Mapoly0012s0202



Description

MYC

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_153265
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR11514 MYC
PANTHER PTHR11514:SF33

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH24 transcription factor, bHLH Mapoly0012s0202.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0012s0202.1 scaffold_12:2258978..2265278  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0012s0202.1  

Gene structure:

mRNA scaffold_12:2258978..2265278  ( - strand )
three_prime_UTR scaffold_12:2258978..2259333  ( - strand )
CDS scaffold_12:2259334..2259417  ( - strand )
CDS scaffold_12:2259871..2260287  ( - strand )
CDS scaffold_12:2261810..2262742  ( - strand )
five_prime_UTR scaffold_12:2262743..2265278  ( - strand )

Sequences:

Gene

>Mapoly0012s0202.1
CTGATGAGTGCAGGGTGTAGCTTGGGGTTATCATCAGGTGCCTGTTCATCTCAACGCTGGCTTGGCTCGGCTCGGCTGAAGCTCTCAGCTAGATAGCTAACTGGCTGGCTAGCTAGTCTGAGCTTATATGTACCTACAAACTGGCTCGACCTCTCCTTTTCTTCTCGCAGGAAGCAAACGTTCGGTTTCTGCCTCGGGTGCTGCTGCTGCTGCGGCTTCTGCTTCTAGTCTAGTGTCTCTTAATCTCCTGGGACTCACGGGGGGCGTCCGTCTACACTGTTCAATTGATAGACCCGTGGAGTCGCGGCTCGGCTCAGGATTCAGATCAGTCGACGAGCAATCAGGGTCACATCCGCTGTCGCCTTAAAGCTTTGTCATCTGCTGCTGCTTCTCCTTTCCTCAGTTCACTACCATCACCACCACCACCAGCGCCTCCTCCTTCCCTCCCTCCGTCCCTCCCTCCGCTGCTGCTTCGTGCTGATCTGTGTGTCCTCGGTGGCTGACTTACTTACTTACTGACTCACTCACTGTCACATGGTTTTTTCTGGACGAGCCTCGTTTTACCTGGAGATGGAGATGTGAACGAGGGATTGTGTAGCAGCAGCAAGCCGCATGCTCAATTGAGTCGTAACGGTTCGCCCGTCTGCGCTTCTCTCCTCTCTCCAGACCTAACACCCGGCGCCAATAATTTCCCTTCCTTCTCTTTCTCTCTCCTTCTCTCTCTCTCTCTCTCCCTCTCTCGGTGCCTATGATTGGGCGTGCGTGGGGCTTGCTTACAGCATACGTTCCAGGACATGTATTTCGTGCTCTGTGAATCTTCCTCGGAAGCGCCTTTTGATATCTCGATGCGCAAAAGAATATTGCCGTCCCGTCCCGTCGCAGTGAGTGAGTGCATGTTTTTTTCCTTCACATAGTTACCTACAGATTCTCTCATCACTCTAGTCGGAGGACAGAGGCAGCTGGAGAGAGAGCGAGAGAGCGAGCGAGCGCTTAAGCTCTCGCCCGATTCAGCAGACGCAACTGCGATCCGTGTTTCTGACTGCACTTGCGGCGGCTTCAGAGGAGGCCACAGTATCAGCGAGAGTGTGTAAACGAATTCCTCTCTAAGATAATCGCGACAGACACGAGTGTCGAGAAAGGCGAAGTCCTTGGATTCCGAAACCTTTTGCGCTGCTTTGAGTACCCGTGCTTCCTACTCGTACTTCTCGAGAGCCGGCGACCCTTCGAGAGAGAGAGAGAGAGACCGAGACCGAGACCGAGCGCGAGAGAAAGAGAGCGACTCGCCACACATTTTACTCGCCCGCCACACCAGTCCACCAGCTGAAAGTGAAGAGTAGAGAAGAGAAGGCAGGCCTGGTTGCCGAGTTGCTGCTGCTGTGGTCGAACTGCTTTGGACGAGACTACTACAGTATCAGAGGGAAATTCGAGCCGCGAGTGAAGTCTATTTTATGGTCTTTTCGTCAAAGGGACAAGATTAGCTGGAAGGCCGGGACCGCACGCCAAGACTTGCAACTTTGTGACGTAGTGTCATCGTCCTGTTCACTCGGAATGTATATGCTGCTGCTGCTGCATGGGCTCATCAGCTCTCAGCACGCTGATCTTTGAAGCCCGGATCCCCATTCCGGTCCGTCCAAATTTCCTTATAGCCTCAAGGCGCAAAATGTAGAAGAGTCACTCCCTTGTTTTGCGAGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGAGAGTCAGTCTTCTTCTCCTTCGTCAGCGAGAATCTCAAGGTGCTTTGGCCCTCTCTCTCTCTCTCTCTCTTTCTCTCTCATAGAGACATAGAGTCGAGAGGTTCTCAGGTGTCAATCATTCGAGCTCGGCCTGCGCTTCATTCGTCTCGTCAGTCGATTCAGAACCCGAGCGAGCTGTTGTGCTTCTGGCAACGATCCACGCAGTTCAGTCCACCAGAGGAGCAAGCGAGCGCTCTTGCATCGGGGATTCGTGTGCTGAAATTCAGCGGTCTGGTTCGTTCGGGAAGGAATGGGCTGGTTCTTGCTCCTGCCTGGCAACAATATGCGGGCTTGCGGTCGTCCAGGAGGTTCGTGAGAGCAGCAGCCGAGCTACAGAAAGGGAGGGAAGGAAGGGAGGAGGTTCTCGTTCCAGCATCGAGTGCCGCGCGCGGTGGGAATTTGCAGCAATTGCCAGGAGGGCGGGCGGGCCATGAAGTGCAAAGCACGACAATAAAGCCCTCGCTGTTTCCGACAGTGGTGAGAGTGGTTACGAGCCAGGGAAGGATCACATTTCGGCCACAGTTTCATCATGCTGCTGCTGCTTCTTGAATCGAGCCGTGATTCTCTCGAAGCGGCGGCGGCCAATTGTTATTAGCCCATGAACGATAGTGCACACGAGCTCGTCGAGAGTCTGAGATTTCGCCTGCTGCTGCTGCAACTGGAGCTAGAGATTTCGTTCGAGGCGAAGCTCTCGCTACAATCGAGAGCGAGGGAGGGAGAGATAGGGAGAGCTGAGCTAGCGTAGGTCGAAATCGAGGAGGTGAGAGGCGCAATGCCTTCACATTGTCGCTCTGGGCTGGGGATGGGGCCGGTTCATCTGCACCCATTTTCGTTCGCGAGATCATCGATGATCCACCACAACAACTTCGACATTCATCGAGCTTATCAGGTGGATTCGTGTACATCGACGTTTCAGCCCGTGAAGGACGACCCGTCGCCGGTGTTGGCGACGCCATTGCTGCAGCAGCAGCAGCAGCAGCAGCAGGCGCATGCGCATGCGCAGCAGCATTCGACGAGCAGCGGGGCGGTGCTGAACCCGGCCAATGTGGAGGAGGTGGATGTGGAGACCATCCTGCAACTGGGAGAGCTGCAAGATTGGACGTGGCCCGGGTCCGTGGAGGCGCACGAGGCAAAACCCTCGGAGCTGAGTCTGCCATACCCGACGCAATCATTGATCTCGAGCACCATCATCCACCCGGCTGCGCATGCCGACATGCACCACGACCAGAAGGGCAGCACGAGCACGAGCTCGCTGTTCGGGCCGCCCGCCGAGCCATCGTCGCAGAGCTTCGATCTGCAATCGTGGTGCAGCGGCGTGCGCAGTGTCCAGTCGCCGCACATCGCCATCCCCAAGTTCCTGGCGAATGGTGGCTTCTCGACCTCGGCCGAGCCCTCGCCCACCACCGATACCAGCCCTCTCAGACTCGACGGCCGCGAGCGCTGCTCCCCCGCCACCACTCCCCAACACCCAGCGCATCACCAGCAGCAGCACCAACAACATCAACATCAACAACATCAACAGCAGCGCAGATTCGCCTACAACTCCGAGCACACCGAGAAAGCCCTCTGCGTGCAGAAAAAATGGCAAGGCAAGCGCGCCGTGAGCCAGCGCGAGTCCCACATCTGGTCCGAGCGCCAACGGCGCAAGGGCATGAACCACTTGTTCTCGACGCTCAGATCGCTGCTGCCGCAGCCCACCTCCAAGGTAAGCACTCGCCTCCTCCTCCTCCTCCTCCTCATAATCATCACCATCCTCGGCAGCAGTAGCGCTAGCTCGCTCACTCGCTCACTCGCTCGCCCAGCTGCCAGTAGCAAGCATGGCATGGCGTCAGTGATTTCGGGTCGATGACAATGATCGTAATATTCAGTACAGCTCTAGAACACGGAGTCTGTGAATGTGAATGAGGGGAGGATTTGGGAGGATGATGATTCTGGACGCAGGAATCGAGGACCGTGAATCTCGCCAAAGTGCTCGAGGCGGGCCGGGATTAGGCAGCGGCGGGGAGCGCAATTAATTTATGGGTCAGGGAAATTCATTCTCGTGGCGCTTTGGCCCGCGGTATTTTCTCACTTATGCCGCGAGACCAGCACTGTACGGGTCAAACGCACAGTCGCTGAGAATTACATTATTATTAAAAATGCCCTCACGAGCCTCCCTCGCAGCCTCGCAGCCTACCCTCTTGCCAGCCACAGCCTCCATCTCCACTGTTCAAGTTGACTGCGCCTTTTCAGACCAGACGCCAAATTCTCTTCTATTTACCGCCTCCTGCTGCACCCTCCCTCCCGAGCTTCCAAGCTTCCGAGAGCGCGTTCGCAGCTTTTGCAGACACCACTGACCTCTGTCTGTGGAGCAGGCGGCGTCGTCGTCGTCATCGTCATCGTTAGCACCTCGGCTCAGAACTGATGTTTCTTCACGTGCTGTTCGTCTGGTGTGGAGACATGGCGGATGCTACTCCGTGCGTCTCGATGGCTGTCGAAGCCCAGGCCCGCCTTGCTCGCTCGCTCGCTTCGTTCGAGCCGCCCGGTCTCAATTTCTTCATTATCATCATCATCTGTGACTGTTTGCGTGTACGCCCCGATCCTCGGCATGTCCTCGGCTGGCCCCCTCCTCTTCTCTCGAGAAAAAGGCCTTGTGCCGGATGTCCCATGTGGGCCAGGCCTGATATGGCGCCCATGGCATGCATGGGCCCTTCCTTCGTCCCTTCCTATCGGTCCGGGAGGATCTTGCAAACCATCTGCTGCTGCTGCTGCTGCTGACGCTGTGAGGTAGCGGCGATGGATCTGACTCCGCAGCTGGAAAATCAGACTCACTTTCCATTCAGGAGCTTAACTTCAGAAGAAAGAACGCAGGACTGCAAGGCCCTCCCGCTGCCACCACCGCCACCGTCCTCGTACTCTGCTGCACGACTGAGATCGATCGATCGATCGATGGGTCGATTGGTTGATTAATTGATTGATTGATTGATTGATTGATTTAGTGGTTGATTGATTTTAAGCTGAAATTTGAGGAAATGCGTCGAGCTCCAGCTGCGCACGTAGAAGCGCAGACGATTGCATGACGCCCCGTGCGGAATTCGCTGCCTGGAGGCGATGGGGACGGATGTGAGGATGGGATTCCGGGTGATGATTGATTGAATGCGGGGACTCGATCGAGTGGCATGATCGATTGATGGAAGCTGACCGGGATTTTTGCGTTGGTGCGTGGCTGGTGGTGTGTGTGCGCGCAGACGGATAAGTCGACGGTGGTGTCGGAGATCATCAAGTACATTCAAGGGCTGCAGGTGAAGCTGGACGAGCTGCAGAAGAAGCGGGCGGAGATTCTGCGGCGCAAGTCGATGGACGTGACGATGGTGGGCGGCTTGAACTCGCCGACGAGCGGCATCGCCACGAGCGTGGGCGTGGGCGTGGCTGTGCCGCTGAGCCTGGTGGCCGCCGCCAACAACGAGTGCTGCCTGCAGTCGTTCGTGCTGCCGAATGTGGCGCTGCACATCAGCGGCAACAACGCCTTCATCACCATGAGCAGCCCCAAGAAGCGCGGCCTCTTCTGCCGCATCCTGCTCATCATGCAGTCGCACAAGCTCGCCGTCCTCAACGCGCACATCAGCACCAGCAATGCCACTGTCTTCCACTGCCTGCACGTCATGGTACGCCTCCCCTCCCCTCCCCACCTCCATCTTCGTCTTCGTCTGCATTCGATCTCTCGTCCATCTCTCGCTTCTCTGCGTCCACAATTGTGTTCTTTCTTCGACTGGCAGTGACATCGAATGTTCCATAAATCTAGAGCTGGTCCGTTCTTCGTCTCAGAAGGCTCAGAGCCATGGACCGAAGGGACTGAAGGGCTTCTGGTAGCTATAGCCATCTCTCGACACGGCACATGGAGCGAGTGAGCAGGTCGGAGACTCCGAGACGATTCGACTGTCGCCATGGTCGCCGTCGTTCGTGTCGAGAGACATCGTGATTGAGTTTCTATCGATGCCAGTGCGAGGATGATAATATATGGCAGACCACATGTTCGCCACTGCTGCATCGGCTGCTGCCGTGCCCTCGAGCTCAAATGAGAGTGCAAGTTCTGATTTCTCGGTTCGTTCGTTGTGCAGACTCCTGAACCTGGCTGCGACTTTCCGAAGGAAGCTCTGCAAACAGCGTTGCAGAATTTGACGCTTCCCGACTCTGCGCTATAGAGAGAAACTCGGACACACGAGCGCAAGAAGTAGTGTTAGAAGTAGTTCAATGTTCAAAGCGATAGGACGAGGACGAGGAGTGGACATTGGGAAATCGATCACTGACTGACCGAATGCATCCAAGAGCGGTTGGAGTAGACACAGGAAACTGGATTTCGACCCTGTGATTGAAGAACAAGTAGTTTTAGATAGTTGTAAAAATAGGACTTGAATCTTCTCATAGGAGCATGAATCTGCGGGAAATGCCGGATGTAGACGAAGGCTGATCCCCACTACAGGCATTTGTAGATGCTATGCAGGCAATGCAATGCAGTGTAACGCGTTGCATCTACGCACGTGATCAAGCTCACCGACCC

