Mapoly0012s0090



Description

PHD finger protein AF10

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0006355 Regulation of transcription, DNA-dependent
KOG KOG0956 PHD finger protein AF10
PFAM PF05920 Homeobox KN domain

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBELL3 Homeodomain protein Public
MpHD4 transcription factor, HD Mapoly0012s0090.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0012s0090.1 scaffold_12:1020340..1041944  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0012s0090.1  

Gene structure:

mRNA scaffold_12:1020340..1041944  ( + strand )
five_prime_UTR scaffold_12:1020340..1022150  ( + strand )
five_prime_UTR scaffold_12:1022564..1022784  ( + strand )
five_prime_UTR scaffold_12:1023025..1023209  ( + strand )
five_prime_UTR scaffold_12:1023473..1023756  ( + strand )
CDS scaffold_12:1023757..1025042  ( + strand )
CDS scaffold_12:1028244..1032225  ( + strand )
CDS scaffold_12:1032501..1032653  ( + strand )
CDS scaffold_12:1032883..1032968  ( + strand )
CDS scaffold_12:1033323..1033413  ( + strand )
CDS scaffold_12:1033697..1033848  ( + strand )
CDS scaffold_12:1034037..1034127  ( + strand )
CDS scaffold_12:1034273..1034355  ( + strand )
CDS scaffold_12:1034704..1034834  ( + strand )
CDS scaffold_12:1035386..1037208  ( + strand )
CDS scaffold_12:1037637..1037769  ( + strand )
CDS scaffold_12:1037907..1038208  ( + strand )
CDS scaffold_12:1038637..1038789  ( + strand )
CDS scaffold_12:1039164..1039264  ( + strand )
CDS scaffold_12:1039960..1040053  ( + strand )
CDS scaffold_12:1040461..1040564  ( + strand )
CDS scaffold_12:1040912..1041002  ( + strand )
CDS scaffold_12:1041810..1041944  ( + strand )

Sequences:

Gene

>Mapoly0012s0090.1
TGTACCACATCCTCTGCCTCCAATTCTCTCCTCCTTCGGATCTGGTAGGACCTCCTGCCGCTTGACTCGAATCGGTTGTTCACATGCTCGGGCATTCTTCAGGCATTGAGATCAAAGCTGGATTGATTAGCAGGACAAGTGAGGGGCAATCGTTGAGGATCACCCGAGACTCGAAGGAGGCAACTCGTCACTCATCTTTGTAGACATGATATCGATCCTGTACCGATCTCGTGTCCTAGTAAGAGGCGATTGCAGGTCTGAGTGTTCTAGATTAGTGCCATTGCACTTTGACCCGAGACATGAGCAGATCAACTGAGCTGAATCTCGATAATCAAAGGTCATTTGCAACCCTGAATCACTTGCTGGCATGAAAAGTATCGAGGTCAAAATCACTCCATTGTCTAGTAATATTGACCTGTTGCCTCACAAAGCTGTGAAGTTTTAATCACGATAAATGGAAGAACTGAGGGCTCGGCCTGGTCGCGAATCTGCTAGCCTTATCTCACTAATTCAAATCTGATTTAATGGAGAGGGTTGACAGCTTTGAGCCGGGATTGAAAATTCCATACAGCTTGGTCAAACTTTCAACCTTGGAGCCTTCCATCAGATAAGCCTTCTCGCAACAGTTTACAACACGAATCGATGCGATTTGAGTTTCGCCTCAAGCAAATGCTTCGCTCGGACTGAATCTATTTGGACTCAACTGGAGCAAGAAAGGGAGACTGCACGTGGAGCACTGATTTGGTAGGGGTGTGATGAATAGACGGACGAATATGCCAACTGCTGGCCAGATATTAAGGCGAGGATTCCAGATCTAGAAGAATTTCATGATTAAATATCAGGGGAACACCATATGAGATACCAAGTTTATCTACAGTTAGTAGATATCAGAAAAAGGATTTGCCACTGCAGAACACAATGTTGACCTGATGAGATATACTACGATTGCAAAATCTTTCTGAGCTTTTCCAGTCTTTGAATTCACGTTTCGCTTCTTCATCTGGCATTGGGTCCAGTTTTACAAACTTGCCTGGGGTAACATCATCTGAGTCCTCACAATGAAAATAAAATTGTGCCACACTAAGATAAACATTTATAAACACAAGCGTTCTCTTGCGTGCACCCTTTCCTCTGCTTGTACAGATTTGACTACAGAGATAAAAAATAAGTGGTGGCTGCGTCGGTTCAGAAACACAAAGGTCGCTCTGATCATGGATGGCCCCAGAAGTGGTATTGTAGCAGAAGGAAGTCCGAACAGAAAGTGTCCGAATGAAGATCTTGCTAATCTCGAGTGCTTCAAATATCTCGAATCACATGAACTCCATGTTCTGGCTTTCAATTTATATCAGAGAGAGAAGGAGAATACACGAAGTTTCAGAAGATCAGAGGCAGAGGCTTTGCAGGATGACAACGTCAGAAAACTGCATGCTCTGATTTCGTTGAAAACATGAAGTTCTTGCAGATACGATCCAGTGTGATGAAATTCGTAGACTTTGAATTCACCTTCCGAAGAAGATTATGAATTCAAAGAGCGGAATTAGGTTGACATTGGTATGTCTCTTACAGTCTCTTATTTTACAGGTCCTCGTTCCGTCGTCCATATTACGTTTGGCATTACTGCACCTGAAGCGACGTGACCTTTCAAAGTATGAGTATCGATGTGCAGCAACTTTCTTTATTCCTGAGAACCAGAAGAAACTCAACTCCTGTTATGGAACAGGCTGCTCAAGCTCAAACTCAGAGCTTGTAGCGAGCTGCAGACAGAACTCGAAGTATCAGTCCAAGCCAATCCACATCTCGTCTTGTAAGAGGTATTCGCATTGCCAATGAATTCCGTCCGAATGGATCGATGTTGCAAGAAAAAAAAAAAAGAGCGGAGTAGCTACTTACGAGCAAAGATGGATTTGTAGTATTCTATGAAGTGGATATTGCAGTCCTTCCAACTCTGGACACCTCAAATGAAAGATATTCCTCAGATAGACGAACTCTGTAGCTGGTCACGATTGCTCACACAAGTTTGACGGAAGTCGAATCGTAACAATTCGTTTGTTCCGTTAGCTGAGTTTGCGTAGCAGATGGCGCCAAAACGGAGGGAACATGTACAATGAACAATTTCAAGGGCTTACAAGTCATGAGTCATTACACTGCGTGTCAATCTGGAGGCCGAAGGGCTACGTCTGTTGAATCGCCCACGTCTGATCGCTAAAACCTTTGGCCACCACAGGACCAGGCACAACGGAAATTTCATTTTCATTGCATGCTCAGGCAGAACTGCGAAATGATAAGAATGGTGTGGCTCTACTACGTCCCAAGCTGAACGAGGGATTCATACAAAATTCAATGGAGGAACAAAGTGTAGGTAATCCGTGCGCTACACTAGATTCGACAGAAGGAGAAAATGTTGATTCCGGTTCGCTCTGAATCCCCTGTCACCAATGCATCGAGGTAAGTTACCATTGTTGTCCGTCAATCACAAGGTACGTTCATCTAGTTTCCCGTCCGTATTCAAGAGTACACTTGTCATTCCCATTCTTAGAATCTTAACAAGAATTTGGCGAAAGCCAACGTTGTGGCAGACATTATCTTTAGAGATCGAAATCGAATCGAAATCCTAGCACAACGGCATGTATAATGTTTGTTGAAATCTGCAGGCTCGACTTAACAGGAAGCTAACAGTGGATACAGATTTTCAGGTTCAGTCTACTTCTGGAGGCCTCATCATCATGTAGCCTGCAGATTCCAGCAGATGTGTAGGCGGCTAAAGGATGGGCAAAGTGCTCAAACTGGTATTTCAGGAAGTTATTGACACCTACCATAAGTTGTCGGCTTTCGTAAAAATCAAGGGGAAGCACATAGTTGACTTTCTGGAGGTGCTTGAATTCGATGACTGACCTTGAAAGTTTCATGCATTCAAGGAGTTTTGGCAACAGAAATTGTACCCATTAGATAGCTTGATGTAGATCCACTCTCCCCGGCTGTCTGTCCAATCTCAGCATTTGAAGCCAATAGGAGAGAAAAAGGAGCCAATTGAGGTACACGAAGATCTTTCCGGTCTGGTGTCCAGATTGTTGCCGTCCTACTCATCAGGATTCTAGAGCCTCATTCATTCACCTTCCCATTTTGACATGTGTAGATTCGCTTCATGGATGTACAAAATCCTTCGGAGAACCGCAAATTGTATGTTAGGGCCGTAACTACAATGGACTAGAAATGTTTAAAGAAGCTGGAAACTAGTCTGTCAAGCATCCGAGAAGCACGAGTACAATGGTCGCAAGAGGCACGAATCGTAGGCCGAGAAGAAGCTGTTTCAAGTCTCTGGAGCGAAAGCTTTCGTTCCAGTAGCTGCTTCATTTCATCGTCTGAGAAGTGACGAGTGCATGAAAAGAACCGCACAACAAAACCGAAATCAGATTCACGATGGCAGGGAGGGGGGGTCAGGGCAAGCCATGGCCAGGGCAAAGGCCAGAGCCGTCTGATTCGGATTCGGAGACGGAGACGGAATCGGATGCTGACGAAGGGCAGGATGGAGCTCAGCCGAGGCGTCTGCCACCGCCGCCAAACATTCGTTTTCCAACTGTCAGACCCAGCACCGTCGGCGCAGTTCTGCTGGGAAGGTCTAGGAGTACATCGCAGACTCCAACCAGGAGAGATCGCAGCAGGTCGCCGAGCCGCGCTGAAGCTGCTGCTGCTGCTGCTGCTGCTCCGCCCGCTGCTCCGTCCGCTCGAGCATCGGGATCTAGAGGTGCATCACCAATTAAGACCAGGCTTAGGAGCGCACGTCCGAGGCCGGATGGAGCAGCGGCACCAGCAGCTGCAGATTCTGCTGTTGCCAGCGGACAGCAGCAAACGGACTCGACAAGGACTGCTCGAGCGTCGGGATCTAGAGGTCCATCACCAATTAAATTCAGGCTTAGGAGCGCACGTCCGAGGCCGGATGGAGCAGCGGCACCAGCAGCTGCAGATTCTGCTGTTGCCAGCGGACAGCAGCAAACGGACTCGACAAGGACTGCTCGAGCGTCGGGATCTAGAGGTCCATCACCAATTAAGATCAGGCTTAGGAGCGCACGTCCGAGGCCGGATGGAGCAGCGGCACCAGCAGCTGCAGATTCTGCTGTTGCCAGCGGACAGCAGCAAACGGACTCGACAAGGACTGCTCGAGCGTCGGGATCTAGAGGTCCATCACCAATTCCGACCAGGCCTAGGAGCGCACGTAAGTTGTCTGAAGAGTCGCGAGCAGCAGCAGCAGCTCCAGCTCCAGCTGGTGCCAGCAGTCAACAGCAATCGGCCGCTGGAGCCCCGGCTGCTGAGTCTGTCCAAGGATCAGGGGCTGGAAGTACATCACGTCCTCAGAGCAGGGTTAAGAACAGACCTCCGAAATCGGATCCACCAGCAGCACCAGCTCCTGCTGATGGCAGCTCTCAACAGCCAAGATATCAAACCAGATCTCAAGCAAGAGCCCGAGATCAGACTCCGGCTCGAGGCACAGCAGCATCTGGTCCATCTTCTAAGCGGGACCCGCCGGCATCGTCTGGACGGGTATCGACAGCTCCATCCACCCAAAGAGCAGCTCCAGCTCCAGCTCCAGCTCAAGCTCCAGCTCCCGTGCAATCTCAGCAAGCGAGAGGAAGACAGCCCAAGTCGCCGGCACGAGGCGGAAGTCCTGGACAAAGTTCATCACCGAAGTCTGCAGTGGCTGTTCCAAGGTATGCAGGTTCTTTTCAGACCAGTCAAATTGTGAGACATTTCGCCGATCAAACCTACGCTGCTACGTCGATGCAAGTGTTCCAGTGCCGCCCACTTCAGAATATGTCACTGGATTCACGTCCGATGATGGAAGTTAGCATCCTAGGATAATCAGAAAGCTTCGTGAAACCATCGCAAAGGGATTACGCATTACACTCTTCAAGCTTGCAGATTCACCTAAATCGAGGAAATGAGAAACCAAACTCCGTAAGACTTGCCAGGCTGCGCTAGTTCGAAAGAAAAATCCCGACAACAAATTCTATACAAATCTTTGCACATAGATTCGAAATCAGATCGAAGTAGCACGCATACCTCTCGACGAAATGTGGAGCAAGGCACACGTCGTCAAAGCAGATGTGATGAACTTATATCTGTTGGCCTGCAATTCACCCGAGCATCGATCTTGAGCCCAAAGTGCGGTCGTCGTTACGAGGCTAGTGAGGAGTAACAGACATCAAAGCTACATCTGTAGAACATGTCGGGGTCATCATCTTTTCCATGCTTTGGTGTGGCACGCAATTTCTGATCTTCTGGCTGGAGTGGTAAACGATGATTGAGGTGATTTTTGAGAAGAAATAGTCACAGTCCCATGGTTTTCCTGCACTCGCTTTTCCTTTACCTTGTCTTTCCTGTTCCCTTGGTCGACTACTTCAGTCTATATTTTCTTCCCCTTGAACCTTGCCCTGCGCCGCTTGCGAACGATTTTGCTGCCTGACTCCACGTACATAGCTCCGTGAGCTCATGCTCTAACAAGAAGTCCAGTTTCGAAGGGGAGCATTTGTGCATATTTTAGGTAGCTGGAACATAAAAGACCACGGACACAGAGATGGCAAGGTCAGGGGAATGCAGGGGCAGGTCAACGCATTGGAGTGCTTTTTGGTCGAGCTTAAGAGAAATTTTAATCTGGTCATGGATTCGAACTCGCGCGACAGGATCATGTCTCGTGTGTCAGACGAATCATATGTTCTTCTTCTATTGACTGCTCTTCAAAGAGCCGGAGACTCCAATTCTCATCCTGGTTGAGAGCAAAGCAGATTCGTGCATCCGCCTCTGACATTTCCTTCAAACCATTTGACCCTCTATACGGATTTTCTGGCAGTTGATTCACTGGCCATCACTCTGTCCTCCCATCCTTCGTCCACTGAGCATGCTTACTCAAATTTCCAGTAGAAATCTAAGGAATCAGAAAGCCCAGAGATTGACGGTTCGGAGAATGCTAGCTCAGAATGTCCGCCAGACTAGTTCCCGGTTCCTTTTGCTGCACCGGGGCACTGAAACAATCGGGTTTCAGCGATTTTGATAAGCAAAGTACAAGTGAAATGAACGAAGGTGAGATCGATGCCGCTCATAAATTATATCAATGATAGTGGAAAGAATTTCCCCGACCTTTTTTGTGCCACAAATTAAGCATCGATGAGTGATGTCTCAGGTAAAATCATGATTAGATGGGTCTGGCACATGTGACCAATAAAAAAACATGCGCCAGGAACCGCAACCATGCAAGACCATGCAATTAATTTTCTTAGACACCAATCCTGCCCTGATCACCGTGAGCAATGTAATAATCTAGTTTGTCGCGCTGGATCTGCCGAGTCAAACTAAAACCAGAATTCTGTAAATAAAAATAAAAATAAAAATGACCGCACCTGCTGGAAAACCAGAAGCCAGGGAAGTGCTGGATATGTAAGGCCTGGATTGGGGATATCTCATGGGGTGATATCATGTAGCGCTCGCATGCCGACTTACTCTTCGGGGGACCGAAGCGAGCTCAGATATTGCTCTGGACTACTTTTAAACCGTCTCCACGTATTATTGAAATCGTCAAATTCTTTCTTTCTATCTTTCTGAGGAGCATATTGACGCATTATTTAGCACGCTACAGATAAGCTTTTTCCGTTCTTTTCCCCTCTTTTTCCCTTGTTTATTTATTCAAGTGATCCAGTTTACCTAAAACTCCAAAGTATGTATCTGTTGTGAAATGGCTTTAGGAGCCTTGACTATTCTTACTTCAGTCTGTGGCTGGTTCTTGTTCAAGTAGACTATGTATGAAAATACATATTCCATGACAGCAACCTGTGGTAGGACCGCTTGCAATGTTCTCTCGATCCGAAATTATGTAACACTTCTCTCTATATTCCCTTGACTTTTAAACTACTCGTTGCTGAACATGCTTGGTCCACCGGTAAATGGGTCGGAAATTCTAGAAAGTGTAGCGTGGCCTTTTTTTAAAATGGAGAAGTCTTTGTCACCCTTTTATTGAAAGTGGCAATGCAAAGACAGCGGGCAATGCCTTTCATTTGAACAAATTCATGCTTCTATGATGTTATTGGGGAGAGTCGGGATATACCCTCCAGGCTGTAGAAAGCCATCTTCGAAGTTATGCTCTGGAAAGTTCAGGGACACCAAATGCTGCACTTCGCTTGTATCCAACGTGATCTTGAAACACTATTTCGGACCCAACGAAGAAAGATCAATCAGTATCAATTTCGGATCAATTAGTAGTTCCCTTAATACTAATTGATCTGAATCTCTATTTTCTTCCCTGGATTTATCCTTCTCCGTGATCAGAAGACTGGGTTCTCGCGATTCAAATGGGGTCAGGTGGCCAGTTTTGAACCCAGTGCAGGCAAAAATTCGGTTCTAGTGGAAGTGCTTCAGTCACGTCAAAGATAATTATTTCTTCGAGCATACCGCTTTCCATAACAGAGGCATTGGTTTTCATTAGTAAGAGGCTTAGAATAAACGAATTGGAAAGTAACATCGACTCCGTGTATAGAAAGAGAAGAAGTAAAGAAGCAGATTCTGTGACCAACGAATGAACATAGATATCAGATCCTCGAGAACATGAACAACATTACGGCTTACCTTCATTCGCAATCCTCTAGCGGCCGCGGTCATCGTTTGAAACTATTCCAGATCTCGATTAGGATAATGTGAGTGATCGTGTACCTGTCTAAAAGACAGGTACACAAAAACGCCGGTAGACGCGATCGGGAACAAACGGACCGAACGAGAAGAGTCGAAAGCAGTCACGTCTTGAGATCGTTCCTTCGTCACGTGGGCTGTTCCAAGCAACGAGTTTGACGAGTCTGATCAATTTGGGAGTTCGATGGAATGAGTGTAAAGTGACGGCGAGCTAACAAGAGATGAGTTCCTTGCAGAGGCGGCAGTCCGAAAGGAGGAGCAGCAGCAGCAGCAGCGGATGGGGATGATACTGATATGTTGAATTTTGGCTCGGCGGATCTAGAAGAAAATCTTCCACAAGATGCTCTGTATTTCCTTCCTTCCCTCGACCATCTTCCACTCTTCGTGAGTGAAGAGCCGCCGCCTTTCCAGGATTTCCGATTAACCGCACAAGATGTGGCAATAGCGCTGGACGGTGCTCTGATTCAGAACCGGGTCAAGGGCACGCCAGCGGCATCGCCGCGGCCCGACGGAGTGCCGGCGAGAGCGACGTGGTTGGATTCAGTTCTGACCCATGCTCAGACACAGGCAGCGTTGAGCCCACAGCCCGTGGCTCCGCAAATCATGTCACCGCCTCGAGCCGGTGGAGGTGCCGACGGTGCGCCAGTCCTGCCGATTGGATTACAGCCCATGCCTCTGCAAGTGAGGTCACCTGACGGTACCATTGTTACGCCATCCATGGCCGGATCGCCTAGCCGGGTGAGCTCCCCCCCGGCGAGTACAGCCGCGGGCTCGCACGGTACATCCAATTTTCCATCCCCGGGCGGATTGCCTAGCCGGGTGAGCTCACCCCCGGCGAGTACAGCCGGGGGCTCGCACGGTACATCAAATTTTCCATCCCCGGGCGGATCACCTGGCCGGGTGAGCTCGCCCCCGGCGAGTACAGCCGGGGGCTCGCCCGGTATATTAAAGTTTCCATCCCCGGTCGGATCGCCTGGCCCGGTGAGCACCCCCCTGGCGATTACAGCCGGGGGCGCGGACGATGTCGCTGACATGGACGAGGATTTTGACGAGGAGTTCAAGTTGTCGGAGAAGGACTTGACTGATGCTCTGTCATATGCTGACGACCTGGACAATCTGGATCCGCTGATCATGCATGCCCTTCGTCAAGCAGGCCATCCCGCTCCTGGAAGTCCGGGGTGGGAGGAGTTTCTGAAGAGCCGAGGACTGCAGCGAAAAGCTCGAAAGCCTGATACTTGGCAAGCGCAAGATGCTGTTGCTCTTGCATCTGGCGATGCCGGAGGCACTGCCCTTCCGGCATCGACTGACGGACGAGCTCTCGATTCTGGCGATGCCGGAGGCGACGACGCGCAAGCTATGACTGTCGTAGCAGGTCCCGCATCTGGCGATGGTGCATTGACCGTCGAAGGAGCTCTGGGTTTTCGGACTCCGTATCATCACGTCGGGGCCGATCGGCCTCCGGGCTTGCATCCAACCGAAGCCCATATGGTTCAGATGATTGACTGGATGCGGTACCTCGTGGCGATGCAGCGACAGCCGCAGCATTTTCTCCACGCAGAGAACGGGTTGAGGTTGGGCCGAATCGTCCAAGCGTTCAATCGGTCGTGGATGTACTCCGTCGACAGGCTGCAGCTGATCCCTGCGGACTCGGATCTAGACAGAGCGCGTCGTCTGCGCAGGACGGTGCGGTACGAGATGAACGGGATCCAGGACGAGTACCGCGAGGGATTGGTCGACGAGTACGAGCAGGAGATGAGTGGATGGATCTCTTACCTGCGCCAGCTGCGGCGCAGCAATCTGCAGTACTCGAACGAAGAGAGCCGCGTATCGTTCGCGGCTGTGGCCGAAGCCTTTAACGAAGAATTCGACCAGACCGTGCGCGCTCTGCTCGGGGAGGAGGACGCGGAGAATATATTGAATGTGCAGGGCGGCACAGCCGATCTCGATCTCAGCCCCCCGCGAGCCGATCCGGCTCGGAGCCCCCTCCGTACTCACCTTATGGAATCGTTGCTAGCTGCGGCATCCCCACCCAAGGGCCATCTTAGCCCGAAGCTTGCATCCCCACCGCCGACAGTGGAAGCGCAAGACTCTCGACCGGGATCCGCCAAACGGAAGAGGGGGCCGAGCCTGGAAAGCGAGTCCGACAAGCCCGCCGCTAAAGTGCCAGCGCAGGGAAGCCCGGGAGGAGGAGATGGTCCACTTCCCGGTAGTCCCGGTGGAAGTCGAGTGGCTAGTCCCGCTGGAAGTCCTGGAGGAGGAGGTAGTCCTGTTCGAGGGGCTAGTCCGGCTCGAGGGGCTAGTCCCGATGGAGGCAGCCCACTTCGAGTGGCTAGTCCGGTGACAAGTCCTGTAGGAGGAGCTACTCCTGTTCGAGGGGCTAGTCCCGTTGGAAGTACTGGAGGAGGAGGTAGTCCTGTTCGAGGGGCGAGTCCCGATGGAGGTAGTCCACTTCGACCGGCTAGTCCGGTTCAAAGTCCTGTAGGAGGAGCTAGTCCTCTTCGAGTGGCAAGTCCCGTGGGAAGTCCAGGTGGAGTCCCCGGGGGAGTTAGTCCACCTCGAGGGGCGAGTCCAGTGGGAATTCCTGCAGGAGCAGCTAGTCCCGGTCCCGGAGGAGGAAGTCCTGTTCGAGGGGCTAGTCCCGATGGAGGTAGTCCACTTCGACCGGCTAGTCCGGTTCAAGGTCCTGTAGGAGGAGCTAGTCCTCTTCGAGTGGCAAGTCCTGTAGGAAGTCCAGGTGGAGTCCCCGGGGGAGTTAGTCCACCTCGAGGGGCGAGTCCGGTGGGAATTCCTGCGGGAGCAGCTAGTCCCGGTCCCGGTGGAAGTCCAGGTGGAAGTAGCCCACTCAGTTGGGCTAGTCCGTTTGTAGGCCGTCGAGGAATTCCTGCGGGAGCAGCTAGTCCCGGTCCCGGTGGAAGTCCAGGTGGAAGTAGCCCACTCAGTTGGGCTAGTCCGTTTGTAGGCCGTGGAGGAGGGGCTAGTTCCGGTCCCGGGGGAAGTCCGGGTGGAGGTTCCGGAGGATCTAGTCATCCGGGTGCAGGTCCTGCAGGAGGTGGTAGTCCTGGAGCGCCTAATCCCGACGGAGGAGGGGGAGGGGGAGGAGGTAGTCCTCCTCCAGCGGGGAGTCCTGGAGCGCCCTCGAGTCCAGGGAGTTCAGGGGATGAAGTTTACGATGAAGACGCATTGTTCAATGGCTTGATGCTGCACATGAAGATGGACGAATGGACGAGGTATCTGTGCATTATGCGGCATCGACCTCAGCGGCTGTCGCAAGAGGAGACTGCCACGACGCTGGCCAATCTTCTGAACCTCGTGCACACGAAACTCTCTCCCATCGCAGCGACATTGGTCAGGTATTTCCCCACTGTGAACCCGGAGGTAGATATGGGAACGGTTGCCCTTCTGCCGTCGTTAATCAGCCACCGGAATCACATCATACGAGCTGCACTGTTGTCTGCTGGATTCCAGCAAGGCGTCTCCGTAGCTGCCTTGGAGGCTATAGACCAGAATACTATCTCCGCGTGGACTCAGGAGATCGATTCCGTCGCAGACCCCTTCCCTGCCATCGATTCGAAAAACCAACAGAGGTTCGTCATTACGTACCATGGTTTTTACGACGAAATAGCCGATGTCGTAGATCAAATTCTTGGTGGCAGGGGAGAGTTTCTCAAAGAAGCGGAACCCATTCGGAGGGAGATATTTCAGACCCCCCAGCTGCACGCCCAGGTGGACTTACCAGAGCTTCTTCAAGTAGGTGGGGATCATCCCGTACTCAATGACGAGTGGCAAGCCCCTCTAACTACGAAACATATAACGACGCGTAGGGTTGGAAATTTCCCGAGCCTCCCTGACACTTACATTGTAGCAGATGTCGATCCTAGTGACGTATCACATCCTGCATGCGAAAGCCAAGTCGAGCCGCTGTACCGACAAAGAGCTATAGTGAACTTGTTCGATGTTAATGCCGATCGTTTCGCTCTAGCCAAGACTTCAGACAATCTCAGGGACATACACGGGGGTAGGCTTACGAAGAATATCGCGGTCCCACAAGCAATATCTGCCCAAGCTCTGACCGATGAAGCTCAATACCATGTTTGGGCTCTGAAAGAGTTGAAGAGATTGCAACTGGAGGTTTGTCTCTCCGTGATGGGCACTCCCAAATACACCCACATGCCAACCAGCTTGCAAAATGATGTGCGGTTCTACATCATCGCTTATCATGTACGTTCAGTTCTTCCATTTCCTCCTCACATTTTCCTTCGCCCGTCCTTCACTAAATCTTCACTGTACTCTCTGTATCAGAGTGTTTGCTGCTCTCCGAGCGGAATTCTACGTTAGGAAAGTTCACAAATATTTAGCATCCGTAGTATAATGGGTGCAGTATCAGAGCAGAATGGCTGGGAGCATCTGAGAAAGTACCACGTGCGGTTTGAAACGTGCGATGAATGAGCTGAAAAGGTGCTCGACTGATCAACATCAATGTCTTTTTGATGCAGAAATTCATTCGAGGCATTGTGGATCACTGCGATCATGAATGCTCTCGAGTGCTAGAGCCTCAACAGTGCTGCTATAACCGAAAACTTGCACCTTTGAACGCCATCATGGATCGCGAAAAGCTGCACAAAAAAACGATGCACAAATTCGTAATCGTAAGACCTTCCAGCATCTGTAAATTTTGACATGTGTCTCGGAATGAAGAAGATGACAAATTTGTGGACTCTTACGTCTAACCTCGACGATCTAGATTGCATGGTACATAAAAAGGCAATAATAAAATATGCACAGATATCGAAAATCGAAAGTCACTAACTTTTGAGCCTACTTCATGAGTTTTGTCGAGGTCGACTACATCTAGCACTGTGTGTGTTTTGCTCGCAGGACATCACAAACGTAGTAACAAAATGGTTGAACAAAACGGGGTCTCACTGTGTTAAATTACCATTCCACGTTATGGAAAAAATAAGGTAAGCTTGTTCGATGTACTCACTCATGTTTGTAATTTGGTTGATACCAAATTTCTTTGCTTTTTTTACATTTTCTGTTTCAGGGTCATACTTGTGAAATATTTTCCCGCTAAAAGAAACCTTTGCTGCTTTCTAAGTTTTTCGATCATAATTTGTTTATGATCCAACAAGCTTAGTAGAAGTGTTACACGCGTACTCCAGAAAACTCATAGAACAGAAAATTCATTCAGTTTGAAACTATCATGACCAAGATGACAATTTCGACTAAATGAGAGGGTTATCATAGTCTGTGTACTTAGATGTTTTGTTATGATTTATATCTAAAAAAACCACTGTTCGAATATGTGGCATAAGAAAATGGAATCGAGATCACCAAGGAAAACCTTATCCTAAAGGAGACGAGTGGGGGCCACTTGTGGCTTCCACAGGAATGCAAAACAATCAGGTATTTGAACACTTACTCATTGCCTGGGTACAATTTAACTTTCAGGCATTATAATAAGAGATTCGCAGATTGAACATGATTGAATACAATTCTTGAATAGAAATAACGGAAGTATATTTCCTACCTAGACTAAATCTTAGCTTGCTAACTAGCTATCTCCAGCTTTACTTTAACTTGAGGGAAAATTTTCAAATGCATGTTCTGCACTCATTTTCTAGTTTTTCCACATTAGGAACCAATCTATTGTTGCTTTGACTTTTGAAATGTAAATCGAATTGTGCAGTTGAAATGGATCTTCAGACGTCTTCGCTTAGAGACCGTCGCTGAGAGAGGGTTGGAACGAGCTAGAGAGTTGGTAATAGTCCAAGAGCTGGATGCGATTGGACAAGCGCCCAAAGACCAGCCACTTAAGCCAGCGGTTGAGGCATTTCTAACGTAGATTTCCTCACTCATTCCAGGAGCTTTTTGGTGAAATGGCACATAATCAAAATTCTTAAAATAAAATAAAATTATAGTGTGTACCATGTTAACTGATAAAAGAACAAATTACATGTAAGAAAAGCAATTAAAACAATGATTTTATGAACAGAGGACTTTTTAACCTAACATTTAATCATCGGCAGAGGTTGGATGGAAGCTCATCGCGAGTATCCCTACCCAATACGGTCAGAAAAGGAAACTTTAAGGAAATATGCCAGACTGACTTCGAGAAGGGTAAATGCTTCTCTTAAAACATCGGGTGGAAAGTTCAAATGTTAAAACTTAACATAAATGTATTATTATAGGATCCTCATGTTATTCCAGGTTCATTTCATGAGAAAAGTCTATCACTTGAAACTTGTATTATGGGAACATGCAGATCCAAACGTGGTTGTCAGATTATCGTAGGAAACATGATCTCGCCGGTACGTGGATAATGAGAGACGCTAATTTGCTAGAAAGGTAAGTTCCTCCATATACATAAAAAAAAATCAAAACACACACACACGCACAGTTTCTGTCTTGATATTAATTAAGAATTATTTTCATCATAAGTATCATTGAAAACGAATCTTAATACAAATCTTATTAAGTTTTGAAAAAAAATGAAATGGCATTTTTCAAACGAATGCACGTATTCACTTATTATAATGTATAAAATATTTCCCCTGTTGGCATTGAGTAAAATTTGAACTTACCTGTGAAACCATTTAGTCTGTACATAAAAGTGAGAATATTTTTATTCTGAATCATCATGCTGAAAACATTTCGAAAAACGTAAAAAAAACAAAACCTTGTTTGAATTTGTAGGCAAGGGAATGGAAGAGGCATGGATCCAAGATATGGAAAGGTGGGTGCTCCGATTGCAGATCCTCACATAGATTGGGACCGAGATGACTCGAGTACCAGTGAGGATGATTCCGGGTCGCCTCGTGATCCAGGTGGATTCACCTTTGCCTTAAGGAAGAGTGATCGGAATAATGTTTATGAAGCAAATAATTTTCAATGAAAGGAGCAAACAAATAGAAATAAGTCGGATTGCAACTTGTTTGTAGTTTTTTCTCGATGATATCTGATAGATGTCAATATATAGACACCTGAAGAGTTGACAATGAATCACATAGTTCATCAAGAGAGTACTCACAGTGTATAAGTAAAATCATGCCCAAAAACCAAGCGTCTAAGCAATGATTCAATTTAATTTGTAAGTGGGATGTTGTGGTTATGCTTTCTCTCGGATACCATGTTAGGCCAAAATCCTGCGACTTTGAAGTTGAATTGATAAGAACTTGGATGTTACACGTGACTTCAGCAAACTGTTATTTCTAGGAGCCAAAATCAAAAGTTTACATCAAAGCTTTGCTCTTCGAGATCATATGTTTCTCTGATTGTCCATCGGTTATATAACTTTAATACAATGTACTCCAAGATTGCATCTCGTGACAGTTCAGTAAGAAGTAGCTCAATCGTGTCTCTCGTTTCTGAATAGCAGCAGCAGGAGGAGATGCAGGAGGAATAGCAGCAGCAGCGGCAGGAGGTGGAGCAGGAGGAATAGCAGCGGCGGCGGCGGCAGGAGGTGGAGCAGGAGGAATAGCAGCAGCGGCGGCGGCGGCAGGAGGAGAAGCAGGAGGAGGTGGAGAAGATTATGCTGATAATATGCTGATAGATGTCGATGACAACGAGCGCCCATTCCCCCAGGCTGAACAGTACGGGGTCACCACCACCATCGATCCTGCTACTTTACAAGAAGCTTTCAGTAACGCAATGCAAGAAGTACCTATGGTAATTGATGGAGGTGACGCTGCTGGTCTTCCGGTTATCGACAAGGCGGCAGACGCAGATCTGGGCTTAGGACCTGCGATTCACGAGGCCATCGAGAAAGCAGCGCAAGAGCGACCGATCGGAGATCAACCTCGGAGGGACAACGATTACGAGGCGTATGCACAGGCAAATCTGCCTGGCGAGACTTTCGTGATTCTCGACGGACAATTTGTTCCTGCGGTCGGCGAGAATGCACCCGAAGACGGCCGAGAGGTCGTACTGTCGAACGTCGGTGCTGGAGGAGGAGGTGGAGCAGATGCGCAGGCCGCCATCGTTGCCGATCCAGGCCGTGCGCCAGATCCCATCCTTCCTGGTGTGGACCCGCATGCACAGCCCCAGCCAGGCCCCATCGTCGTCCAGCTCGTGCGGAGCCCGCTGCTGCAAGCCCGCCATGAGATCCAACAAATGGACGCCCAGGGCCAGCTCCCGGCCGCCATCGCCGACGAGGCCTTGGCTAATCTCCAAAACCAGGAAGCCGAGCCTCCCCCGCCATCGCCCCAGCAGCCGGTCATACTCGACCCCATCCTCCAAGCTGCCCCGGGGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCTACCGGATGGTGGCCATCCCCAGCCCTATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCTATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCTACCGGATGGTGGCCATCCCCAGCCCTATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCCCGCCGGTGCACCTCAAGCCCAGGCGGGCCCCGCTCCCGCACGTCAAGTCGACGACCGTCTGCCAGACCAGGGTCCCTTCGATATGGAACGTCGGCGGAGGTTGCGAATGGAGTGTTGGGAACCCAATGCACGGATGGCAACGGACCTCATGTTTCGAGCCTCTGAAATGATCAAGGCCTGCGTGTCCAAGGTTAATGCCCAAACGATACTGGCCGCACGTACAGGCACCATCACGAGACTTGTCCTAAGTCACCAGGTAAGTGATCTTCTGATTTTCGAGTTTCTTCGCATTCGACTGGTGTTTGCCTCTACAAATGACCCATCTTCTGACTGCACGAAATTGCAATGCCAGTCGTTATAGTAACGGGCGAAGTTCTATTTGGCACTTGACCTTATTAGGCATTCTTAATTAATTGTGGCGAGTGTTAAGAGTCATCATACGGTAAAGACAAAGCCAAACGAAGATTGTGAAAAAATTCTCCCGTTCCCAAAAATTGAAGAGTTTTAAGTTTAAGTTTCTATATCCCTAAACTGTTGGACATTGGAAGTGCTTGATCGTGTGGATTCTCCTTAGAGAAGTTACGTGTTGTGATCATTCCTGAACTCACCCCGGTCATAGTACGATAGAATGACAGATCCATTCACGCAAATCCTTATCCTTACAGATGGCACTATCATGTGCAGGGCTTCGCGAAGAGTCAGCCTGTACATACTTGGGACGATTGCGTGCCCGGCGGCCCTGTAAACGAGTGCTGCTACTCACTGCGATACGGAGAGATAGATAACATCGTGGGGGAGCAACAACGCTTGGCTGCCAGTCTGTTTATGTTCGATGTGGTATGCATCTTACTTTGGATTTATTCTTTGGGGTGCAATGCATGTATTAAACGATAAAAGAGCCCGTTTTTACAGGAAAACTGTCGAAATGAAAACCTGATGCTGGCCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCCGCCGGTGCACCTCAAGCCCAGGCGGGCCCCGCTCCCGCACGTCAAGTCGACGACCGTCTGCCAGACCAGGGTCCCTTCGATATGGAACGTCGGCGGAGGTTGCGAATGGAGTGTTGGGAACCCAATGCACGGATGGCAACGGACCTCATGTTTCGAGCCTCTGAAATGATCAAGGCCTGCGTGTCCAAGGTTAATGCCCAAACGATACTGGCCGCACGTACAGGCACCATCACGAGACTTGTCCTAAGTCACCAGGTAAGTGATCTTCTGATTTTCGAGTTTCTTCGCATTCGACTGGTGTTTGCCTCTACAAATGACCCATCTTCTGACTGCACGAAATTGCAATGCCAGTCGTTATAGTAACGGGCGAAGTTCTATTTGGCACTTGACCTTATTAGGCATTCTTAATTAATTGTGGCGAGTGTTAAGAGTCATCATACGGTAAAGACAAAGCCAAACGAAGATTGTGAAAAAATTCTCCCGTTCCCAAAAATTGAAGAGTTTTAAGTTTAAGTTTCTATATCCCTAAACTGTTGGACATTGGAAGTGCTTGATCGTGTGGATTCTCCTTAGAGAAGTTACGTGTTGTGATCATTCCTGAACTCACCCCGGTCATAGTACGATAGAATGACAGATCCATTCACGCAAATCCTTATCCTTACAGATGGCACTATCATGTGCAGGGCTTCGCGAAGAGTCAGCCTGTACATACTTGGGACGATTGCGTGCCCGGCGGCCCTGTAAACGAGTGCTGCTACTCACTGCGATACGGAGAGATAGATAACATCGTGGGGGAGCAACAACGCTTGGCTGCCAGTCTGTTTATGTTCGATGTGGTATGCATCTTACTTTGGATTTATTCTTTGGGGTGCAATGCATGTATTAAACGATAAAAGAGCCCGTTTTTACAGGAAAACTGTCGAAATGAAAACCTGAATTGCTACCTTTTAGTAATTATACGCATAACAAGATTGTATCCATAGGTTCTGCCTGATGGTAAGTTCTTTCAATCAAAACTTCATCCGTTCTATTTAATATAATATCCATTGAATTGTGTCAAACCATCAGTCAGGATTAAATTTCTGATAGTTTGTTATATCTTCACCAAATCCACTCCGTGGTATGAAGTGTTGATACGCATCTTACTTTCATCATATAAACCTTCCGACCAATGGCTTTCCGTATTGCCCTTGTCTTTCATGACGCGCAGGAAGTTTTCAGGTTGGTGGGGATAGCATCCAATATACAGAAAGGGAAATGTAATCGAGTGATGAGACTAAATATGCCAGGATGGGTCGTCAGGTGGATGGAGTAAGCAAACAACTAAACCCATGTCTCAACAGAAGAATTGTAATCTAGATTCGTCATTTTAACAAGGATTTCATAACTGAACTAATTCTTACTGTAGAAATCAGGAATCTGCTGTAAGTGAAAATCAGATAAAGAAGTACTATCTTCCACAATCTTGAAATAGAAGTTGGCACACACAAATCCTGGCTGCATTAATTTGGCTACGACTTAATACAGCATGACAACCATGCTTGATCCCTGGTGTGAACGACAAATCTATGAGAGTAATGGTTTTTAAAGAGATGTTCTCGATCATATCAAACCACATAATTAAAATAACGTGCCTCAAGTTGGATAAGAGCTAGAATGTAGAATTCACAAGCGCTTATCATCCTCCAAATATAAATGTTAAATGCACAAGACATAGAAGTGGTGCTGTTAAATATAAGTAGGTGCCTCCATATGAACGTAGGCACTTGGTTTTCGTATGTCAGACTGAAAGAAACAAGCTTATAAAATAGACGTGTACAATATATTCATATGGTACTGTCTTCTAGATCTGACAAGTTTTTTCTTTGACTAGAATTAAAAATTTGATTTGATTATCTTGCGTACTCATAAGCTCTATTGCAAAAAGCAATGCCAAACACGAAATCTAATGACAAACTTACAAAAAATTGTCTTCCACTGGATTTCATGCATGTGCTTTAAACCAGCGAGTGGTGCGCGGCAAACGTTGCAGTACACCCCCTTACAGGAAAACAAATGTTGGCAGCAATTGAAGCTGAAATTGGACTGACCTATGTACATGTAGGGAAATATTTTCTACCCAGATTGAGCATAATTGCAGTAATCTGAGAATATCTGAGAATTCGGTCATTATAAGAAAATCTCCATAAGTGGGGTTTAAGCACACTAACAGATCTAGTTAAATCGAAGAAATAAAAGCAAACAAATCGAGTGATATTAGTTGATACTAGATGTGGATGTATGTAAAGCGAGTTCAAATAGCACGATGTATAGCATGAATAGCCTTCTTTCCCCTCAACTATCAAGATTTTGTCTTCGATCTTGCATGAAGGAATTGTTAATTTCAATGCAACCCCAGCAAAAGAATAGAAACAGGGTAGCCGAAAGACTGCTATATAGAGCATCATGAATGAGAGCTCGATCACTGGCAGAACTAATTTCAATCGTATTGTGTGTACATTTCAAAGGCAATTTCATTTATCTACAAGTGGAAGGCGGAATGCCTGAATGTTAAGGTTATTCCGGCTATCACTATGGGACAAATGGAAGAGGCTCAGCGAACTTACATGAGGTAATCGTCAAATGGACGTGTTGTCCTTAAGTGAGCATGCAACTGTATTCTAAGCACTAACGAAATCAGTCAGAAGAAGCTATCAATAAAGCTGATGAACTCTTTAATAATGGTTTAATTGAAATAAATCAAATTAGGTATTCAATGGTCAAATTATTATATATGTATATGTATACATATATGCCTGACATATAATTTAGACAAGTTTCAAAACATAATATCGAACAACTTGAAGGTAGAGACGATCACTCCAATGAAATAATTTTTAAGGGTTTGCTCTTATATCATGTGTTTCATGTCCAATGTGACCATGAATTTGAAAGTCTGGTTTCAATTGTCTTCATCAGAAATTGGTTTGAAGAGCATGTACAACTTCCTCACCCGACCAATGCGGAGCTTGATGTCATGTGTCGAGAAACGGGTTTATCAGCCATAAAGGTAAACTTTCTTTATGTCGAGAGTCAATCTCACTCTCTCAACTGAAGGTACTGCGATTGATCGAGATTTTAAAACAATCTCCCCGAATAAAATTCAAAAAATAGCACAAGTGTGTTCAAAGTCTAAGTTATGAAGGAATTTAGATAATCCGGCAGGAGAAAATTATTAACATATATATGCATGCACTCTAAAGAGCTCAAATTTGAGTTGAAAAACCCCAGAACCCAGATTCTCAAAAATTAAAACAACTGAGTCTATATTGACAGTAAGTGCTGTTACAGAAGTCATTAGGTTACCTCAAGTACACTGAACAATGAGCCACACTAACTTCAACTCGGTTTTTAGCTGCACACATCTTCGGTTGATATTCTAGGTCGTCGTACTAGCTGTTGACACCTATGGTTATATCTCTTCAGCTGCATGTCAGAAAGTGATTTCGTTGGATTCGGGTGTTTTGGTTGTCATTATTTGTCTCATTCTTACATGCGCTTTATTTCATTTCTGTTAAGAATACTATGGTAGTTGGTTCGTCTTTTCTTCTACTAGAGTTCCCTCTTCAGTGCTGAACAATCTTCTTAAAGGATTTTACACCGCATGCCGAAGGTTTGGCAGTGTGAATTACCGACCACGATTGGTCAAATCAAGCTTCCTCAGCTAGTGGGATGTGCAAGTCTACTTGCCAGATCTTAGACACTTTCATTGTCATCTTCCAAAAACGATTTACGAGGAAACTATCTAGTAAACGCAAATGTAACTTCCAACTTCGACGGTCAGCGGACTAAATTGTGACACCTGAGCTTGTTTCAGGTATTAAGATGGTTGGACAATTACAGATTAACAAACAATTTTAGAATGACTGGCATCGATGGTCATGGACGGTCTATGTTTAGACCTATCCAGCCAGGTGATGAAGCAGCAATTGAGAGAATTACGAAAAGGTGA

