Mapoly0012s0172



Description

CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
OrthoMCL OG5_156187
PFAM PF00170 BZIP transcription factor
PFAM PF12498 Basic leucine-zipper C terminal
PANTHER PTHR22952 CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED
PANTHER PTHR22952:SF90

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP3 transcription factor, bZIP Mapoly0012s0172.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0012s0172.1 scaffold_12:1945355..1950835  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0012s0172.1  

Gene structure:

mRNA scaffold_12:1945355..1950835  ( + strand )
five_prime_UTR scaffold_12:1945355..1946130  ( + strand )
five_prime_UTR scaffold_12:1946510..1946892  ( + strand )
CDS scaffold_12:1946893..1947447  ( + strand )
CDS scaffold_12:1947684..1947774  ( + strand )
CDS scaffold_12:1948114..1948321  ( + strand )
CDS scaffold_12:1948794..1948869  ( + strand )
CDS scaffold_12:1949108..1949233  ( + strand )
CDS scaffold_12:1949404..1949799  ( + strand )
three_prime_UTR scaffold_12:1949800..1950835  ( + strand )

Sequences:

Gene

>Mapoly0012s0172.1
GGCGGGCGGGCTGGCGGGCGGGTTTGGATTTAGGGCGGCCGCGAAGGCCCAAGGGGCGAAATTGAGGCTGTGGTTGAGTCTGTCCCATGTTGTTGACTGACTGACTGACTGACTGACTACTGACCGAGTGAATGAGAGGTCGGGCGGCGTCGTCGACTATTGTTGTTGTTGTTGTAGCGCGAGATGAGTTGAGTACTTGCGCGGTACATTGGCAAAGCGTGAAATCTCGCTCGCCATCGCGAAAAGCTGGGCTGTAAATTCCGACGCCTTCTCAGGCGGAAGCTTTCGCTCCTTTCGCTCCGTGCATAGTCGTACGAGTGACAGCCAGCGAGCCCTCGTTCGTTGTTCAGTGTCGACGGTTTTTTTGGTTGGGATTTTTTGGTAGGATAGCAGAGCAGAGACGGGTTTTTCGTTGGTCGGCATCGAAGCCCCGAGCGATTTGGAACGAGAAAGTAGGCGTGATATTCTCTGCCTTTTTTTAATGCGGCGAAAGGTCGAAATCGGTGTTTTGTGCCTGGGAAAGCTCTGGCGATTTGCCGTCTTGCAGCGTGGGCAGCGAACTGCGGTTTCTGCAGCGTGAGACTGCGTGTCTAGGGTTCTTCGAGTTCGGTCGGTGGATTGATTGATTGTTGGTCGGAGCGGTTCGTTCTGAGCCCCTGTACGCGTTTCTTTCGAGGGTTTGCACCTCGTTGGCGCCTTGTGTATGGCAGGTAGTCTTCTGTCTTCCGCAAATTGGAGACGAGCAGCTGGTGGGCAAGAGAGCACCATAGGTTCAGGTAATTCAGATAGTTCGAATATTGGTCACGCATGCTTGTCCTGAAACTACTTCAATGTCGCTGAGTCTTCTGGAAGAGTGAATATTCGGTTAGTTCGGAATCCTTGCCGTATTTGGTGATCATTGCAGTTTTTCGTGCGAATTCCTCGAAGCCATTGTTCTTACCGTGGTTCCTACGAATTAAGGTGCATTTGGCATTTTGTGCGATCACCGTCTTGACATAGTGTCATTTACTACGTCCCTCTGGGACCTTATGCACGGGAAAGATTCTCGTTCTGCAATTTATGCTTCTCTCCAAGCTCGTTTCTCTTGTATCCCGCCTGCATGTTTTGTCGACAGGAGTTGCATCTTACTCCTTCGCGGCGTGCTCCGTATTGCAGAAGTGACGACAGAAAGCGACGAACAAGAGAGTGATCAAACTTTTTCCAGTCAGTAACAATTGGATTTCGTTTCAGTAGCACTGAGAACAACCTAGCACTTAGACTCTTGTGCCAAGGACAGCAGTGCTTCAAATCATCCCTTGGGAGGTCCTAGCTGGAAACATGCGTGCACGGCTAGGTGATACCGTCTGATTCACACTCCATAAGCACTCTTTAAACTCGAATTCCCCACAGAATCGAACGCTGGACCATCCAGTTGGTGTCCTTGTCGGATGAGAAAAGACTGGCGCAACAATTAGACTAGAATTCCAGGTTTTTTGGTAGCTGAATGTTCCAACGGGACAACCACTTGTCTGAGGCTGGTAACAGAACTTCAAACTACTATGGAACGTGTTTTTTCAGTAGATGATATATTAGGTACGTTTTGGAAACTGGATACTCAGAGTGGTGATCAAGCCAGTAGTACGGGAGCAGTCAATGGTACTGGCGTTTTAGGAAATGGAGGAAATGGTTATAACCCGGGCATGAACAGAAGTGCCTCAGAGTGGGCGTTTCAAGAGTTTCTTAAGGAGCATACTCAGGCCTCGGGTCTTCAATCCCGAAATGATAGCCAGGTGTTTATGATATCCGAGGAAGAAGCAGGAGAGAAAGAACTTCCTCCTTCGCAAGACAAGGAGTGTGTTGAGGAGCAAAAGGAACCAGATGTGATAAGCATTCCTGGATTGAAGGAGGAGGTAGACGAGAGTAGTTATACCGCGTCCAATCAAAAGGCAGAAGATCCGCTTGAGCAGCCTGAATTGAAAGTCGCTGTGAATCCTCTATTCTCAGGGCTGCGAGATGAAGTTCCAGCAGCGCCAGCCAGTAGTGATCCTCGGGAGTATGAGCACTTCCTCAAACGTCGTTTGGACATTGCTTGTGCCGCGGTCGCCATGTCTCGGGTATGTTTTATTGACAGCAATGATGTCAGTTGTGTTGGCCGGGATACCAACTCTCATGAGTTAGAATTTGTACCTCTAGAGTTATTTTGTGGAGAAAGAGCTGTTTTAGACTCCCGTGCATTGAAGGTTCCAAGTTGAAGGAGGTTAGAGGCGAAACCCTTTCTCGTGTCTAGAATGCCGGGTGTATACGTTGGAGAATGATCGTGACACAACATATTTATTTGCTTTCCCCACAGGCAACTGGGCTTGGGTCTCCGAAGATTGCTGGGAACCTGTCGCTGCAACAAGCCGTGCCTCAAGGAAAGGGAGCAGCCCCCGGCCTTCTAGGTACATTTCAATGAATTTTGCTGCAAAGTCTTTACTTCTCATGCAGCCCTTGGTCGTTCTGGCGATCATGTCTAGATGCTTGGAACAAAAAGCAGAGATTTTGTATGTAACTTCTGGTCTCTAGTAACTTCCAGTGTTTCGTACAAGGTCTCGCTTGTTGAGACAGCGGTAGGTATGCTCCATGATAGTTTGAGGTTTAACCTTGAAACCTTTGATTGTGGTTTACTTCCTCCAGTGTCTGAGATATAAGGGTGTTTGGAGTAGGTGATTTATCTCAGGAGCTTAAAAAGTCGGGAATCTGATTTGGGATGGTCGATTGGCGGGTGGAGTTTTCTCCAGGTGCTGACGTTGCAGCCAATGGAAGTCACGTCAGGGGTCCCGTCGGAATTCCGGCGCTTCCCCCGAAACCTGACAGTCTCGCACCAGTGAGCAGCGCAAAGCCTACGACCAGTGGTTCATCAAGAGAGCAATCAGATGACGAGGACGGGGATGACGGCGTGGTGAACGATCAAAATTTGGAGCCGGGGGATCTGAAACGCGTGAAACGGTAATCCGCTCAACCTGCACTGTTCGTCAGCTTGGTTTTCAGTATCGTGAGAACTTTGCTCAACGAAGGGTAGTTTCGCGAGACCACTCTACAGTATGTCTCCCGGATTTACATAATTTGAACCTTCATGCTACACTCTGTATCCTTATTTACTACATATTATAAAATTTCGCCGTCTGGTTTCTTTATTCTCTCAGCCTACATGTGGTTCGGTGATCCATCTTCCCGCCCAAGTTATTATCGGTGTCAATTTCACCGCAGTCTTGCTCTTGGTTTTCATCGGAGTGTGCTCTTCAAACCAAGAGCACAATGTTAAGTTTGTACTGAATTAGATATAGCTATAAGTCGTTTTCAAGAACCATCTCCGTGACGTAGCCTGTCTATCTCTTCCGGCTTGATGATAGTTTCGAATCGTGGACTGTTAGCATGAAGGCAATTGGTTGAGTAACTTTCAATGTCGGTGATGATTCAGGATGCTGTCCAACAGAGAATCTGCCAGACGCTCGAGAAGAAGAAAGCAAGCCCACTTAAGCGAGTTGGAGACACAGGTACTCGTCAACCGCCCCCATTTGTATCCGGCCTGCACCTCCTGCTTGCACCTTGTTTTGAGTACGCGGGAGAAATCATAGATACGACAGATCATGACCTGGAAATGTTTCCTGGATACGTTTCGACTCTTTTATGCCTCAAGCATGGATGCGACGGAACACTTGTTATAGTTTTTTATGGTATGGCACTATGTAGCGCAAATTCTAAACCTTTATTGTGAGTGATTGTTCTATTCAGGTTGCTCAACTCCGCGTTGAAAATACGACGCTGGTGAAGAGATTAACTGACATCAGCCAGAAGTTTAGTGATGCAGCTGTCGACAATCGAGTCCTGAAGTCAGATGTTGAAGCTCTTAGAGCTAAGGTACATTTCTTCCGCAACAATTTTTACCCGATTAAGATCTGTTTTTTCACTTTCAGCTCGGACGTGGGGCACGTGCCTCTGTTGCGGCCCAGGATACTCAATTTGGAGATGATTTAGACTAAGTCGAGGAACTGACTTTGACTGAAGATTTTCTCGATCTGCATGCTCAGGTGAAAATGGCTGAAGATTTAGTCACAAGAGCAACCGGTCAAACAGTTGCTCATCCACCTCACATTCCTGCAAGTCTTGGCATGAGCCACGGTTTTTCTTACATGCCAGGACCGTATGTGGCATCTGCTATGCCTCCTACCCACGGATATTTGCATCACAGTCTTCCTGTTTCATCTCAAGCGTTCCCTGTTGAACTTCCCTCCCTTCCGACGGGCCAGCAGGGACTGAGTGGTAAAATGGGGCGGACTCCTTCCATGCAACGTGTCGCAAGCTTAGAACACTTGCAAAAGCGCAGTCGTGGTGGTACTTGTAGTAGTACATCTGCGTGGGGTGCAGGATGGGACATGGAAGGACCTTCGATGGTTGAGCAATCCTCAATCAATGGTGACCACTAAGCAGGAGATGGTCAAAGAGTCGATGTACTACCGCTCACACATTGCTTCGTTTGATGTCCGTATATTCATACTAGGCATAGAAATATGTCTTACCAATGTGTATGAGGAAGGTCTCATAGCTGTTAGCAAGATGTACAGATACCGATTCATGTTCTTTACATTTGTGAATTTTGAGAGCAAAGGCGGGCATGACAAGTGGCTTGCTTGCCGCTGACCTGTGAAGGAACATGCTCTTCCTTCCAGAGAAGATGCGATACCCACGTATTATATCAGGGGACAGAACAGCGCACACATGTAGTCAAGTTGGTCTGTTTATATTAAGCTACATGCACATGCATCCGGAGAGGCGGTGACCAGAGCTTCCCTAAATGAACTTCTGGTTCAAGACGAATATGGTGATCCTTTTATCTATTGCGGCGCACATCTCATTGTTATATTCTACACGGAACTTGTTCAAGAATTTGTACAAAGCTATTCTTTTTCAAGATTGAAGTTTTTCGTTACTCTGTGAATCTGTACCAAGTTCAGGTTAAGGCAAAACAATCTGTTATAACCTGTTCACCCTATTTTGGAAAGCAGTCAATTTTGACATTGATGATTAATCGACCACATTTTTCTCCTTGTTGGTCATTGTCGTAATAGTGAATATTATTCAATAAGACCGCTGTAATATTTACTCACTCTTCTTTATTACCTTCTCGTCTACATTCTGTCGTAACGGATGCTGTCTGTGATTCAATTGTGCGTAATATTACTGTCGACTATTTTCCTATCTCTGTCCAGCATTTGAATGTGCTGCTCTTACCATAAGGGCCCCTGACACACGCCGCGTGGAAACTGCTTCTTACCCGTAGGTTGTCATCTCAGTAGGCTGAGATTTCCACTCAGACCCGAAGAAGATTTGATCGGCCGCGTGAGCACGCATTTAAGAGGGCCTGAATATTTTGGCAAAATTTCGTTGAAACGAGTTCAAATTTTCTTGAAGGCCCAGTTTTCTCTGTCTGCCATTCCGTTCAGTCTATGGGACTCGTGTGGG

