Mapoly0012s0026



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_150265
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR16223 FAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH25 transcription factor, bHLH Mapoly0012s0026.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0012s0026.1 scaffold_12:310139..311874  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0012s0026.1  

Gene structure:

mRNA scaffold_12:310139..311874  ( + strand )
five_prime_UTR scaffold_12:310139..310146  ( + strand )
CDS scaffold_12:310147..310524  ( + strand )
CDS scaffold_12:310975..311514  ( + strand )
three_prime_UTR scaffold_12:311515..311874  ( + strand )

Sequences:

Gene

>Mapoly0012s0026.1
GTCTACATATGCAGATCGAGCTTTCGACAACTCGAGTGCACATTTGCAGAGGGTCTGCAATTCTCCAAATCCATAAAATGGATGTCAACTCCTCTGTCTACAGATATGGAGTGTGCCCGTGGAGTCCGAGGAGTCATGATGGGGCCCAGGTTGAATGGAAGAGCACAGGGCAGGGTTCGCTGATTGAAAACCAGCTGATTTTAACGTGTACTGACTCTCCTTCTTCACTGCAGGCAGTTACGTCTCCATCTTTCAGACCATTTTTTTCCCCAGGTGGAGAGTACGTCCATCCACCACTTTCCATGGCCTCGCGACAAACGCTGATGGAAGTCCCTCAGAACGCGATCTCAGATCATATTGGGAACTCTTTTCTCTCGGCTCCTAAGGTATCAAACGACATCCTAAACTCCACGTTCTGAACATCGTAGATTCTTAATTTCGCTGCGAAGTCTATAAAGTCCTCATGCAACATTGAAGCTTCGGTCAGAAGGTCATCATTTTCTGGTACCAACATGTTCTTTCAGGTCGATGGTTCACCTTTTCCAGATCCCAAAATGAGTTGTCAATCAAGAGTTGGTCGACTTATGCTGCCAAGTCTGTAAGTCAGGACATTCCATTGATTTAGCTTGAACGAGTTGTGAGCCACTTCGAGTCTTCATTGTTCTCCGTTTATGGAAGCGTGCAGCCAATGGAACTTTCATTCTTCTCCGTCATCTGGGTTGCCAGATCCCCGAGTGGTACTAGCGAGGCAACCCACAGGTTCATAATCTAAGTATGAAAAATCCTCACCATGAGTCTGAAGTGGGCACTAAAGTGAATCGTGAATAAATGTGCAGGGCATTTTGGACATTTCTTCCACACAAACAGTGGGCAACACTTCCAAGGATAGCTTGACACTGGATGGGAGATGGACGAAGAGTTTGCAGATATCTCCAGACGTCAATTTCCACATCCCAATGGGCATACAGAAGGCTAAGGATACTCTATCTCGAAATGTTATCTCAGACTTATGCAGTGGGCCCACGAGTAACCAGGGAGCCGTCATCCATGCTCCCTCTAGCTACGAGATGGCTCTGAGCAATTACAGAAACCATTATGTCAACTGTCTTCCTGTCAATTGCATGAGAGCCAGACGAGGATGTGCAACGAACCCACGGAGTATAGCAGAGAGACTGAGGAGGATTCGCATCACTGAACGTCTGCGCAAACTTCAGGCTCTCCTGCCGCATCCTCGCTTGTCAACGCATAACAAAGATACAGCTTACATGTTGGACGAGATAATTGACTATATTGAATATCTTCAGCGTGAAGTAGAGATTCTGAAAGCAAGAAAGTGTTCTTGCGATGTTGAGGATACATTCGACGACTCTCAATAGGCAGCTAGCTGCCTGGAAGTTGTGTCTTTGATGGTGTGGTCGTTTGATCAGAACACCCGTGCACATTTAACTTGACGCATCCTTGGCATGTCGTTAATCACGAATATGGAGAGGTGCAAAGATTTGTCCACACTTTGCGATGAGATCGGTATTAAGCTCAAAACCTACGACTCTTTAAGATGAAACTCATGCAAGCGAGGCACTTTGTGTATGCTATGAATCATCTCTGGCTCCAAGATTTTTTAGCATAAATTGTTCTCAAACCTTGGATAAGCGATGGACGCAATAGAGGCCTATCGAGTGTGGGGATTAGAGAAGAGCAACTTCCTCATTTCGGAGTTGAATGCAAACAACCATTTA