mRNA

>Mapoly0012s0090.1
TGTACCACATCCTCTGCCTCCAATTCTCTCCTCCTTCGGATCTGGTAGGACCTCCTGCCGCTTGACTCGAATCGGTTGTTCACATGCTCGGGCATTCTTCAGGCATTGAGATCAAAGCTGGATTGATTAGCAGGACAAGTGAGGGGCAATCGTTGAGGATCACCCGAGACTCGAAGGAGGCAACTCGTCACTCATCTTTGTAGACATGATATCGATCCTGTACCGATCTCGTGTCCTAGTAAGAGGCGATTGCAGGTCTGAGTGTTCTAGATTAGTGCCATTGCACTTTGACCCGAGACATGAGCAGATCAACTGAGCTGAATCTCGATAATCAAAGGTCATTTGCAACCCTGAATCACTTGCTGGCATGAAAAGTATCGAGGTCAAAATCACTCCATTGTCTAGTAATATTGACCTGTTGCCTCACAAAGCTGTGAAGTTTTAATCACGATAAATGGAAGAACTGAGGGCTCGGCCTGGTCGCGAATCTGCTAGCCTTATCTCACTAATTCAAATCTGATTTAATGGAGAGGGTTGACAGCTTTGAGCCGGGATTGAAAATTCCATACAGCTTGGTCAAACTTTCAACCTTGGAGCCTTCCATCAGATAAGCCTTCTCGCAACAGTTTACAACACGAATCGATGCGATTTGAGTTTCGCCTCAAGCAAATGCTTCGCTCGGACTGAATCTATTTGGACTCAACTGGAGCAAGAAAGGGAGACTGCACGTGGAGCACTGATTTGGTAGGGGTGTGATGAATAGACGGACGAATATGCCAACTGCTGGCCAGATATTAAGGCGAGGATTCCAGATCTAGAAGAATTTCATGATTAAATATCAGGGGAACACCATATGAGATACCAAGTTTATCTACAGTTAGTAGATATCAGAAAAAGGATTTGCCACTGCAGAACACAATGTTGACCTGATGAGATATACTACGATTGCAAAATCTTTCTGAGCTTTTCCAGTCTTTGAATTCACGTTTCGCTTCTTCATCTGGCATTGGGTCCAGTTTTACAAACTTGCCTGGGGTAACATCATCTGAGTCCTCACAATGAAAATAAAATTGTGCCACACTAAGATAAACATTTATAAACACAAGCGTTCTCTTGCGTGCACCCTTTCCTCTGCTTGTACAGATTTGACTACAGAGATAAAAAATAAGTGGTGGCTGCGTCGGTTCAGAAACACAAAGGTCGCTCTGATCATGGATGGCCCCAGAAGTGGTATTGTAGCAGAAGGAAGTCCGAACAGAAAGTGTCCGAATGAAGATCTTGCTAATCTCGAGTGCTTCAAATATCTCGAATCACATGAACTCCATGTTCTGGCTTTCAATTTATATCAGAGAGAGAAGGAGAATACACGAAGTTTCAGAAGATCAGAGGCAGAGGCTTTGCAGGATGACAACGTCAGAAAACTGCATGCTCTGATTTCGTTGAAAACATGAAGTTCTTGCAGATACGATCCAGTGTGATGAAATTCGTAGACTTTGAATTCACCTTCCGAAGAAGATTATGAATTCAAAGAGCGGAATTAGGTTGACATTGGTATGTCTCTTACAGTCTCTTATTTTACAGGTCCTCGTTCCGTCGTCCATATTACGTTTGGCATTACTGCACCTGAAGCGACGTGACCTTTCAAAGTATGAGTATCGATGTGCAGCAACTTTCTTTATTCCTGAGAACCAGAAGAAACTCAACTCCTGTTATGGAACAGGCTGCTCAAGCTCAAACTCAGAGCTTGTAGCGAGCTGCAGACAGAACTCGAAGTATCAGTCCAAGCCAATCCACATCTCGTCTTGTAAGAGGACCAGGCACAACGGAAATTTCATTTTCATTGCATGCTCAGGCAGAACTGCGAAATGATAAGAATGGTGTGGCTCTACTACGTCCCAAGCTGAACGAGGGATTCATACAAAATTCAATGGAGGAACAAAGTGTAGGTAATCCGTGCGCTACACTAGATTCGACAGAAGGAGAAAATGTTGATTCCGGTTCGCTCTGAATCCCCTGTCACCAATGCATCGAGATTTTCAGGTTCAGTCTACTTCTGGAGGCCTCATCATCATGTAGCCTGCAGATTCCAGCAGATGTGTAGGCGGCTAAAGGATGGGCAAAGTGCTCAAACTGGTATTTCAGGAAGTTATTGACACCTACCATAAGTTGTCGGCTTTCGTAAAAATCAAGGGGAAGCACATAGTTGACTTTCTGGAGATTCGCTTCATGGATGTACAAAATCCTTCGGAGAACCGCAAATTGTATGTTAGGGCCGTAACTACAATGGACTAGAAATGTTTAAAGAAGCTGGAAACTAGTCTGTCAAGCATCCGAGAAGCACGAGTACAATGGTCGCAAGAGGCACGAATCGTAGGCCGAGAAGAAGCTGTTTCAAGTCTCTGGAGCGAAAGCTTTCGTTCCAGTAGCTGCTTCATTTCATCGTCTGAGAAGTGACGAGTGCATGAAAAGAACCGCACAACAAAACCGAAATCAGATTCACGATGGCAGGGAGGGGGGGTCAGGGCAAGCCATGGCCAGGGCAAAGGCCAGAGCCGTCTGATTCGGATTCGGAGACGGAGACGGAATCGGATGCTGACGAAGGGCAGGATGGAGCTCAGCCGAGGCGTCTGCCACCGCCGCCAAACATTCGTTTTCCAACTGTCAGACCCAGCACCGTCGGCGCAGTTCTGCTGGGAAGGTCTAGGAGTACATCGCAGACTCCAACCAGGAGAGATCGCAGCAGGTCGCCGAGCCGCGCTGAAGCTGCTGCTGCTGCTGCTGCTGCTCCGCCCGCTGCTCCGTCCGCTCGAGCATCGGGATCTAGAGGTGCATCACCAATTAAGACCAGGCTTAGGAGCGCACGTCCGAGGCCGGATGGAGCAGCGGCACCAGCAGCTGCAGATTCTGCTGTTGCCAGCGGACAGCAGCAAACGGACTCGACAAGGACTGCTCGAGCGTCGGGATCTAGAGGTCCATCACCAATTAAATTCAGGCTTAGGAGCGCACGTCCGAGGCCGGATGGAGCAGCGGCACCAGCAGCTGCAGATTCTGCTGTTGCCAGCGGACAGCAGCAAACGGACTCGACAAGGACTGCTCGAGCGTCGGGATCTAGAGGTCCATCACCAATTAAGATCAGGCTTAGGAGCGCACGTCCGAGGCCGGATGGAGCAGCGGCACCAGCAGCTGCAGATTCTGCTGTTGCCAGCGGACAGCAGCAAACGGACTCGACAAGGACTGCTCGAGCGTCGGGATCTAGAGGTCCATCACCAATTCCGACCAGGCCTAGGAGCGCACGTAAGTTGTCTGAAGAGTCGCGAGCAGCAGCAGCAGCTCCAGCTCCAGCTGGTGCCAGCAGTCAACAGCAATCGGCCGCTGGAGCCCCGGCTGCTGAGTCTGTCCAAGGATCAGGGGCTGGAAGTACATCACGTCCTCAGAGCAGGGTTAAGAACAGACCTCCGAAATCGGATCCACCAGCAGCACCAGCTCCTGCTGATGGCAGCTCTCAACAGCCAAGATATCAAACCAGATCTCAAGCAAGAGCCCGAGATCAGACTCCGGCTCGAGGCACAGCAGCATCTGGTCCATCTTCTAAGCGGGACCCGCCGGCATCGTCTGGACGGGTATCGACAGCTCCATCCACCCAAAGAGCAGCTCCAGCTCCAGCTCCAGCTCAAGCTCCAGCTCCCGTGCAATCTCAGCAAGCGAGAGGAAGACAGCCCAAGTCGCCGGCACGAGGCGGAAGTCCTGGACAAAGTTCATCACCGAAGTCTGCAGTGGCTGTTCCAAGAGGCGGCAGTCCGAAAGGAGGAGCAGCAGCAGCAGCAGCGGATGGGGATGATACTGATATGTTGAATTTTGGCTCGGCGGATCTAGAAGAAAATCTTCCACAAGATGCTCTGTATTTCCTTCCTTCCCTCGACCATCTTCCACTCTTCGTGAGTGAAGAGCCGCCGCCTTTCCAGGATTTCCGATTAACCGCACAAGATGTGGCAATAGCGCTGGACGGTGCTCTGATTCAGAACCGGGTCAAGGGCACGCCAGCGGCATCGCCGCGGCCCGACGGAGTGCCGGCGAGAGCGACGTGGTTGGATTCAGTTCTGACCCATGCTCAGACACAGGCAGCGTTGAGCCCACAGCCCGTGGCTCCGCAAATCATGTCACCGCCTCGAGCCGGTGGAGGTGCCGACGGTGCGCCAGTCCTGCCGATTGGATTACAGCCCATGCCTCTGCAAGTGAGGTCACCTGACGGTACCATTGTTACGCCATCCATGGCCGGATCGCCTAGCCGGGTGAGCTCCCCCCCGGCGAGTACAGCCGCGGGCTCGCACGGTACATCCAATTTTCCATCCCCGGGCGGATTGCCTAGCCGGGTGAGCTCACCCCCGGCGAGTACAGCCGGGGGCTCGCACGGTACATCAAATTTTCCATCCCCGGGCGGATCACCTGGCCGGGTGAGCTCGCCCCCGGCGAGTACAGCCGGGGGCTCGCCCGGTATATTAAAGTTTCCATCCCCGGTCGGATCGCCTGGCCCGGTGAGCACCCCCCTGGCGATTACAGCCGGGGGCGCGGACGATGTCGCTGACATGGACGAGGATTTTGACGAGGAGTTCAAGTTGTCGGAGAAGGACTTGACTGATGCTCTGTCATATGCTGACGACCTGGACAATCTGGATCCGCTGATCATGCATGCCCTTCGTCAAGCAGGCCATCCCGCTCCTGGAAGTCCGGGGTGGGAGGAGTTTCTGAAGAGCCGAGGACTGCAGCGAAAAGCTCGAAAGCCTGATACTTGGCAAGCGCAAGATGCTGTTGCTCTTGCATCTGGCGATGCCGGAGGCACTGCCCTTCCGGCATCGACTGACGGACGAGCTCTCGATTCTGGCGATGCCGGAGGCGACGACGCGCAAGCTATGACTGTCGTAGCAGGTCCCGCATCTGGCGATGGTGCATTGACCGTCGAAGGAGCTCTGGGTTTTCGGACTCCGTATCATCACGTCGGGGCCGATCGGCCTCCGGGCTTGCATCCAACCGAAGCCCATATGGTTCAGATGATTGACTGGATGCGGTACCTCGTGGCGATGCAGCGACAGCCGCAGCATTTTCTCCACGCAGAGAACGGGTTGAGGTTGGGCCGAATCGTCCAAGCGTTCAATCGGTCGTGGATGTACTCCGTCGACAGGCTGCAGCTGATCCCTGCGGACTCGGATCTAGACAGAGCGCGTCGTCTGCGCAGGACGGTGCGGTACGAGATGAACGGGATCCAGGACGAGTACCGCGAGGGATTGGTCGACGAGTACGAGCAGGAGATGAGTGGATGGATCTCTTACCTGCGCCAGCTGCGGCGCAGCAATCTGCAGTACTCGAACGAAGAGAGCCGCGTATCGTTCGCGGCTGTGGCCGAAGCCTTTAACGAAGAATTCGACCAGACCGTGCGCGCTCTGCTCGGGGAGGAGGACGCGGAGAATATATTGAATGTGCAGGGCGGCACAGCCGATCTCGATCTCAGCCCCCCGCGAGCCGATCCGGCTCGGAGCCCCCTCCGTACTCACCTTATGGAATCGTTGCTAGCTGCGGCATCCCCACCCAAGGGCCATCTTAGCCCGAAGCTTGCATCCCCACCGCCGACAGTGGAAGCGCAAGACTCTCGACCGGGATCCGCCAAACGGAAGAGGGGGCCGAGCCTGGAAAGCGAGTCCGACAAGCCCGCCGCTAAAGTGCCAGCGCAGGGAAGCCCGGGAGGAGGAGATGGTCCACTTCCCGGTAGTCCCGGTGGAAGTCGAGTGGCTAGTCCCGCTGGAAGTCCTGGAGGAGGAGGTAGTCCTGTTCGAGGGGCTAGTCCGGCTCGAGGGGCTAGTCCCGATGGAGGCAGCCCACTTCGAGTGGCTAGTCCGGTGACAAGTCCTGTAGGAGGAGCTACTCCTGTTCGAGGGGCTAGTCCCGTTGGAAGTACTGGAGGAGGAGGTAGTCCTGTTCGAGGGGCGAGTCCCGATGGAGGTAGTCCACTTCGACCGGCTAGTCCGGTTCAAAGTCCTGTAGGAGGAGCTAGTCCTCTTCGAGTGGCAAGTCCCGTGGGAAGTCCAGGTGGAGTCCCCGGGGGAGTTAGTCCACCTCGAGGGGCGAGTCCAGTGGGAATTCCTGCAGGAGCAGCTAGTCCCGGTCCCGGAGGAGGAAGTCCTGTTCGAGGGGCTAGTCCCGATGGAGGTAGTCCACTTCGACCGGCTAGTCCGGTTCAAGGTCCTGTAGGAGGAGCTAGTCCTCTTCGAGTGGCAAGTCCTGTAGGAAGTCCAGGTGGAGTCCCCGGGGGAGTTAGTCCACCTCGAGGGGCGAGTCCGGTGGGAATTCCTGCGGGAGCAGCTAGTCCCGGTCCCGGTGGAAGTCCAGGTGGAAGTAGCCCACTCAGTTGGGCTAGTCCGTTTGTAGGCCGTCGAGGAATTCCTGCGGGAGCAGCTAGTCCCGGTCCCGGTGGAAGTCCAGGTGGAAGTAGCCCACTCAGTTGGGCTAGTCCGTTTGTAGGCCGTGGAGGAGGGGCTAGTTCCGGTCCCGGGGGAAGTCCGGGTGGAGGTTCCGGAGGATCTAGTCATCCGGGTGCAGGTCCTGCAGGAGGTGGTAGTCCTGGAGCGCCTAATCCCGACGGAGGAGGGGGAGGGGGAGGAGGTAGTCCTCCTCCAGCGGGGAGTCCTGGAGCGCCCTCGAGTCCAGGGAGTTCAGGGGATGAAGTTTACGATGAAGACGCATTGTTCAATGGCTTGATGCTGCACATGAAGATGGACGAATGGACGAGGTATCTGTGCATTATGCGGCATCGACCTCAGCGGCTGTCGCAAGAGGAGACTGCCACGACGCTGGCCAATCTTCTGAACCTCGTGCACACGAAACTCTCTCCCATCGCAGCGACATTGGTCAGGTATTTCCCCACTGTGAACCCGGAGGTAGATATGGGAACGGTTGCCCTTCTGCCGTCGTTAATCAGCCACCGGAATCACATCATACGAGCTGCACTGTTGTCTGCTGGATTCCAGCAAGGCGTCTCCGTAGCTGCCTTGGAGGCTATAGACCAGAATACTATCTCCGCGTGGACTCAGGAGATCGATTCCGTCGCAGACCCCTTCCCTGCCATCGATTCGAAAAACCAACAGAGGTTCGTCATTACGTACCATGGTTTTTACGACGAAATAGCCGATGTCGTAGATCAAATTCTTGGTGGCAGGGGAGAGTTTCTCAAAGAAGCGGAACCCATTCGGAGGGAGATATTTCAGACCCCCCAGCTGCACGCCCAGGTGGACTTACCAGAGCTTCTTCAAGTAGGTGGGGATCATCCCGTACTCAATGACGAGTGGCAAGCCCCTCTAACTACGAAACATATAACGACGCGTAGGGTTGGAAATTTCCCGAGCCTCCCTGACACTTACATTGTAGCAGATGTCGATCCTAGTGACGTATCACATCCTGCATGCGAAAGCCAAGTCGAGCCGCTGTACCGACAAAGAGCTATAGTGAACTTGTTCGATGTTAATGCCGATCGTTTCGCTCTAGCCAAGACTTCAGACAATCTCAGGGACATACACGGGGGTAGGCTTACGAAGAATATCGCGGTCCCACAAGCAATATCTGCCCAAGCTCTGACCGATGAAGCTCAATACCATGTTTGGGCTCTGAAAGAGTTGAAGAGATTGCAACTGGAGGTTTGTCTCTCCGTGATGGGCACTCCCAAATACACCCACATGCCAACCAGCTTGCAAAATGATGTGCGGTTCTACATCATCGCTTATCATAAATTCATTCGAGGCATTGTGGATCACTGCGATCATGAATGCTCTCGAGTGCTAGAGCCTCAACAGTGCTGCTATAACCGAAAACTTGCACCTTTGAACGCCATCATGGATCGCGAAAAGCTGCACAAAAAAACGATGCACAAATTCGTAATCGACATCACAAACGTAGTAACAAAATGGTTGAACAAAACGGGGTCTCACTGTGTTAAATTACCATTCCACGTTATGGAAAAAATAAGAAAATGGAATCGAGATCACCAAGGAAAACCTTATCCTAAAGGAGACGAGTGGGGGCCACTTGTGGCTTCCACAGGAATGCAAAACAATCAGTTGAAATGGATCTTCAGACGTCTTCGCTTAGAGACCGTCGCTGAGAGAGGGTTGGAACGAGCTAGAGAGTTGGTAATAGTCCAAGAGCTGGATGCGATTGGACAAGCGCCCAAAGACCAGCCACTTAAGCCAGCGGTTGAGGCATTTCTAACAGGTTGGATGGAAGCTCATCGCGAGTATCCCTACCCAATACGGTCAGAAAAGGAAACTTTAAGGAAATATGCCAGACTGACTTCGAGAAGGATCCAAACGTGGTTGTCAGATTATCGTAGGAAACATGATCTCGCCGGTACGTGGATAATGAGAGACGCTAATTTGCTAGAAAGGCAAGGGAATGGAAGAGGCATGGATCCAAGATATGGAAAGGTGGGTGCTCCGATTGCAGATCCTCACATAGATTGGGACCGAGATGACTCGAGTACCAGTGAGGATGATTCCGGGTCGCCTCGTGATCCAGCAGCAGGAGGAGATGCAGGAGGAATAGCAGCAGCAGCGGCAGGAGGTGGAGCAGGAGGAATAGCAGCGGCGGCGGCGGCAGGAGGTGGAGCAGGAGGAATAGCAGCAGCGGCGGCGGCGGCAGGAGGAGAAGCAGGAGGAGGTGGAGAAGATTATGCTGATAATATGCTGATAGATGTCGATGACAACGAGCGCCCATTCCCCCAGGCTGAACAGTACGGGGTCACCACCACCATCGATCCTGCTACTTTACAAGAAGCTTTCAGTAACGCAATGCAAGAAGTACCTATGGTAATTGATGGAGGTGACGCTGCTGGTCTTCCGGTTATCGACAAGGCGGCAGACGCAGATCTGGGCTTAGGACCTGCGATTCACGAGGCCATCGAGAAAGCAGCGCAAGAGCGACCGATCGGAGATCAACCTCGGAGGGACAACGATTACGAGGCGTATGCACAGGCAAATCTGCCTGGCGAGACTTTCGTGATTCTCGACGGACAATTTGTTCCTGCGGTCGGCGAGAATGCACCCGAAGACGGCCGAGAGGTCGTACTGTCGAACGTCGGTGCTGGAGGAGGAGGTGGAGCAGATGCGCAGGCCGCCATCGTTGCCGATCCAGGCCGTGCGCCAGATCCCATCCTTCCTGGTGTGGACCCGCATGCACAGCCCCAGCCAGGCCCCATCGTCGTCCAGCTCGTGCGGAGCCCGCTGCTGCAAGCCCGCCATGAGATCCAACAAATGGACGCCCAGGGCCAGCTCCCGGCCGCCATCGCCGACGAGGCCTTGGCTAATCTCCAAAACCAGGAAGCCGAGCCTCCCCCGCCATCGCCCCAGCAGCCGGTCATACTCGACCCCATCCTCCAAGCTGCCCCGGGGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCTACCGGATGGTGGCCATCCCCAGCCCTATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCTATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCTACCGGATGGTGGCCATCCCCAGCCCTATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCCCGCCGGTGCACCTCAAGCCCAGGCGGGCCCCGCTCCCGCACGTCAAGTCGACGACCGTCTGCCAGACCAGGGTCCCTTCGATATGGAACGTCGGCGGAGGTTGCGAATGGAGTGTTGGGAACCCAATGCACGGATGGCAACGGACCTCATGTTTCGAGCCTCTGAAATGATCAAGGCCTGCGTGTCCAAGGTTAATGCCCAAACGATACTGGCCGCACGTACAGGCACCATCACGAGACTTGTCCTAAGTCACCAGGGCTTCGCGAAGAGTCAGCCTGTACATACTTGGGACGATTGCGTGCCCGGCGGCCCTGTAAACGAGTGCTGCTACTCACTGCGATACGGAGAGATAGATAACATCGTGGGGGAGCAACAACGCTTGGCTGCCACCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCCGCCGGTGCACCTCAAGCCCAGGCGGGCCCCGCTCCCGCACGTCAAGTCGACGACCGTCTGCCAGACCAGGGTCCCTTCGATATGGAACGTCGGCGGAGGTTGCGAATGGAGTGTTGGGAACCCAATGCACGGATGGCAACGGACCTCATGTTTCGAGCCTCTGAAATGATCAAGGCCTGCGTGTCCAAGGTTAATGCCCAAACGATACTGGCCGCACGTACAGGCACCATCACGAGACTTGTCCTAAGTCACCAGGGCTTCGCGAAGAGTCAGCCTGTACATACTTGGGACGATTGCGTGCCCGGCGGCCCTGTAAACGAGTGCTGCTACTCACTGCGATACGGAGAGATAGATAACATCGTGGGGGAGCAACAACGCTTGGCTGCCAGTCTGTTTATGTTCGATGTGGAAGTTTTCAGGTTGGTGGGGATAGCATCCAATATACAGAAAGGGAAATGTAATCGAGTGATGAGACTAAATATGCCAGGATGGGTCGTCAGGTGGATGGACGAGTGGTGCGCGGCAAACGTTGCAGTACACCCCCTTACAGGAAAACAAATGTTGGCAGCAATTGAAGCTGAAATTGGACTGACCTATGTACATGCAATTTCATTTATCTACAAGTGGAAGGCGGAATGCCTGAATGTTAAGGTTATTCCGGCTATCACTATGGGACAAATGGAAGAGGCTCAGCGAACTTACATGAGAAATTGGTTTGAAGAGCATGTACAACTTCCTCACCCGACCAATGCGGAGCTTGATGTCATGTGTCGAGAAACGGGTTTATCAGCCATAAAGGTATTAAGATGGTTGGACAATTACAGATTAACAAACAATTTTAGAATGACTGGCATCGATGGTCATGGACGGTCTATGTTTAGACCTATCCAGCCAGGTGATGAAGCAGCAATTGAGAGAATTACGAAAAGGTGA