mRNA

>Mapoly0012s0172.1
GGCGGGCGGGCTGGCGGGCGGGTTTGGATTTAGGGCGGCCGCGAAGGCCCAAGGGGCGAAATTGAGGCTGTGGTTGAGTCTGTCCCATGTTGTTGACTGACTGACTGACTGACTGACTACTGACCGAGTGAATGAGAGGTCGGGCGGCGTCGTCGACTATTGTTGTTGTTGTTGTAGCGCGAGATGAGTTGAGTACTTGCGCGGTACATTGGCAAAGCGTGAAATCTCGCTCGCCATCGCGAAAAGCTGGGCTGTAAATTCCGACGCCTTCTCAGGCGGAAGCTTTCGCTCCTTTCGCTCCGTGCATAGTCGTACGAGTGACAGCCAGCGAGCCCTCGTTCGTTGTTCAGTGTCGACGGTTTTTTTGGTTGGGATTTTTTGGTAGGATAGCAGAGCAGAGACGGGTTTTTCGTTGGTCGGCATCGAAGCCCCGAGCGATTTGGAACGAGAAAGTAGGCGTGATATTCTCTGCCTTTTTTTAATGCGGCGAAAGGTCGAAATCGGTGTTTTGTGCCTGGGAAAGCTCTGGCGATTTGCCGTCTTGCAGCGTGGGCAGCGAACTGCGGTTTCTGCAGCGTGAGACTGCGTGTCTAGGGTTCTTCGAGTTCGGTCGGTGGATTGATTGATTGTTGGTCGGAGCGGTTCGTTCTGAGCCCCTGTACGCGTTTCTTTCGAGGGTTTGCACCTCGTTGGCGCCTTGTGTATGGCAGGTAGTCTTCTGTCTTCCGCAAATTGGAGACGAGCAGCTGGTGGGCAAGAGAGCACCATAGGTTCAGAAGTGACGACAGAAAGCGACGAACAAGAGAGTGATCAAACTTTTTCCAGTCAGTAACAATTGGATTTCGTTTCAGTAGCACTGAGAACAACCTAGCACTTAGACTCTTGTGCCAAGGACAGCAGTGCTTCAAATCATCCCTTGGGAGGTCCTAGCTGGAAACATGCGTGCACGGCTAGGTGATACCGTCTGATTCACACTCCATAAGCACTCTTTAAACTCGAATTCCCCACAGAATCGAACGCTGGACCATCCAGTTGGTGTCCTTGTCGGATGAGAAAAGACTGGCGCAACAATTAGACTAGAATTCCAGGTTTTTTGGTAGCTGAATGTTCCAACGGGACAACCACTTGTCTGAGGCTGGTAACAGAACTTCAAACTACTATGGAACGTGTTTTTTCAGTAGATGATATATTAGGTACGTTTTGGAAACTGGATACTCAGAGTGGTGATCAAGCCAGTAGTACGGGAGCAGTCAATGGTACTGGCGTTTTAGGAAATGGAGGAAATGGTTATAACCCGGGCATGAACAGAAGTGCCTCAGAGTGGGCGTTTCAAGAGTTTCTTAAGGAGCATACTCAGGCCTCGGGTCTTCAATCCCGAAATGATAGCCAGGTGTTTATGATATCCGAGGAAGAAGCAGGAGAGAAAGAACTTCCTCCTTCGCAAGACAAGGAGTGTGTTGAGGAGCAAAAGGAACCAGATGTGATAAGCATTCCTGGATTGAAGGAGGAGGTAGACGAGAGTAGTTATACCGCGTCCAATCAAAAGGCAGAAGATCCGCTTGAGCAGCCTGAATTGAAAGTCGCTGTGAATCCTCTATTCTCAGGGCTGCGAGATGAAGTTCCAGCAGCGCCAGCCAGTAGTGATCCTCGGGAGTATGAGCACTTCCTCAAACGTCGTTTGGACATTGCTTGTGCCGCGGTCGCCATGTCTCGGGCAACTGGGCTTGGGTCTCCGAAGATTGCTGGGAACCTGTCGCTGCAACAAGCCGTGCCTCAAGGAAAGGGAGCAGCCCCCGGCCTTCTAGGTGCTGACGTTGCAGCCAATGGAAGTCACGTCAGGGGTCCCGTCGGAATTCCGGCGCTTCCCCCGAAACCTGACAGTCTCGCACCAGTGAGCAGCGCAAAGCCTACGACCAGTGGTTCATCAAGAGAGCAATCAGATGACGAGGACGGGGATGACGGCGTGGTGAACGATCAAAATTTGGAGCCGGGGGATCTGAAACGCGTGAAACGGATGCTGTCCAACAGAGAATCTGCCAGACGCTCGAGAAGAAGAAAGCAAGCCCACTTAAGCGAGTTGGAGACACAGGTTGCTCAACTCCGCGTTGAAAATACGACGCTGGTGAAGAGATTAACTGACATCAGCCAGAAGTTTAGTGATGCAGCTGTCGACAATCGAGTCCTGAAGTCAGATGTTGAAGCTCTTAGAGCTAAGGTGAAAATGGCTGAAGATTTAGTCACAAGAGCAACCGGTCAAACAGTTGCTCATCCACCTCACATTCCTGCAAGTCTTGGCATGAGCCACGGTTTTTCTTACATGCCAGGACCGTATGTGGCATCTGCTATGCCTCCTACCCACGGATATTTGCATCACAGTCTTCCTGTTTCATCTCAAGCGTTCCCTGTTGAACTTCCCTCCCTTCCGACGGGCCAGCAGGGACTGAGTGGTAAAATGGGGCGGACTCCTTCCATGCAACGTGTCGCAAGCTTAGAACACTTGCAAAAGCGCAGTCGTGGTGGTACTTGTAGTAGTACATCTGCGTGGGGTGCAGGATGGGACATGGAAGGACCTTCGATGGTTGAGCAATCCTCAATCAATGGTGACCACTAAGCAGGAGATGGTCAAAGAGTCGATGTACTACCGCTCACACATTGCTTCGTTTGATGTCCGTATATTCATACTAGGCATAGAAATATGTCTTACCAATGTGTATGAGGAAGGTCTCATAGCTGTTAGCAAGATGTACAGATACCGATTCATGTTCTTTACATTTGTGAATTTTGAGAGCAAAGGCGGGCATGACAAGTGGCTTGCTTGCCGCTGACCTGTGAAGGAACATGCTCTTCCTTCCAGAGAAGATGCGATACCCACGTATTATATCAGGGGACAGAACAGCGCACACATGTAGTCAAGTTGGTCTGTTTATATTAAGCTACATGCACATGCATCCGGAGAGGCGGTGACCAGAGCTTCCCTAAATGAACTTCTGGTTCAAGACGAATATGGTGATCCTTTTATCTATTGCGGCGCACATCTCATTGTTATATTCTACACGGAACTTGTTCAAGAATTTGTACAAAGCTATTCTTTTTCAAGATTGAAGTTTTTCGTTACTCTGTGAATCTGTACCAAGTTCAGGTTAAGGCAAAACAATCTGTTATAACCTGTTCACCCTATTTTGGAAAGCAGTCAATTTTGACATTGATGATTAATCGACCACATTTTTCTCCTTGTTGGTCATTGTCGTAATAGTGAATATTATTCAATAAGACCGCTGTAATATTTACTCACTCTTCTTTATTACCTTCTCGTCTACATTCTGTCGTAACGGATGCTGTCTGTGATTCAATTGTGCGTAATATTACTGTCGACTATTTTCCTATCTCTGTCCAGCATTTGAATGTGCTGCTCTTACCATAAGGGCCCCTGACACACGCCGCGTGGAAACTGCTTCTTACCCGTAGGTTGTCATCTCAGTAGGCTGAGATTTCCACTCAGACCCGAAGAAGATTTGATCGGCCGCGTGAGCACGCATTTAAGAGGGCCTGAATATTTTGGCAAAATTTCGTTGAAACGAGTTCAAATTTTCTTGAAGGCCCAGTTTTCTCTGTCTGCCATTCCGTTCAGTCTATGGGACTCGTGTGGG