mRNA

>Mapoly0012s0026.1
GTCTACATATGCAGATCGAGCTTTCGACAACTCGAGTGCACATTTGCAGAGGGTCTGCAATTCTCCAAATCCATAAAATGGATGTCAACTCCTCTGTCTACAGATATGGAGTGTGCCCGTGGAGTCCGAGGAGTCATGATGGGGCCCAGGTTGAATGGAAGAGCACAGGGCAGGGTTCGCTGATTGAAAACCAGCTGATTTTAACGTGTACTGACTCTCCTTCTTCACTGCAGGCAGTTACGTCTCCATCTTTCAGACCATTTTTTTCCCCAGGTGGAGAGTACGTCCATCCACCACTTTCCATGGCCTCGCGACAAACGCTGATGGAAGTCCCTCAGAACGCGATCTCAGATCATATTGGGAACTCTTTTCTCTCGGCTCCTAAGGGCATTTTGGACATTTCTTCCACACAAACAGTGGGCAACACTTCCAAGGATAGCTTGACACTGGATGGGAGATGGACGAAGAGTTTGCAGATATCTCCAGACGTCAATTTCCACATCCCAATGGGCATACAGAAGGCTAAGGATACTCTATCTCGAAATGTTATCTCAGACTTATGCAGTGGGCCCACGAGTAACCAGGGAGCCGTCATCCATGCTCCCTCTAGCTACGAGATGGCTCTGAGCAATTACAGAAACCATTATGTCAACTGTCTTCCTGTCAATTGCATGAGAGCCAGACGAGGATGTGCAACGAACCCACGGAGTATAGCAGAGAGACTGAGGAGGATTCGCATCACTGAACGTCTGCGCAAACTTCAGGCTCTCCTGCCGCATCCTCGCTTGTCAACGCATAACAAAGATACAGCTTACATGTTGGACGAGATAATTGACTATATTGAATATCTTCAGCGTGAAGTAGAGATTCTGAAAGCAAGAAAGTGTTCTTGCGATGTTGAGGATACATTCGACGACTCTCAATAGGCAGCTAGCTGCCTGGAAGTTGTGTCTTTGATGGTGTGGTCGTTTGATCAGAACACCCGTGCACATTTAACTTGACGCATCCTTGGCATGTCGTTAATCACGAATATGGAGAGGTGCAAAGATTTGTCCACACTTTGCGATGAGATCGGTATTAAGCTCAAAACCTACGACTCTTTAAGATGAAACTCATGCAAGCGAGGCACTTTGTGTATGCTATGAATCATCTCTGGCTCCAAGATTTTTTAGCATAAATTGTTCTCAAACCTTGGATAAGCGATGGACGCAATAGAGGCCTATCGAGTGTGGGGATTAGAGAAGAGCAACTTCCTCATTTCGGAGTTGAATGCAAACAACCATTTA

CDS

>Mapoly0012s0026.1
ATGCAGATCGAGCTTTCGACAACTCGAGTGCACATTTGCAGAGGGTCTGCAATTCTCCAAATCCATAAAATGGATGTCAACTCCTCTGTCTACAGATATGGAGTGTGCCCGTGGAGTCCGAGGAGTCATGATGGGGCCCAGGTTGAATGGAAGAGCACAGGGCAGGGTTCGCTGATTGAAAACCAGCTGATTTTAACGTGTACTGACTCTCCTTCTTCACTGCAGGCAGTTACGTCTCCATCTTTCAGACCATTTTTTTCCCCAGGTGGAGAGTACGTCCATCCACCACTTTCCATGGCCTCGCGACAAACGCTGATGGAAGTCCCTCAGAACGCGATCTCAGATCATATTGGGAACTCTTTTCTCTCGGCTCCTAAGGGCATTTTGGACATTTCTTCCACACAAACAGTGGGCAACACTTCCAAGGATAGCTTGACACTGGATGGGAGATGGACGAAGAGTTTGCAGATATCTCCAGACGTCAATTTCCACATCCCAATGGGCATACAGAAGGCTAAGGATACTCTATCTCGAAATGTTATCTCAGACTTATGCAGTGGGCCCACGAGTAACCAGGGAGCCGTCATCCATGCTCCCTCTAGCTACGAGATGGCTCTGAGCAATTACAGAAACCATTATGTCAACTGTCTTCCTGTCAATTGCATGAGAGCCAGACGAGGATGTGCAACGAACCCACGGAGTATAGCAGAGAGACTGAGGAGGATTCGCATCACTGAACGTCTGCGCAAACTTCAGGCTCTCCTGCCGCATCCTCGCTTGTCAACGCATAACAAAGATACAGCTTACATGTTGGACGAGATAATTGACTATATTGAATATCTTCAGCGTGAAGTAGAGATTCTGAAAGCAAGAAAGTGTTCTTGCGATGTTGAGGATACATTCGACGACTCTCAATAG

Protein

>Mapoly0012s0026.1
MQIELSTTRVHICRGSAILQIHKMDVNSSVYRYGVCPWSPRSHDGAQVEWKSTGQGSLIENQLILTCTDSPSSLQAVTSPSFRPFFSPGGEYVHPPLSMASRQTLMEVPQNAISDHIGNSFLSAPKGILDISSTQTVGNTSKDSLTLDGRWTKSLQISPDVNFHIPMGIQKAKDTLSRNVISDLCSGPTSNQGAVIHAPSSYEMALSNYRNHYVNCLPVNCMRARRGCATNPRSIAERLRRIRITERLRKLQALLPHPRLSTHNKDTAYMLDEIIDYIEYLQREVEILKARKCSCDVEDTFDDSQ

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>