mRNA

>Mapoly0012s0202.1
CTGATGAGTGCAGGGTGTAGCTTGGGGTTATCATCAGGTGCCTGTTCATCTCAACGCTGGCTTGGCTCGGCTCGGCTGAAGCTCTCAGCTAGATAGCTAACTGGCTGGCTAGCTAGTCTGAGCTTATATGTACCTACAAACTGGCTCGACCTCTCCTTTTCTTCTCGCAGGAAGCAAACGTTCGGTTTCTGCCTCGGGTGCTGCTGCTGCTGCGGCTTCTGCTTCTAGTCTAGTGTCTCTTAATCTCCTGGGACTCACGGGGGGCGTCCGTCTACACTGTTCAATTGATAGACCCGTGGAGTCGCGGCTCGGCTCAGGATTCAGATCAGTCGACGAGCAATCAGGGTCACATCCGCTGTCGCCTTAAAGCTTTGTCATCTGCTGCTGCTTCTCCTTTCCTCAGTTCACTACCATCACCACCACCACCAGCGCCTCCTCCTTCCCTCCCTCCGTCCCTCCCTCCGCTGCTGCTTCGTGCTGATCTGTGTGTCCTCGGTGGCTGACTTACTTACTTACTGACTCACTCACTGTCACATGGTTTTTTCTGGACGAGCCTCGTTTTACCTGGAGATGGAGATGTGAACGAGGGATTGTGTAGCAGCAGCAAGCCGCATGCTCAATTGAGTCGTAACGGTTCGCCCGTCTGCGCTTCTCTCCTCTCTCCAGACCTAACACCCGGCGCCAATAATTTCCCTTCCTTCTCTTTCTCTCTCCTTCTCTCTCTCTCTCTCTCCCTCTCTCGGTGCCTATGATTGGGCGTGCGTGGGGCTTGCTTACAGCATACGTTCCAGGACATGTATTTCGTGCTCTGTGAATCTTCCTCGGAAGCGCCTTTTGATATCTCGATGCGCAAAAGAATATTGCCGTCCCGTCCCGTCGCAGTGAGTGAGTGCATGTTTTTTTCCTTCACATAGTTACCTACAGATTCTCTCATCACTCTAGTCGGAGGACAGAGGCAGCTGGAGAGAGAGCGAGAGAGCGAGCGAGCGCTTAAGCTCTCGCCCGATTCAGCAGACGCAACTGCGATCCGTGTTTCTGACTGCACTTGCGGCGGCTTCAGAGGAGGCCACAGTATCAGCGAGAGTGTGTAAACGAATTCCTCTCTAAGATAATCGCGACAGACACGAGTGTCGAGAAAGGCGAAGTCCTTGGATTCCGAAACCTTTTGCGCTGCTTTGAGTACCCGTGCTTCCTACTCGTACTTCTCGAGAGCCGGCGACCCTTCGAGAGAGAGAGAGAGAGACCGAGACCGAGACCGAGCGCGAGAGAAAGAGAGCGACTCGCCACACATTTTACTCGCCCGCCACACCAGTCCACCAGCTGAAAGTGAAGAGTAGAGAAGAGAAGGCAGGCCTGGTTGCCGAGTTGCTGCTGCTGTGGTCGAACTGCTTTGGACGAGACTACTACAGTATCAGAGGGAAATTCGAGCCGCGAGTGAAGTCTATTTTATGGTCTTTTCGTCAAAGGGACAAGATTAGCTGGAAGGCCGGGACCGCACGCCAAGACTTGCAACTTTGTGACGTAGTGTCATCGTCCTGTTCACTCGGAATGTATATGCTGCTGCTGCTGCATGGGCTCATCAGCTCTCAGCACGCTGATCTTTGAAGCCCGGATCCCCATTCCGGTCCGTCCAAATTTCCTTATAGCCTCAAGGCGCAAAATGTAGAAGAGTCACTCCCTTGTTTTGCGAGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGAGAGTCAGTCTTCTTCTCCTTCGTCAGCGAGAATCTCAAGGTGCTTTGGCCCTCTCTCTCTCTCTCTCTCTTTCTCTCTCATAGAGACATAGAGTCGAGAGGTTCTCAGGTGTCAATCATTCGAGCTCGGCCTGCGCTTCATTCGTCTCGTCAGTCGATTCAGAACCCGAGCGAGCTGTTGTGCTTCTGGCAACGATCCACGCAGTTCAGTCCACCAGAGGAGCAAGCGAGCGCTCTTGCATCGGGGATTCGTGTGCTGAAATTCAGCGGTCTGGTTCGTTCGGGAAGGAATGGGCTGGTTCTTGCTCCTGCCTGGCAACAATATGCGGGCTTGCGGTCGTCCAGGAGGTTCGTGAGAGCAGCAGCCGAGCTACAGAAAGGGAGGGAAGGAAGGGAGGAGGTTCTCGTTCCAGCATCGAGTGCCGCGCGCGGTGGGAATTTGCAGCAATTGCCAGGAGGGCGGGCGGGCCATGAAGTGCAAAGCACGACAATAAAGCCCTCGCTGTTTCCGACAGTGGTGAGAGTGGTTACGAGCCAGGGAAGGATCACATTTCGGCCACAGTTTCATCATGCTGCTGCTGCTTCTTGAATCGAGCCGTGATTCTCTCGAAGCGGCGGCGGCCAATTGTTATTAGCCCATGAACGATAGTGCACACGAGCTCGTCGAGAGTCTGAGATTTCGCCTGCTGCTGCTGCAACTGGAGCTAGAGATTTCGTTCGAGGCGAAGCTCTCGCTACAATCGAGAGCGAGGGAGGGAGAGATAGGGAGAGCTGAGCTAGCGTAGGTCGAAATCGAGGAGGTGAGAGGCGCAATGCCTTCACATTGTCGCTCTGGGCTGGGGATGGGGCCGGTTCATCTGCACCCATTTTCGTTCGCGAGATCATCGATGATCCACCACAACAACTTCGACATTCATCGAGCTTATCAGGTGGATTCGTGTACATCGACGTTTCAGCCCGTGAAGGACGACCCGTCGCCGGTGTTGGCGACGCCATTGCTGCAGCAGCAGCAGCAGCAGCAGCAGGCGCATGCGCATGCGCAGCAGCATTCGACGAGCAGCGGGGCGGTGCTGAACCCGGCCAATGTGGAGGAGGTGGATGTGGAGACCATCCTGCAACTGGGAGAGCTGCAAGATTGGACGTGGCCCGGGTCCGTGGAGGCGCACGAGGCAAAACCCTCGGAGCTGAGTCTGCCATACCCGACGCAATCATTGATCTCGAGCACCATCATCCACCCGGCTGCGCATGCCGACATGCACCACGACCAGAAGGGCAGCACGAGCACGAGCTCGCTGTTCGGGCCGCCCGCCGAGCCATCGTCGCAGAGCTTCGATCTGCAATCGTGGTGCAGCGGCGTGCGCAGTGTCCAGTCGCCGCACATCGCCATCCCCAAGTTCCTGGCGAATGGTGGCTTCTCGACCTCGGCCGAGCCCTCGCCCACCACCGATACCAGCCCTCTCAGACTCGACGGCCGCGAGCGCTGCTCCCCCGCCACCACTCCCCAACACCCAGCGCATCACCAGCAGCAGCACCAACAACATCAACATCAACAACATCAACAGCAGCGCAGATTCGCCTACAACTCCGAGCACACCGAGAAAGCCCTCTGCGTGCAGAAAAAATGGCAAGGCAAGCGCGCCGTGAGCCAGCGCGAGTCCCACATCTGGTCCGAGCGCCAACGGCGCAAGGGCATGAACCACTTGTTCTCGACGCTCAGATCGCTGCTGCCGCAGCCCACCTCCAAGACGGATAAGTCGACGGTGGTGTCGGAGATCATCAAGTACATTCAAGGGCTGCAGGTGAAGCTGGACGAGCTGCAGAAGAAGCGGGCGGAGATTCTGCGGCGCAAGTCGATGGACGTGACGATGGTGGGCGGCTTGAACTCGCCGACGAGCGGCATCGCCACGAGCGTGGGCGTGGGCGTGGCTGTGCCGCTGAGCCTGGTGGCCGCCGCCAACAACGAGTGCTGCCTGCAGTCGTTCGTGCTGCCGAATGTGGCGCTGCACATCAGCGGCAACAACGCCTTCATCACCATGAGCAGCCCCAAGAAGCGCGGCCTCTTCTGCCGCATCCTGCTCATCATGCAGTCGCACAAGCTCGCCGTCCTCAACGCGCACATCAGCACCAGCAATGCCACTGTCTTCCACTGCCTGCACGTCATGACTCCTGAACCTGGCTGCGACTTTCCGAAGGAAGCTCTGCAAACAGCGTTGCAGAATTTGACGCTTCCCGACTCTGCGCTATAGAGAGAAACTCGGACACACGAGCGCAAGAAGTAGTGTTAGAAGTAGTTCAATGTTCAAAGCGATAGGACGAGGACGAGGAGTGGACATTGGGAAATCGATCACTGACTGACCGAATGCATCCAAGAGCGGTTGGAGTAGACACAGGAAACTGGATTTCGACCCTGTGATTGAAGAACAAGTAGTTTTAGATAGTTGTAAAAATAGGACTTGAATCTTCTCATAGGAGCATGAATCTGCGGGAAATGCCGGATGTAGACGAAGGCTGATCCCCACTACAGGCATTTGTAGATGCTATGCAGGCAATGCAATGCAGTGTAACGCGTTGCATCTACGCACGTGATCAAGCTCACCGACCC