CDS

>Mapoly0012s0090.1
ATGGCAGGGAGGGGGGGTCAGGGCAAGCCATGGCCAGGGCAAAGGCCAGAGCCGTCTGATTCGGATTCGGAGACGGAGACGGAATCGGATGCTGACGAAGGGCAGGATGGAGCTCAGCCGAGGCGTCTGCCACCGCCGCCAAACATTCGTTTTCCAACTGTCAGACCCAGCACCGTCGGCGCAGTTCTGCTGGGAAGGTCTAGGAGTACATCGCAGACTCCAACCAGGAGAGATCGCAGCAGGTCGCCGAGCCGCGCTGAAGCTGCTGCTGCTGCTGCTGCTGCTCCGCCCGCTGCTCCGTCCGCTCGAGCATCGGGATCTAGAGGTGCATCACCAATTAAGACCAGGCTTAGGAGCGCACGTCCGAGGCCGGATGGAGCAGCGGCACCAGCAGCTGCAGATTCTGCTGTTGCCAGCGGACAGCAGCAAACGGACTCGACAAGGACTGCTCGAGCGTCGGGATCTAGAGGTCCATCACCAATTAAATTCAGGCTTAGGAGCGCACGTCCGAGGCCGGATGGAGCAGCGGCACCAGCAGCTGCAGATTCTGCTGTTGCCAGCGGACAGCAGCAAACGGACTCGACAAGGACTGCTCGAGCGTCGGGATCTAGAGGTCCATCACCAATTAAGATCAGGCTTAGGAGCGCACGTCCGAGGCCGGATGGAGCAGCGGCACCAGCAGCTGCAGATTCTGCTGTTGCCAGCGGACAGCAGCAAACGGACTCGACAAGGACTGCTCGAGCGTCGGGATCTAGAGGTCCATCACCAATTCCGACCAGGCCTAGGAGCGCACGTAAGTTGTCTGAAGAGTCGCGAGCAGCAGCAGCAGCTCCAGCTCCAGCTGGTGCCAGCAGTCAACAGCAATCGGCCGCTGGAGCCCCGGCTGCTGAGTCTGTCCAAGGATCAGGGGCTGGAAGTACATCACGTCCTCAGAGCAGGGTTAAGAACAGACCTCCGAAATCGGATCCACCAGCAGCACCAGCTCCTGCTGATGGCAGCTCTCAACAGCCAAGATATCAAACCAGATCTCAAGCAAGAGCCCGAGATCAGACTCCGGCTCGAGGCACAGCAGCATCTGGTCCATCTTCTAAGCGGGACCCGCCGGCATCGTCTGGACGGGTATCGACAGCTCCATCCACCCAAAGAGCAGCTCCAGCTCCAGCTCCAGCTCAAGCTCCAGCTCCCGTGCAATCTCAGCAAGCGAGAGGAAGACAGCCCAAGTCGCCGGCACGAGGCGGAAGTCCTGGACAAAGTTCATCACCGAAGTCTGCAGTGGCTGTTCCAAGAGGCGGCAGTCCGAAAGGAGGAGCAGCAGCAGCAGCAGCGGATGGGGATGATACTGATATGTTGAATTTTGGCTCGGCGGATCTAGAAGAAAATCTTCCACAAGATGCTCTGTATTTCCTTCCTTCCCTCGACCATCTTCCACTCTTCGTGAGTGAAGAGCCGCCGCCTTTCCAGGATTTCCGATTAACCGCACAAGATGTGGCAATAGCGCTGGACGGTGCTCTGATTCAGAACCGGGTCAAGGGCACGCCAGCGGCATCGCCGCGGCCCGACGGAGTGCCGGCGAGAGCGACGTGGTTGGATTCAGTTCTGACCCATGCTCAGACACAGGCAGCGTTGAGCCCACAGCCCGTGGCTCCGCAAATCATGTCACCGCCTCGAGCCGGTGGAGGTGCCGACGGTGCGCCAGTCCTGCCGATTGGATTACAGCCCATGCCTCTGCAAGTGAGGTCACCTGACGGTACCATTGTTACGCCATCCATGGCCGGATCGCCTAGCCGGGTGAGCTCCCCCCCGGCGAGTACAGCCGCGGGCTCGCACGGTACATCCAATTTTCCATCCCCGGGCGGATTGCCTAGCCGGGTGAGCTCACCCCCGGCGAGTACAGCCGGGGGCTCGCACGGTACATCAAATTTTCCATCCCCGGGCGGATCACCTGGCCGGGTGAGCTCGCCCCCGGCGAGTACAGCCGGGGGCTCGCCCGGTATATTAAAGTTTCCATCCCCGGTCGGATCGCCTGGCCCGGTGAGCACCCCCCTGGCGATTACAGCCGGGGGCGCGGACGATGTCGCTGACATGGACGAGGATTTTGACGAGGAGTTCAAGTTGTCGGAGAAGGACTTGACTGATGCTCTGTCATATGCTGACGACCTGGACAATCTGGATCCGCTGATCATGCATGCCCTTCGTCAAGCAGGCCATCCCGCTCCTGGAAGTCCGGGGTGGGAGGAGTTTCTGAAGAGCCGAGGACTGCAGCGAAAAGCTCGAAAGCCTGATACTTGGCAAGCGCAAGATGCTGTTGCTCTTGCATCTGGCGATGCCGGAGGCACTGCCCTTCCGGCATCGACTGACGGACGAGCTCTCGATTCTGGCGATGCCGGAGGCGACGACGCGCAAGCTATGACTGTCGTAGCAGGTCCCGCATCTGGCGATGGTGCATTGACCGTCGAAGGAGCTCTGGGTTTTCGGACTCCGTATCATCACGTCGGGGCCGATCGGCCTCCGGGCTTGCATCCAACCGAAGCCCATATGGTTCAGATGATTGACTGGATGCGGTACCTCGTGGCGATGCAGCGACAGCCGCAGCATTTTCTCCACGCAGAGAACGGGTTGAGGTTGGGCCGAATCGTCCAAGCGTTCAATCGGTCGTGGATGTACTCCGTCGACAGGCTGCAGCTGATCCCTGCGGACTCGGATCTAGACAGAGCGCGTCGTCTGCGCAGGACGGTGCGGTACGAGATGAACGGGATCCAGGACGAGTACCGCGAGGGATTGGTCGACGAGTACGAGCAGGAGATGAGTGGATGGATCTCTTACCTGCGCCAGCTGCGGCGCAGCAATCTGCAGTACTCGAACGAAGAGAGCCGCGTATCGTTCGCGGCTGTGGCCGAAGCCTTTAACGAAGAATTCGACCAGACCGTGCGCGCTCTGCTCGGGGAGGAGGACGCGGAGAATATATTGAATGTGCAGGGCGGCACAGCCGATCTCGATCTCAGCCCCCCGCGAGCCGATCCGGCTCGGAGCCCCCTCCGTACTCACCTTATGGAATCGTTGCTAGCTGCGGCATCCCCACCCAAGGGCCATCTTAGCCCGAAGCTTGCATCCCCACCGCCGACAGTGGAAGCGCAAGACTCTCGACCGGGATCCGCCAAACGGAAGAGGGGGCCGAGCCTGGAAAGCGAGTCCGACAAGCCCGCCGCTAAAGTGCCAGCGCAGGGAAGCCCGGGAGGAGGAGATGGTCCACTTCCCGGTAGTCCCGGTGGAAGTCGAGTGGCTAGTCCCGCTGGAAGTCCTGGAGGAGGAGGTAGTCCTGTTCGAGGGGCTAGTCCGGCTCGAGGGGCTAGTCCCGATGGAGGCAGCCCACTTCGAGTGGCTAGTCCGGTGACAAGTCCTGTAGGAGGAGCTACTCCTGTTCGAGGGGCTAGTCCCGTTGGAAGTACTGGAGGAGGAGGTAGTCCTGTTCGAGGGGCGAGTCCCGATGGAGGTAGTCCACTTCGACCGGCTAGTCCGGTTCAAAGTCCTGTAGGAGGAGCTAGTCCTCTTCGAGTGGCAAGTCCCGTGGGAAGTCCAGGTGGAGTCCCCGGGGGAGTTAGTCCACCTCGAGGGGCGAGTCCAGTGGGAATTCCTGCAGGAGCAGCTAGTCCCGGTCCCGGAGGAGGAAGTCCTGTTCGAGGGGCTAGTCCCGATGGAGGTAGTCCACTTCGACCGGCTAGTCCGGTTCAAGGTCCTGTAGGAGGAGCTAGTCCTCTTCGAGTGGCAAGTCCTGTAGGAAGTCCAGGTGGAGTCCCCGGGGGAGTTAGTCCACCTCGAGGGGCGAGTCCGGTGGGAATTCCTGCGGGAGCAGCTAGTCCCGGTCCCGGTGGAAGTCCAGGTGGAAGTAGCCCACTCAGTTGGGCTAGTCCGTTTGTAGGCCGTCGAGGAATTCCTGCGGGAGCAGCTAGTCCCGGTCCCGGTGGAAGTCCAGGTGGAAGTAGCCCACTCAGTTGGGCTAGTCCGTTTGTAGGCCGTGGAGGAGGGGCTAGTTCCGGTCCCGGGGGAAGTCCGGGTGGAGGTTCCGGAGGATCTAGTCATCCGGGTGCAGGTCCTGCAGGAGGTGGTAGTCCTGGAGCGCCTAATCCCGACGGAGGAGGGGGAGGGGGAGGAGGTAGTCCTCCTCCAGCGGGGAGTCCTGGAGCGCCCTCGAGTCCAGGGAGTTCAGGGGATGAAGTTTACGATGAAGACGCATTGTTCAATGGCTTGATGCTGCACATGAAGATGGACGAATGGACGAGGTATCTGTGCATTATGCGGCATCGACCTCAGCGGCTGTCGCAAGAGGAGACTGCCACGACGCTGGCCAATCTTCTGAACCTCGTGCACACGAAACTCTCTCCCATCGCAGCGACATTGGTCAGGTATTTCCCCACTGTGAACCCGGAGGTAGATATGGGAACGGTTGCCCTTCTGCCGTCGTTAATCAGCCACCGGAATCACATCATACGAGCTGCACTGTTGTCTGCTGGATTCCAGCAAGGCGTCTCCGTAGCTGCCTTGGAGGCTATAGACCAGAATACTATCTCCGCGTGGACTCAGGAGATCGATTCCGTCGCAGACCCCTTCCCTGCCATCGATTCGAAAAACCAACAGAGGTTCGTCATTACGTACCATGGTTTTTACGACGAAATAGCCGATGTCGTAGATCAAATTCTTGGTGGCAGGGGAGAGTTTCTCAAAGAAGCGGAACCCATTCGGAGGGAGATATTTCAGACCCCCCAGCTGCACGCCCAGGTGGACTTACCAGAGCTTCTTCAAGTAGGTGGGGATCATCCCGTACTCAATGACGAGTGGCAAGCCCCTCTAACTACGAAACATATAACGACGCGTAGGGTTGGAAATTTCCCGAGCCTCCCTGACACTTACATTGTAGCAGATGTCGATCCTAGTGACGTATCACATCCTGCATGCGAAAGCCAAGTCGAGCCGCTGTACCGACAAAGAGCTATAGTGAACTTGTTCGATGTTAATGCCGATCGTTTCGCTCTAGCCAAGACTTCAGACAATCTCAGGGACATACACGGGGGTAGGCTTACGAAGAATATCGCGGTCCCACAAGCAATATCTGCCCAAGCTCTGACCGATGAAGCTCAATACCATGTTTGGGCTCTGAAAGAGTTGAAGAGATTGCAACTGGAGGTTTGTCTCTCCGTGATGGGCACTCCCAAATACACCCACATGCCAACCAGCTTGCAAAATGATGTGCGGTTCTACATCATCGCTTATCATAAATTCATTCGAGGCATTGTGGATCACTGCGATCATGAATGCTCTCGAGTGCTAGAGCCTCAACAGTGCTGCTATAACCGAAAACTTGCACCTTTGAACGCCATCATGGATCGCGAAAAGCTGCACAAAAAAACGATGCACAAATTCGTAATCGACATCACAAACGTAGTAACAAAATGGTTGAACAAAACGGGGTCTCACTGTGTTAAATTACCATTCCACGTTATGGAAAAAATAAGAAAATGGAATCGAGATCACCAAGGAAAACCTTATCCTAAAGGAGACGAGTGGGGGCCACTTGTGGCTTCCACAGGAATGCAAAACAATCAGTTGAAATGGATCTTCAGACGTCTTCGCTTAGAGACCGTCGCTGAGAGAGGGTTGGAACGAGCTAGAGAGTTGGTAATAGTCCAAGAGCTGGATGCGATTGGACAAGCGCCCAAAGACCAGCCACTTAAGCCAGCGGTTGAGGCATTTCTAACAGGTTGGATGGAAGCTCATCGCGAGTATCCCTACCCAATACGGTCAGAAAAGGAAACTTTAAGGAAATATGCCAGACTGACTTCGAGAAGGATCCAAACGTGGTTGTCAGATTATCGTAGGAAACATGATCTCGCCGGTACGTGGATAATGAGAGACGCTAATTTGCTAGAAAGGCAAGGGAATGGAAGAGGCATGGATCCAAGATATGGAAAGGTGGGTGCTCCGATTGCAGATCCTCACATAGATTGGGACCGAGATGACTCGAGTACCAGTGAGGATGATTCCGGGTCGCCTCGTGATCCAGCAGCAGGAGGAGATGCAGGAGGAATAGCAGCAGCAGCGGCAGGAGGTGGAGCAGGAGGAATAGCAGCGGCGGCGGCGGCAGGAGGTGGAGCAGGAGGAATAGCAGCAGCGGCGGCGGCGGCAGGAGGAGAAGCAGGAGGAGGTGGAGAAGATTATGCTGATAATATGCTGATAGATGTCGATGACAACGAGCGCCCATTCCCCCAGGCTGAACAGTACGGGGTCACCACCACCATCGATCCTGCTACTTTACAAGAAGCTTTCAGTAACGCAATGCAAGAAGTACCTATGGTAATTGATGGAGGTGACGCTGCTGGTCTTCCGGTTATCGACAAGGCGGCAGACGCAGATCTGGGCTTAGGACCTGCGATTCACGAGGCCATCGAGAAAGCAGCGCAAGAGCGACCGATCGGAGATCAACCTCGGAGGGACAACGATTACGAGGCGTATGCACAGGCAAATCTGCCTGGCGAGACTTTCGTGATTCTCGACGGACAATTTGTTCCTGCGGTCGGCGAGAATGCACCCGAAGACGGCCGAGAGGTCGTACTGTCGAACGTCGGTGCTGGAGGAGGAGGTGGAGCAGATGCGCAGGCCGCCATCGTTGCCGATCCAGGCCGTGCGCCAGATCCCATCCTTCCTGGTGTGGACCCGCATGCACAGCCCCAGCCAGGCCCCATCGTCGTCCAGCTCGTGCGGAGCCCGCTGCTGCAAGCCCGCCATGAGATCCAACAAATGGACGCCCAGGGCCAGCTCCCGGCCGCCATCGCCGACGAGGCCTTGGCTAATCTCCAAAACCAGGAAGCCGAGCCTCCCCCGCCATCGCCCCAGCAGCCGGTCATACTCGACCCCATCCTCCAAGCTGCCCCGGGGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCTACCGGATGGTGGCCATCCCCAGCCCTATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCTATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCTACCGGATGGTGGCCATCCCCAGCCCTATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGATGGTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCTCCGGCTGCTGGCCATCCCCAGCCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCCCGCCGGTGCACCTCAAGCCCAGGCGGGCCCCGCTCCCGCACGTCAAGTCGACGACCGTCTGCCAGACCAGGGTCCCTTCGATATGGAACGTCGGCGGAGGTTGCGAATGGAGTGTTGGGAACCCAATGCACGGATGGCAACGGACCTCATGTTTCGAGCCTCTGAAATGATCAAGGCCTGCGTGTCCAAGGTTAATGCCCAAACGATACTGGCCGCACGTACAGGCACCATCACGAGACTTGTCCTAAGTCACCAGGGCTTCGCGAAGAGTCAGCCTGTACATACTTGGGACGATTGCGTGCCCGGCGGCCCTGTAAACGAGTGCTGCTACTCACTGCGATACGGAGAGATAGATAACATCGTGGGGGAGCAACAACGCTTGGCTGCCACCCCATGCCGGTTCTCCTCCACCGGCTGCTGGCCATCCCCAGCCCCCGCCGGTGCACCTCAAGCCCAGGCGGGCCCCGCTCCCGCACGTCAAGTCGACGACCGTCTGCCAGACCAGGGTCCCTTCGATATGGAACGTCGGCGGAGGTTGCGAATGGAGTGTTGGGAACCCAATGCACGGATGGCAACGGACCTCATGTTTCGAGCCTCTGAAATGATCAAGGCCTGCGTGTCCAAGGTTAATGCCCAAACGATACTGGCCGCACGTACAGGCACCATCACGAGACTTGTCCTAAGTCACCAGGGCTTCGCGAAGAGTCAGCCTGTACATACTTGGGACGATTGCGTGCCCGGCGGCCCTGTAAACGAGTGCTGCTACTCACTGCGATACGGAGAGATAGATAACATCGTGGGGGAGCAACAACGCTTGGCTGCCAGTCTGTTTATGTTCGATGTGGAAGTTTTCAGGTTGGTGGGGATAGCATCCAATATACAGAAAGGGAAATGTAATCGAGTGATGAGACTAAATATGCCAGGATGGGTCGTCAGGTGGATGGACGAGTGGTGCGCGGCAAACGTTGCAGTACACCCCCTTACAGGAAAACAAATGTTGGCAGCAATTGAAGCTGAAATTGGACTGACCTATGTACATGCAATTTCATTTATCTACAAGTGGAAGGCGGAATGCCTGAATGTTAAGGTTATTCCGGCTATCACTATGGGACAAATGGAAGAGGCTCAGCGAACTTACATGAGAAATTGGTTTGAAGAGCATGTACAACTTCCTCACCCGACCAATGCGGAGCTTGATGTCATGTGTCGAGAAACGGGTTTATCAGCCATAAAGGTATTAAGATGGTTGGACAATTACAGATTAACAAACAATTTTAGAATGACTGGCATCGATGGTCATGGACGGTCTATGTTTAGACCTATCCAGCCAGGTGATGAAGCAGCAATTGAGAGAATTACGAAAAGGTGA

