEASSSGKSGQSHDEDAGAGKDGAKRCDSSSPSAGARGDDM

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>