CDS

>Mapoly0012s0202.1
ATGCCTTCACATTGTCGCTCTGGGCTGGGGATGGGGCCGGTTCATCTGCACCCATTTTCGTTCGCGAGATCATCGATGATCCACCACAACAACTTCGACATTCATCGAGCTTATCAGGTGGATTCGTGTACATCGACGTTTCAGCCCGTGAAGGACGACCCGTCGCCGGTGTTGGCGACGCCATTGCTGCAGCAGCAGCAGCAGCAGCAGCAGGCGCATGCGCATGCGCAGCAGCATTCGACGAGCAGCGGGGCGGTGCTGAACCCGGCCAATGTGGAGGAGGTGGATGTGGAGACCATCCTGCAACTGGGAGAGCTGCAAGATTGGACGTGGCCCGGGTCCGTGGAGGCGCACGAGGCAAAACCCTCGGAGCTGAGTCTGCCATACCCGACGCAATCATTGATCTCGAGCACCATCATCCACCCGGCTGCGCATGCCGACATGCACCACGACCAGAAGGGCAGCACGAGCACGAGCTCGCTGTTCGGGCCGCCCGCCGAGCCATCGTCGCAGAGCTTCGATCTGCAATCGTGGTGCAGCGGCGTGCGCAGTGTCCAGTCGCCGCACATCGCCATCCCCAAGTTCCTGGCGAATGGTGGCTTCTCGACCTCGGCCGAGCCCTCGCCCACCACCGATACCAGCCCTCTCAGACTCGACGGCCGCGAGCGCTGCTCCCCCGCCACCACTCCCCAACACCCAGCGCATCACCAGCAGCAGCACCAACAACATCAACATCAACAACATCAACAGCAGCGCAGATTCGCCTACAACTCCGAGCACACCGAGAAAGCCCTCTGCGTGCAGAAAAAATGGCAAGGCAAGCGCGCCGTGAGCCAGCGCGAGTCCCACATCTGGTCCGAGCGCCAACGGCGCAAGGGCATGAACCACTTGTTCTCGACGCTCAGATCGCTGCTGCCGCAGCCCACCTCCAAGACGGATAAGTCGACGGTGGTGTCGGAGATCATCAAGTACATTCAAGGGCTGCAGGTGAAGCTGGACGAGCTGCAGAAGAAGCGGGCGGAGATTCTGCGGCGCAAGTCGATGGACGTGACGATGGTGGGCGGCTTGAACTCGCCGACGAGCGGCATCGCCACGAGCGTGGGCGTGGGCGTGGCTGTGCCGCTGAGCCTGGTGGCCGCCGCCAACAACGAGTGCTGCCTGCAGTCGTTCGTGCTGCCGAATGTGGCGCTGCACATCAGCGGCAACAACGCCTTCATCACCATGAGCAGCCCCAAGAAGCGCGGCCTCTTCTGCCGCATCCTGCTCATCATGCAGTCGCACAAGCTCGCCGTCCTCAACGCGCACATCAGCACCAGCAATGCCACTGTCTTCCACTGCCTGCACGTCATGACTCCTGAACCTGGCTGCGACTTTCCGAAGGAAGCTCTGCAAACAGCGTTGCAGAATTTGACGCTTCCCGACTCTGCGCTATAG

Protein

>Mapoly0012s0202.1
MPSHCRSGLGMGPVHLHPFSFARSSMIHHNNFDIHRAYQVDSCTSTFQPVKDDPSPVLATPLLQQQQQQQQAHAHAQQHSTSSGAVLNPANVEEVDVETILQLGELQDWTWPGSVEAHEAKPSELSLPYPTQSLISSTIIHPAAHADMHHDQKGSTSTSSLFGPPAEPSSQSFDLQSWCSGVRSVQSPHIAIPKFLANGGFSTSAEPSPTTDTSPLRLDGRERCSPATTPQHPAHHQQQHQQHQHQQHQQQRRFAYNSEHTEKALCVQKKWQGKRAVSQRESHIWSERQRRKGMNHLFSTLRSLLPQPTSKTDKSTVVSEIIKYIQGLQVKLDELQKKRAEILRRKSMDVTMVGGLNSPTSGIATSVGVGVAVPLSLVAAANNECCLQSFVLPNVALHISGNNAFITMSSPKKRGLFCRILLIMQSHKLAVLNAHISTSNATVFHCLHVMTPEPGCDFPKEALQTALQNLTLPDSAL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>