Protein

>Mapoly0012s0090.1
MAGRGGQGKPWPGQRPEPSDSDSETETESDADEGQDGAQPRRLPPPPNIRFPTVRPSTVGAVLLGRSRSTSQTPTRRDRSRSPSRAEAAAAAAAAPPAAPSARASGSRGASPIKTRLRSARPRPDGAAAPAAADSAVASGQQQTDSTRTARASGSRGPSPIKFRLRSARPRPDGAAAPAAADSAVASGQQQTDSTRTARASGSRGPSPIKIRLRSARPRPDGAAAPAAADSAVASGQQQTDSTRTARASGSRGPSPIPTRPRSARKLSEESRAAAAAPAPAGASSQQQSAAGAPAAESVQGSGAGSTSRPQSRVKNRPPKSDPPAAPAPADGSSQQPRYQTRSQARARDQTPARGTAASGPSSKRDPPASSGRVSTAPSTQRAAPAPAPAQAPAPVQSQQARGRQPKSPARGGSPGQSSSPKSAVAVPRGGSPKGGAAAAAADGDDTDMLNFGSADLEENLPQDALYFLPSLDHLPLFVSEEPPPFQDFRLTAQDVAIALDGALIQNRVKGTPAASPRPDGVPARATWLDSVLTHAQTQAALSPQPVAPQIMSPPRAGGGADGAPVLPIGLQPMPLQVRSPDGTIVTPSMAGSPSRVSSPPASTAAGSHGTSNFPSPGGLPSRVSSPPASTAGGSHGTSNFPSPGGSPGRVSSPPASTAGGSPGILKFPSPVGSPGPVSTPLAITAGGADDVADMDEDFDEEFKLSEKDLTDALSYADDLDNLDPLIMHALRQAGHPAPGSPGWEEFLKSRGLQRKARKPDTWQAQDAVALASGDAGGTALPASTDGRALDSGDAGGDDAQAMTVVAGPASGDGALTVEGALGFRTPYHHVGADRPPGLHPTEAHMVQMIDWMRYLVAMQRQPQHFLHAENGLRLGRIVQAFNRSWMYSVDRLQLIPADSDLDRARRLRRTVRYEMNGIQDEYREGLVDEYEQEMSGWISYLRQLRRSNLQYSNEESRVSFAAVAEAFNEEFDQTVRALLGEEDAENILNVQGGTADLDLSPPRADPARSPLRTHLMESLLAAASPPKGHLSPKLASPPPTVEAQDSRPGSAKRKRGPSLESESDKPAAKVPAQGSPGGGDGPLPGSPGGSRVASPAGSPGGGGSPVRGASPARGASPDGGSPLRVASPVTSPVGGATPVRGASPVGSTGGGGSPVRGASPDGGSPLRPASPVQSPVGGASPLRVASPVGSPGGVPGGVSPPRGASPVGIPAGAASPGPGGGSPVRGASPDGGSPLRPASPVQGPVGGASPLRVASPVGSPGGVPGGVSPPRGASPVGIPAGAASPGPGGSPGGSSPLSWASPFVGRRGIPAGAASPGPGGSPGGSSPLSWASPFVGRGGGASSGPGGSPGGGSGGSSHPGAGPAGGGSPGAPNPDGGGGGGGGSPPPAGSPGAPSSPGSSGDEVYDEDALFNGLMLHMKMDEWTRYLCIMRHRPQRLSQEETATTLANLLNLVHTKLSPIAATLVRYFPTVNPEVDMGTVALLPSLISHRNHIIRAALLSAGFQQGVSVAALEAIDQNTISAWTQEIDSVADPFPAIDSKNQQRFVITYHGFYDEIADVVDQILGGRGEFLKEAEPIRREIFQTPQLHAQVDLPELLQVGGDHPVLNDEWQAPLTTKHITTRRVGNFPSLPDTYIVADVDPSDVSHPACESQVEPLYRQRAIVNLFDVNADRFALAKTSDNLRDIHGGRLTKNIAVPQAISAQALTDEAQYHVWALKELKRLQLEVCLSVMGTPKYTHMPTSLQNDVRFYIIAYHKFIRGIVDHCDHECSRVLEPQQCCYNRKLAPLNAIMDREKLHKKTMHKFVIDITNVVTKWLNKTGSHCVKLPFHVMEKIRKWNRDHQGKPYPKGDEWGPLVASTGMQNNQLKWIFRRLRLETVAERGLERARELVIVQELDAIGQAPKDQPLKPAVEAFLTGWMEAHREYPYPIRSEKETLRKYARLTSRRIQTWLSDYRRKHDLAGTWIMRDANLLERQGNGRGMDPRYGKVGAPIADPHIDWDRDDSSTSEDDSGSPRDPAAGGDAGGIAAAAAGGGAGGIAAAAAAGGGAGGIAAAAAAAGGEAGGGGEDYADNMLIDVDDNERPFPQAEQYGVTTTIDPATLQEAFSNAMQEVPMVIDGGDAAGLPVIDKAADADLGLGPAIHEAIEKAAQERPIGDQPRRDNDYEAYAQANLPGETFVILDGQFVPAVGENAPEDGREVVLSNVGAGGGGGADAQAAIVADPGRAPDPILPGVDPHAQPQPGPIVVQLVRSPLLQARHEIQQMDAQGQLPAAIADEALANLQNQEAEPPPPSPQQPVILDPILQAAPGDGGHPQPHAGSPPPAAGHPQPHAGSPLPDGGHPQPYAGSPPPAAGHPQPHAGSPPPDGGHPQPYAGSPPPAAGHPQPHAGSPPPDGGHPQPHAGSPPPAAGSPPPAAGHPQPHAGSPLPDGGHPQPYAGSPPPAAGHPQPHAGSPPPDGGHPQPHAGSPPPAAGHPQPHAGSPPPDGGHPQPHAGSPPPAAGSPPPAAGHPQPHAGSPPPAAGHPQPHAGSPPPAAGHPQPPAGAPQAQAGPAPARQVDDRLPDQGPFDMERRRRLRMECWEPNARMATDLMFRASEMIKACVSKVNAQTILAARTGTITRLVLSHQGFAKSQPVHTWDDCVPGGPVNECCYSLRYGEIDNIVGEQQRLAATPCRFSSTGCWPSPAPAGAPQAQAGPAPARQVDDRLPDQGPFDMERRRRLRMECWEPNARMATDLMFRASEMIKACVSKVNAQTILAARTGTITRLVLSHQGFAKSQPVHTWDDCVPGGPVNECCYSLRYGEIDNIVGEQQRLAASLFMFDVEVFRLVGIASNIQKGKCNRVMRLNMPGWVVRWMDEWCAANVAVHPLTGKQMLAAIEAEIGLTYVHAISFIYKWKAECLNVKVIPAITMGQMEEAQRTYMRNWFEEHVQLPHPTNAELDVMCRETGLSAIKVLRWLDNYRLTNNFRMTGIDGHGRSMFRPIQPGDEAAIERITKR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>