CDS

>Mapoly0012s0172.1
ATGGAACGTGTTTTTTCAGTAGATGATATATTAGGTACGTTTTGGAAACTGGATACTCAGAGTGGTGATCAAGCCAGTAGTACGGGAGCAGTCAATGGTACTGGCGTTTTAGGAAATGGAGGAAATGGTTATAACCCGGGCATGAACAGAAGTGCCTCAGAGTGGGCGTTTCAAGAGTTTCTTAAGGAGCATACTCAGGCCTCGGGTCTTCAATCCCGAAATGATAGCCAGGTGTTTATGATATCCGAGGAAGAAGCAGGAGAGAAAGAACTTCCTCCTTCGCAAGACAAGGAGTGTGTTGAGGAGCAAAAGGAACCAGATGTGATAAGCATTCCTGGATTGAAGGAGGAGGTAGACGAGAGTAGTTATACCGCGTCCAATCAAAAGGCAGAAGATCCGCTTGAGCAGCCTGAATTGAAAGTCGCTGTGAATCCTCTATTCTCAGGGCTGCGAGATGAAGTTCCAGCAGCGCCAGCCAGTAGTGATCCTCGGGAGTATGAGCACTTCCTCAAACGTCGTTTGGACATTGCTTGTGCCGCGGTCGCCATGTCTCGGGCAACTGGGCTTGGGTCTCCGAAGATTGCTGGGAACCTGTCGCTGCAACAAGCCGTGCCTCAAGGAAAGGGAGCAGCCCCCGGCCTTCTAGGTGCTGACGTTGCAGCCAATGGAAGTCACGTCAGGGGTCCCGTCGGAATTCCGGCGCTTCCCCCGAAACCTGACAGTCTCGCACCAGTGAGCAGCGCAAAGCCTACGACCAGTGGTTCATCAAGAGAGCAATCAGATGACGAGGACGGGGATGACGGCGTGGTGAACGATCAAAATTTGGAGCCGGGGGATCTGAAACGCGTGAAACGGATGCTGTCCAACAGAGAATCTGCCAGACGCTCGAGAAGAAGAAAGCAAGCCCACTTAAGCGAGTTGGAGACACAGGTTGCTCAACTCCGCGTTGAAAATACGACGCTGGTGAAGAGATTAACTGACATCAGCCAGAAGTTTAGTGATGCAGCTGTCGACAATCGAGTCCTGAAGTCAGATGTTGAAGCTCTTAGAGCTAAGGTGAAAATGGCTGAAGATTTAGTCACAAGAGCAACCGGTCAAACAGTTGCTCATCCACCTCACATTCCTGCAAGTCTTGGCATGAGCCACGGTTTTTCTTACATGCCAGGACCGTATGTGGCATCTGCTATGCCTCCTACCCACGGATATTTGCATCACAGTCTTCCTGTTTCATCTCAAGCGTTCCCTGTTGAACTTCCCTCCCTTCCGACGGGCCAGCAGGGACTGAGTGGTAAAATGGGGCGGACTCCTTCCATGCAACGTGTCGCAAGCTTAGAACACTTGCAAAAGCGCAGTCGTGGTGGTACTTGTAGTAGTACATCTGCGTGGGGTGCAGGATGGGACATGGAAGGACCTTCGATGGTTGAGCAATCCTCAATCAATGGTGACCACTAA

Protein

>Mapoly0012s0172.1
MERVFSVDDILGTFWKLDTQSGDQASSTGAVNGTGVLGNGGNGYNPGMNRSASEWAFQEFLKEHTQASGLQSRNDSQVFMISEEEAGEKELPPSQDKECVEEQKEPDVISIPGLKEEVDESSYTASNQKAEDPLEQPELKVAVNPLFSGLRDEVPAAPASSDPREYEHFLKRRLDIACAAVAMSRATGLGSPKIAGNLSLQQAVPQGKGAAPGLLGADVAANGSHVRGPVGIPALPPKPDSLAPVSSAKPTTSGSSREQSDDEDGDDGVVNDQNLEPGDLKRVKRMLSNRESARRSRRRKQAHLSELETQVAQLRVENTTLVKRLTDISQKFSDAAVDNRVLKSDVEALRAKVKMAEDLVTRATGQTVAHPPHIPASLGMSHGFSYMPGPYVASAMPPTHGYLHHSLPVSSQAFPVELPSLPTGQQGLSGKMGRTPSMQRVASLEHLQKRSRGGTCSSTSAWGAGWDMEGPSMVEQSSINGDH

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>