Mapoly0013s0027



Description

Uncharacterized conserved protein

Reference DB

Database ID Description
KOG KOG4090 Uncharacterized conserved protein
PANTHER PTHR24023 FAMILY NOT NAMED
PANTHER PTHR24023:SF95 SUBFAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBELL4 Homeodomain protein Public
MpHD5 transcription factor, HD Mapoly0013s0027.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0013s0027.1 scaffold_13:244816..258730  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0013s0027.1  

Gene structure:

mRNA scaffold_13:244816..258730  ( + strand )
five_prime_UTR scaffold_13:244816..244999  ( + strand )
five_prime_UTR scaffold_13:245552..245790  ( + strand )
five_prime_UTR scaffold_13:246099..246311  ( + strand )
five_prime_UTR scaffold_13:246592..246738  ( + strand )
CDS scaffold_13:246739..247193  ( + strand )
CDS scaffold_13:248165..250973  ( + strand )
CDS scaffold_13:251229..251384  ( + strand )
CDS scaffold_13:251561..251646  ( + strand )
CDS scaffold_13:251864..251954  ( + strand )
CDS scaffold_13:252130..252326  ( + strand )
CDS scaffold_13:252485..252575  ( + strand )
CDS scaffold_13:252745..252827  ( + strand )
CDS scaffold_13:253317..253778  ( + strand )
CDS scaffold_13:254087..254720  ( + strand )
CDS scaffold_13:255320..255472  ( + strand )
CDS scaffold_13:256112..256200  ( + strand )
CDS scaffold_13:256637..256727  ( + strand )
CDS scaffold_13:257206..257312  ( + strand )
CDS scaffold_13:257614..257704  ( + strand )
CDS scaffold_13:258330..258518  ( + strand )
three_prime_UTR scaffold_13:258519..258730  ( + strand )

Sequences:

Gene

>Mapoly0013s0027.1
AGCAGAGCAGCTCCAGATATTGCACAAAATGCGCTCCGCTTCGAAGGAGCCAAGCGATCTCAATTCTCGTGTAAAAACTCGAGTTCTTTGTAGGCTGAGAAACTTCTCACTTTTTAAAGAGGACGGCTCAGCTCTTCGACTGCACACACACGTCGAAGATTTGGACTCGATTAGCTTCCTCCTTGTAAGTGAAATTTGAGCATTGCTTGTCCCTATGACTTGCAAAAGAGATTGCGTCAGCAATTACACCTCGGTCTCCGGCTAGGCTGTATAAATCCCAACAATGGAAGACTGAGATGATTGAAATTAAGGACCATTCCGGATAGATGCCTGCTGATTGAAAGTCCCTGCGGCAACGTTGGACGTTGTTGATGGTCAGTTTGGCATGTTTAGTAGAACGTAGATCATGAACAGAATGCTACGGCAAAATCTTTCTCAGGAGCTGTGGCAATGATACTAAGAGATTGTAGTTGCAGTACGGGACCTGTCGAAGGAATGTCGAGACAGACATCTCTTACTCTTCAGCATACTCTCTTGCTGCTCAGAATCCATCGACGTTGACAGCTGCGTATTTTTCTTCTGGTCCGTAAGCTACTACTTGTCAAAAAAGGGGGAAGATTTATTTCGTCGAGAAAATAGTGCGCTCGGAAAGGAGCACTCTGATCCCAACTGGAGCCAACAAGAGGCACATGTGTAGGATCAGATTGTGATCTGATCCCTCGAATGTTGATGTCAGGACACAGCAGTGTTGGAGGTCCAATTTTCGTGACTCGAGCGCAACTGCGTAACTGGTAGGAACCAGTGCGTGGAATGCGAATGCTCCATGTAAAATATTCATAAGCAAGCCAGTGGCAGAAGGAGGAACGACGTGTTGGTAGTATCCCTGACACATTTTTCTGGTCTGGAAGATCGAGGCGAATGCGGTATGCTTTGTATCCTGAGGTAATTCGCCCTTAATGTCTTCTCGACTACAAGGTATGCCCACCTACCTCTCCTTCCTTTACTGCTTGTTGCCAGTGATTGATTCCAGGGAGAAATTCCCCTTCCCGTTCTCACATTATTGCGGACACGACCGTGATCTGTGGATTTTAATTTTGACGAGTGAGGCAGAATTCTGTACACTGGGAGCTCTCCTCTTCAACCTTGTAAATGAGGGAATAGATGGTGGTAATTAAATATAAAGCTGACAATTCATGTTTTGAATCAACAGGTCAATAAGTGCGATATGGCTTTCACATTAGGACTCATTTGCAGGCTCATGAGGCCGTGATCTTGGTTTGCAGATGTCAGTGGATTCGTTGTCGTCGGGGGATCGGCAGATTGCTCGTAAAGTCTTTCAGGAATTTGTTCCAATGAGCGATACACGCTTGTAATTGGACCGATCTAGAATGGGGATAGCATAGCTGATTTCTGGAGGTACTCGAAGTCGATGACAGATCTCAGACGTTTCCTGCATTCAAAAGCTAATTTGCAACAAAAAGCCCACCCAGAAACTGGTCGATATCTATCCACCATAGAACCACTCTCAAACTTTTCGCGGATCATCATTAGGTCTCTTAGGTTCAAGTTAATTTCCGCAGACTCTTGCATGTCAATGATTGAAGCTCTTGGAGCAAACAACAGTTGATTCTCCAGAGTCTTCATCCACTTTTCAAGATTCTACCCACCTGCGTTTCCTTTCCGCTGTATGAATTCGCTCGATGGATGTTCCTGTTTTCTGACTTTCCAGACATTTGAATGCTTGGCCCGTTTCTAAATCCAGTATACTCAGTACAGGAAGCTTATCAAAAGTATTTCAACCAAGGGATAAGCACAAGTAGGATTAGCAGAAGATGCACGAAGTCGGACGAGAAGCTGGCTCATTAGACTCGATGGCAAGAGAATAAACACATGTAACAAAACACAAGCGACATCAGATCCAGGATGTCGTCGAAGAAGCGAAAGGACCGTGGGGAGGATGAGGGACAAGGGCAGGCAGATGCACCTGCACCAGCAGGCTCTGGGGCGAGTGGCGGTGGCCGGAGTCCAGCTCGTGCCACCGGATCTCCGAAATCCGGCGGCCCGTCCGGTCGGAGTCCGAGTAGATCACCGAAAGCCGTCGATTCTGCCGGGCAGCCGCAGCCTGCGAGTCCAGGAAAAAGTGCTCCCGGCAAATCTAAGAACGCGGGTCAGGGTTCGAGTGCGTCCGGAGGTTCATCACCCGCGTCCAGGAGCGCGGGTCCTAGTTCTGGCAGGACCTCGGGTCAGTCCACACCACGAGCTGGAGATGTAGATCCTGGAGATGGCTCACAACCTCCACCGAAGAAGAAGCAGAATTCAGGGCGGAGTTCAGGCCAAGCCACACCTCGAGCTGGTAGCCCTGGGCAAGCACAAGCGAGGTGACTATTTCTCACTGCGCTCACTTCTCAGGAACTTGTCTGCTTGCGACAAGGCCCCGTGTCTTACAGATCGAAGCGGGACTGGTTATGTACTGAGGTCTACAAAATGGTGTTGATTTCTTTTTTCTGCTGGGTTTATTATGAATCTGAAGATACGTTCTCTTAATTCTTAATTCTTAAGAACGGAAGTCAAGCGCATTACTCTCAAGCGCATTAGTGTCTCTGAGGTTCTCAACAGAACGAATCCCCCGTCGCACACAAATTGCTGTCCGTGGCCTCTGTAACGTTTGTCAAAGATAGGATTTTAAAGACCCCATAGCCTGGTGCGGATTCCCCAAGCCTGCTTCCGCCACTTCCATGTTCCCTGATCTGTAATAGTCTAGCTAAATGCTTATTACTAGGAGCCAGGCCAAGGACTACTTTCAATATTAGAACCAAGAGCATTGTCACCTTGGACTGGATTCAGACATATTCTGGTGGCTTGCACGTCTCTGATTTTTTGAAAATTTCCTCTCGTGTCTAGGATTCTGTATGGACTTCATTATTCTAACTCATAATGTTAACGGTTCCATTCTGAAAACGGCCGTTTGGTGCCATCGTCACACGTAACTTCGAGCTTCAATCTTTTGAAACGTAATCCCGCAATAACTCTGAGTTGACATGGTTCAAGTAGATGCAGTGTCCTCTTGAGTACGAGGTGTTGCAGCAGACAGAGGTGTAGTTTTTAATCAGAGAGTTTCCACCTTTTCCCTCGACGAAGGTTATCGTGTCTTATTATCCTGAAATGATCGTATCAGATTCTCAGGATACTTACGTAGGTGAAGCCTTCAGGCTTTTTGACCTGCACTCTAGACTTTATACTTATGTAAGAAGTCAAAGAAAATTTTATAAATAACAGTTGCATGGAAGTAAGACAAGAGGTCGTTTCGAAACACAATCACAAGATTTGACGATATCCGACTTCATTGCAGTGGTTCCGATCAGCCATCGCAAACACAGATGTCTGCGGGAGGGGCAGCAAACCCAAACCCTGATGCTGGGCTCATTCCAGCACTTCAGACTGCGTCAATAAACCCTGGCTCTGACCCCCAGGCCTTCCAAAGCTTCCGGCTGACCGAGCAAGAAGTACGTCGTGCCATTGAATGTGCTACAGTTCAAAACCTGGCGACAGGAGTTCCTCAGGCGATACCAAGCGTTGCAGGTGTACCTCAATCAGCCAATTGGCTTGAACAAGCCTTGATTAACGCTCCCAATAAACCGCTCGACGAGGATCTTGGCGGGCCTCCAGAACTGGGAGAAGAAGATGCCGATTGGCTTGGAGACTTGTTGTCCGATGACGATGAAAAGAAAAAGAGACAAGATGGCGGATCTCCTCCTCAATTATTTGTCCCTACAAGAGTTCTTCCACCAGAAGGCCAAGAATCAGAAGATGATCTCATGAACTTGAATGAGATATTGAATCAGCGCCCAGACCTTGAAAATCCCGGAGAAGATACCCTCAAATTTCTTGAACTGAATGACTTACCCAAGCCTGGAGATCCAACTTGGGAGGAATTTTTGGAATCTCGACGTCCAGCTCCAATCAGAACACCAGACCGTATTAACACGGATCAGCCTGCACAAGATGGAGTTAGACAGCTGACTGTCGACGAGATTCTTGCTCTTCGTACACCGTTTAATCGATCGGGGGATTCTCCTGATGCGCAATCTGCAGACACGTTACATCCCACAGACGCCCATAAACTTCGGTTATTGGACTGGATGCGGTACCTCGTCGCAGCGCAGCGTAGACCCAGATATTTGGACCGACCTGAGCAAGGAGAAAGATTACTGAAAGTTTTCGAAGAATTCGATAAGTCCTTCACGGATGCCAGTCAACAGCTGAACGTACTACCAACTGTCGAACACCAGGAGAGCTCGAATTCCATTCGCCTTAAGATCTGGAAGGAACAGCGACAGAGAACGCCTGCCAGACAACTACGCCCACTACCTTTGACTCATTATGAAGGGCAGATTAGTGAATGGGCAAAATATCTGGAGACAATGAGAGATACTCCTCTACAATTCGAAAGCAGGGAGAGCAGAAATTCGTTCGCCAGTATACTGCGAGGACTGAGGATGGAACTTCTGAACACCATCAAAACAGTGTTCGCCGATTATATTAAGCCACCCGATCCTCCCGCCGCTCCTCCCGCCGCTCCTCCCGCTGCTTCCGATCCCGCCGCTCCTCCCGCTGATCCCTTCGCTCGCCCTCGTCGCGGTCGTAAGGCTCGTCCCGAAGCCCCTGCACCCGCCAATCCTTCACCTGGTCCTCCCGCTGTTCCTCGGGGTCCTCCCTGGTCCCCTCCTCCGGGGCTGTTTGTGGTAAATCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAATCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAACCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAACCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAACCCAGCGGGTAGTCCTGGTCAGGAGGATGCTGCAGCCCAGCAAGCAGCCTCGATCCAAGGGTCAGAGCTCGGGATGAAGATTGTGGACTGGTCGTTGTACATCTGTGCAATGAGGTTTACATGGCAAAGGCTGTCGGGCAGAATCCAGCCGGCCTATGCCCGAGACTACTACTCTGCATTCACAGAGCTGCACAACCACCTGAGGCCTGTGATGAGCAGAACTCTGACTCAGCAAGAGTCCAGCACGACTCTGGAAGCAATGGGATTGAACGGGTACCGCATAGACTATCGACGTCGACTGCGATCGTCTACGCGGTTGATAGCTCTCCTGCACGCAGAGCACGACTTGATGCTGCTGCAGAAGGCTGACATGTGGTATTTCTCCTCCTGGATCCAGTACTTGGCCTCGCTGGCCTTAGACAGCCCGGTTGTCGTTCCCGGCAACCGGATACAGTTCCTGATCGTATACCACTCTTTCTACGACGAAATGTACGACACCGCCTGCGCACTCCTGGGGAGACCCCTGGGTAGACTTCTGGATGTGGAGCCCATACGTCACGGCTTGGACTGGCAGGGAAAACGGCGGGTTGTGGATCAAGCTCCGGCCGGTGCCGCACCGATGGAGGTCCGCCAGTCGTCGCCAGCCGATTCGCAGTCCGAGTCGGACGGACCGCCAGGGACCGTAGGTCCGATTTTCAATCCTGTATTTGGGAGAATGAGGATGCCAGACAGGAAGCGACGATTAGAGGCTGAGAAAATTGCTAAACTAGCTGCTGAGAACGATCCCAGATCCTTGAATCACCCCGCCGTGGAGGCCCGAGTAGCGCCGGAGTACCGAGAGACGACTGTGGTGACACTCTTCGAAACTGTGGAACATCGAACCAAAAACTTCAGGGCAATGGGGGACGCACGAGCACGAGCACGAGCAAATAATGAGGAGGAGGCACAAATAGGTGTTCCCCGATATTTGACTGCAGAACAGGTGGCTGACCAGCAGGAGTATCACAATCTGTTCCTCCGAGAACTGAAGAGATTGGAGATGGACGTTTCGCTTGCCGTCTTGGGAATAGCCAAGTATCAGCATATGCCTCTCCCCCTGCAGAATGACCTCAGATTTTACATCATCGCCTACCACGTGAGTGACCACCGTGATGCAAATCTCTTCACCGCATCTTACCTGACCGACGAGCTGCACTCTCAGTGCAACATAATGAGATTCAGATTCCATCACTTGTCCATAAGTTTGAAATGTGACGATAAACTCTTATATGCATCAGTGGTAGCACTAGCATCTAAAGTGAACATGGACACTTTAGTAGTTTGGACATGTTGGGATGTGTTTTCAACTATCGAACTATCAAATGGTCACTGGTGTGTTTTCATGTTACAGAAATTCATAAAAGGTGAAGTGGATCATTGTCACCACCTATGTCCTCAAACTCTACCCGCGGCAACCTGCAACTGCTATTCTACAAAGTTGGGCCCTTTAAATGCTTTCATAGATCGCCAACTTTTGCACAAAAAAGCATTGGACATGTATGTAAGAGTAAGTTCTTTCTTTTAACCTCTCATCAGGAGTGAAAGAGACATGGATCTCAAAAAGCAAGACAGATTCAATAGATATTTGTATATACTCGATCTGATTCAGGTTTCATTCCAAATGTTGGATTTTTTTTCAAGGAAAGATATCTAACTTGTAATAGGAATTAAATTGAACTACAGGACGTGAGTAAACTACTTTTTGATTGGTGTCATGCAAATAATGTTAAAACACTTCGTGTTCCAAAATATGTGGAAGAAGCTTTCAGGTGAGATGAAGCATTCTATATCTTTTACGCTTCAGTCTAAAGTTAATTGGAGTGTTTTAAGCCCTTCATAGTATATATATATAGTCACAAAGCTTAATAACATTCCAAAATAATATCTCGATGGATAGTAGAGTTTTAAATATTTAATTGAAATTTATTCGCAAAGATTACTTATTATTATCATATAGTTATGGAATTTAACATTGAAAATCTACAGAGAATGGAATGAAGTTCATCGTAAAAGGACAAACGCTTCACTCCAAGAATGGCAAGAGCTTAGTAGGAAGACTGGAATCCCAATGAAACAGGTGTCTTTTGTTCCGAAATTCCTTACATTTTAATTGAAAATATATGGTTGAATATAAACCAGTTCAAACATCTACATGCTTTTATCTGTTAATAAAATATGTAATATGACTTAGAAAGACGTTTATGTTGCCAAATGAATAAAATTGCATAATGAGGTTAACGTTATGTGAGCAGATTAAAGTTTCAGTACGAGGCTTTAAAAGAATGATTGCCGGTGAAAGAAGAACAGATCCAGTAACAGGTCTTAGCGTCCAAGCACAACAAGCAAATGAACCAGAACAGCCCCAACAAGCTGCACAACCAGAACGAATTGCACCACGACAGCCTCCTTGGGTTCAGGAAGTTGGAACTCAAGTGTACAATTTTTTAAAGTAATTCTCGCTTTCTACTTCATTTGAACGATTAAAGATACATTATTTTATTATGATGAGAATATTCAATAAACTCATAAAATAATGTCTTAAGTCTTTCATCATATTACATGATATTTCTAAAATAATTGAAATTTTCATATATCTATTTCTTTCAGATCTTGGGCAGACGAACATCGAGAATATGCGTTTCCGATTGACATTGAAATGGACCAATTGACGAAATATACAGGAATGACTAAGAGTCAAGTAAGTATGATGATATTCTGTTATTGAAGATATAATTGCTTTCAACAAATGACTTTGGAAAAAGTATAATTTTTTTGACTTTCATTTTTCTAAAAATTTAAAATTTAAAATTAGATGAAAATATGATTCTATGGTTGAAGTAAGTTTTCGAATATTATCAACTTTGCAGGTTGGCAGATGGCTGAAGGACTATCGAGTTGTTAATAATTATTTCAGTGTTTTTTCTTGTTCTATCCAGGCCAAATTGAATAGGTATGTACAGTCCAAAAATTCAAAATATATTTTTGATTTACGAATTTTTTAATTTATTACTAAAAATATAAATCGGTTTAAAGTAAATTTATTTATTATCATCTCTAGAAATCATTTTGAACATGACTATTAGATGTTGACATTGCATGTTAAATTTTCAAGATGATTAAAATTTTCATGTCTTTTAAATCAAGTTTGAAATGATTAGAAAAAAAAATTTCAAATTTTTCTGTTTTCTTTATTTCACCCCTCTAAATTTTATTGGTTTTGTTAAAATAAAAAATTTCACATTGATATTGCTAATATTTTGACTTCTAAATATATAATTCTAATCTCGTATTTTTACCAATAAGAAGAACATGAAATTGATTGAATATAAAAATCTGTCATGATTTTCAAATGTGCAGTTTTTTGGGTTTAGAGTCAATACAAAATAAATTTTTAATTGTGGAATATGACTTCTAAAATTCGATTGGGTTGTTATTAAAGGCAAGGTAACGGAGAAGGAATGGGCCCAAGGTATGCATTAGTAGGTGCTCCAATTCAGAATCCTCAGATAAATTTTTCTCGTAATCGGAGGAACAACAATGGGAATCGTAATAATGAGGCGGAAAGAAAGGCAAAGTCAGATGAAGATGTGGTCATGGCAGATCCAGCCGGTCCAGCCGGTCCAGCCGATGCCCCATTGCAGCCTGTAGAGGATGTGGTCATGGCAGATCAAGCCGATCCAGGCGATGCTCCATTGCAGCCGGTAGAGGATGTGGATTTGGATATGGCAGAGTGGCAGGGTTTTATAGAAAATAATCTCAAAGAGAACGAGGAAAGATTCCGGAACGATGCTGCGTACCTGGACCAACAGGCGATCCCTCAGAGGAATTATGTCATCAACGAGGATGGACAAATAGTTCCAGTCGATGCAGGCGTCGCGCAGCAAATTCAACCCTTGGTCCAGTGAGTCATCATCATCTAGACCCCAAATCACCCATTTTTTTTGCCGCATAGGATAACCAATTAATAAAAAATGAACACATTCCAACCAGTTCCCCAAAAAATTAAACTTGTATTTTATTAGGACCGAGGACTGATCCGAACATAGGGGCGCCAATTGAGATTGTTTGAATCATCTTTTAGCTCGGGCTAATTGGTTTTGAGTATTCCATCTCACCTCTAGAACGACAGGAAGTTGTGGTCCAGTGGATCCGGTGTATGTACGCTGGGGAAAAGCTGTGTCTCACTTGTACGTGGATTTCCCTCTGCAGACCAGGACAAGCGTCCCAACCAGGCTCACCGGCACGAGGAGGCGGACCCGCGGGTGCCGTCGATCCCATACTGCCGGACATTCAACCGCGCCCACTGGGAGACGGGGGCGGACCCGCGGGCGCAGTCGATCCCATACTGCCGGACATTCAACATAGCCCACTGAGAGACGGGAGCGGACCTGTGGGCGCAGTCGATCCCATACTGCCGGGCAATCAACCGCGCCCACTGGGAGACGGGGGCGGACCCGCGGGCGCAGTCGATCCCAGACCAGCGGATCCCGAGCAAAACCCTCTGGATGGCGCGCGCGGTGAGATCCAAGCCTTGAACCAACAGGGCCAGCTGCCGCCGGCCGTTGCCGCGGAAGCGGTGGCCAATATCGACAACCAGGGGGCCGCAGGCCGCAGGGCGGACGACGATGGGGAGAATCTCGCGGAACTCGCGAATGGCGCGATTATCGACCTAAACGCTCGAGAACGCATATTGACAAACAAATGGGAGCCCCTTCTCGCCCACGAGACGGACCTCCGCTTGCGCTATACGTCGCTGATCAATTACGCAATTTTCAAAAGCCACGCAAAAAATTTTCTGCGCGAACGGAGCAACGAATTGAACAAGCTCGTCGTATCTCACTTGGCAAGTGTCTTCAACTCTGTGCATGGGCTGGGCATTCGCCTTTCGTTTTCGTCTCGAGGTTGTTCTCGCACGATGTGAGATCGGGATGCTGTCTGCGTATAGAATCAGTTTTAAAGTCTCCGATGGACCTCAGAAACTTCTGTTTGATAAGAGCAGGCGGGATCATGACGTTTGGCGCCTTCTCGCTTTGATAGTTTCTGCATCCTTTGTAAATCAGCCGCTATGTTCTCGAATGTCGAGAGCCTAATTGGGAGCCTAAGTCCACTCTAGTTAAGTATCCTAGAAAACTGGCAGAAAACATAATTACTAGCGGTCTGCGAGGGTATTGCCATCATTATAATGACATGACGAATTGGTCTCCAACTTACATGCTTTTGATGAATGCTTGCAAGCGGGACGTAAGGTAATGAAACTCTCAGTCTATGAGATGAGGTTCTAACACTCAAAGGACTGGATGAAATTTTCGGACAGTTTTGAGAGATATAGTGATTTTGATGGACATTTGACGTGTTTTGATCGACCCAGAATATCCTATTTCAATTCATGGATCTGTGAAATTTGAAGCGCCATAGGGTCTTATTAATAAATTTCCCTTGCAGGCCTTTTCAAAGCGTACTCCTGTTCATACGTTCGTGGATTGTGTGGATGCAAACGAAGTGCGTGCGTGTTGTTACGATAAAAGATATGGTGACATAGATATCATTCAAGGGGAGAAGGAACGACTGGACGCTAGCTTCCAGAGATTTGATGCGGTAGGCACCTTATAATCATCTTCGATGTATGAGCCAGATTTTTGAGCCTTGCCTGAAAGAGAGCAAAATTGATAACACAAATTGAAAATTCAATGCAATTCAGATTTCAAAACATAGAAATATGATTATTCTGGGTTGAGAGCATTTTCACCATTATATCATTCATCCTGCAATTGCAGGTTTTAACCTCGGGAATGTCAGTGTTTTTCCTCCATGCTCAGGCCAAGCTGTCTTGCTTGATAATTAACACACCTATGAACTCCATATTAATTATTCTAAACAGTTAACTACATCTGGAAGTTAAGTCAGATCGGCTAGCCATTTAAAAGTATTTTTCAGACATTTCGACATCTGGACGCTCCAGAAATCTTTTCTTTAGGCAATCTCGACTGTGACATTTCTTATTGGTGCATATATGCTGTCCCTTATTGATGTGGGCTTAAAGTATTGTCTTCTTGATAAAGAGCTTTATTTAATCTCTACTGGTGTCGCGATTCTTTAAAGTCATCGAACGGGAGGCCACGTAAATATCAAAAAAGGGTGAATACTTTATTTTTCAGCCTCAGTTTTTTCTCGAAGAGGAAAAACGCATGTTCTAACAATTTTGTTATGATAAACCTGGCATTTCATACTATGCAGATGATTATCAGATGGGTGTCAATTTATTGCAATACTATTGACAAAAGATCCAGAGTTACGTTACCAGGGTTTGTCGTCCGCTATCTAGAGTAAGTATTGATGCAAGTCTTACTACAAAACGCGTAATGAACATTTATCAATATATGAACTATCCGTATTTTTCCCTCGAGCCTTTATATTTTTACTCCCATCTTTTATAGTGTTGAGACCTCTGCACTCTTATCTGTGATATGCAGTCTCGCAATTATGCATATATTCGGTCTTCTAAAATCTAGTACATCAATCGCTCAATGACACCCACTGTAGTGGTCTTCTAATCAAAACCAACTCTCGTTAAATGAGTTGATAGCGATATACACATTCAACACATATTTTGTTTTCTTCCTCCAGTTCATACACGTTCTATTGTGTTTTTTCTTTAGTAAGTTCTATCTCTCAAAGATGTTCATTAAAGATCCAAAATGTACCAGACGAAGAGATAAGCAAAACCACCTACTGAACCCCTCTTGTTTTCTGCTTTGACAGCGCCTGGTGCATCCAGCATCCAGAAGTTGGCGTTGTAACCCACGAAGACTACACTCGTTTTGAAAGTGAGGTCGGCGTACAACTCAGACAGGTACAATACGAACTTCTTGAGACTAGACCTGTACGTGTTTCACACACATTATAGGTTCTTCACTCCGTTCAGGAGGTTTGTACATTATTTCCGCTTTTGTCATCGAAAAATAATGCAATCAGAAATTCAATGCTTATCTCATAGAGACTGCAAAAACCCAGCGCAGTAGAACGGACAAGCACTGATGGAATCATATCACAATTTTTGGAACAGGTCCTGAAATTTGAGTGAGTGAATATATTATGTGCTTCCTCGGGTTTCCTCAAAGAGATTGTCCTCCCATGCTATTATGATGTATATCTAGATTAAATTTTCATCCTCTTTGTGTATATGGAGACTCACATTTTAGAGCTGTAAACGTTAACATTGTAAGTAAGTTTATTTCGCAACAAATGTTCTAGATATTTTCAATCGGAAGAATTTTATGCCCATGATACTCAGGAACTAACTCCCTTCGTATTTCCATTACATGTTAAAGGGATCGAGTTTTTTAAGGTTTTGGAGACAACAATGCGTGAAAAACAAACGAGCAAAAGCAGCAGGGGCTAAGAGGGAGATACAAGTATTTCAAACCAATTGGATGAAGTAAGTTTCTAAATAAAATTTAAGTTCATATAATACAATTAAATAATTAATCAAACATTGATTGCATTGCAAGCGATACTTAGCTCCAGATTTTTTCAATGGGAATTATTTTGATATCCTCACAAATATATAAATAAGCAATTAAGAGCCACGGAGACGCATCAAATCTTGTAACTCATGACCAACGAAAGCTTTGTACCAGCTTATTTTCAACTTACTAAAACTCACGCCAAGATTTAAGCTCTGCTGCATGTTTTGAGTGCATAGAATGCTGATTTGAGAACCCAATTCATTTCAACAGAGAATGGTTTGAACAAAATTTGAATCGAGCATACATTACCGTTGATAATTTACGAGAGTTGACGCAGAACACGGGTTTGACTAGATCACAGGTGTGTTAATCTCCAGACTTTCCAGATGTGAAGAAAATAAAAAGGAAAAAGTCAAAAGATATATATATATATATATATATATATATATGGTTTTTCGTTTATATTTGTAAACTTGACTTTCGATATGATGGCGTTGATATTTAGGAAGCCGGAAAGATTCCAAGATGCAAATTTCACTAAATCTAATAAAAAAAATTGGTCCTGAATAAAGAAGACTAATTACTTAGTAGTAAAACCTGCACACTGTGGCCCATATCAAGTACTTAGCCATATAAATGACTGTGACGCTTTATGCACAAACTTTTAGCACAAAACTAGTATCCTTTACTGAAGGTTTGTTACTTAGCCATATAAATGACTGTGACGCTTTATGCACAAACTTTCAGCACAAAACTAGTACTTTTACTGAAGGTTTGTTTCTTCAGTCAAATGTTGTGGCTTTTTACTTTGAATTTGCAGCCAACGTGCAAACATAAAGCATGCTGGTTTGAGCCGACTGCAACTTTAGATAAAAACGATGGGATATCTCGATGGAACAGCCATTTCGAACACACCATTCAGTAGCATGTGTTTTAAAAATTGAAGCACTACAGGGTTTAAATTAGTCAAGCTATGTGACCTGCAGGTAATAAGATGGCTTAAAAATAAGAGATTTATCAACAAATTTAGAAGAATTGAACGAAATGGGATTTATTGGAGATTCCGACCTTGGCAGCCTGGTGACGAACTTAAGGAGAATTTAGCTTATAACACGAACCTGGGGAATCCAGGAGATGACGAAGATCCTCAAGAAGATGTCCTTGCTGCTGGCTAGTTTTACGATTTTCACTTCTTAAATCATCTTTAAAAATATTTAATCTCTGAAACCAAAAAAAACTGGAGGTGTTTTAATCTTTTCATTTTATTTGACAACAAAAATTTTACATGAATTTGTAAATTTTTTTGTTCGCTTCTTTGTATAGACTCGTATTTCATTGATTTTGTAAAGCTGATCTTATATGCTTCTATAAATCGAATAATTTTGCG

mRNA

>Mapoly0013s0027.1
AGCAGAGCAGCTCCAGATATTGCACAAAATGCGCTCCGCTTCGAAGGAGCCAAGCGATCTCAATTCTCGTGTAAAAACTCGAGTTCTTTGTAGGCTGAGAAACTTCTCACTTTTTAAAGAGGACGGCTCAGCTCTTCGACTGCACACACACGTCGAAGATTTGGACTCGATTAGCTTCCTCCTTGACACAGCAGTGTTGGAGGTCCAATTTTCGTGACTCGAGCGCAACTGCGTAACTGGTAGGAACCAGTGCGTGGAATGCGAATGCTCCATGTAAAATATTCATAAGCAAGCCAGTGGCAGAAGGAGGAACGACGTGTTGGTAGTATCCCTGACACATTTTTCTGGTCTGGAAGATCGAGGCGAATGCGGTATGCTTTGTATCCTGAGGTAATTCGCCCTTAATGTCTTCTCGACTACAAGATGTCAGTGGATTCGTTGTCGTCGGGGGATCGGCAGATTGCTCGTAAAGTCTTTCAGGAATTTGTTCCAATGAGCGATACACGCTTGTAATTGGACCGATCTAGAATGGGGATAGCATAGCTGATTTCTGGAGGTACTCGAAGTCGATGACAGATCTCAGACGTTTCCTGCATTCAAAAGCTAATTTGCAACAAAAAGCCCACCCAGAAACTGGAAGCTTATCAAAAGTATTTCAACCAAGGGATAAGCACAAGTAGGATTAGCAGAAGATGCACGAAGTCGGACGAGAAGCTGGCTCATTAGACTCGATGGCAAGAGAATAAACACATGTAACAAAACACAAGCGACATCAGATCCAGGATGTCGTCGAAGAAGCGAAAGGACCGTGGGGAGGATGAGGGACAAGGGCAGGCAGATGCACCTGCACCAGCAGGCTCTGGGGCGAGTGGCGGTGGCCGGAGTCCAGCTCGTGCCACCGGATCTCCGAAATCCGGCGGCCCGTCCGGTCGGAGTCCGAGTAGATCACCGAAAGCCGTCGATTCTGCCGGGCAGCCGCAGCCTGCGAGTCCAGGAAAAAGTGCTCCCGGCAAATCTAAGAACGCGGGTCAGGGTTCGAGTGCGTCCGGAGGTTCATCACCCGCGTCCAGGAGCGCGGGTCCTAGTTCTGGCAGGACCTCGGGTCAGTCCACACCACGAGCTGGAGATGTAGATCCTGGAGATGGCTCACAACCTCCACCGAAGAAGAAGCAGAATTCAGGGCGGAGTTCAGGCCAAGCCACACCTCGAGCTGGTAGCCCTGGGCAAGCACAAGCGAGTGGTTCCGATCAGCCATCGCAAACACAGATGTCTGCGGGAGGGGCAGCAAACCCAAACCCTGATGCTGGGCTCATTCCAGCACTTCAGACTGCGTCAATAAACCCTGGCTCTGACCCCCAGGCCTTCCAAAGCTTCCGGCTGACCGAGCAAGAAGTACGTCGTGCCATTGAATGTGCTACAGTTCAAAACCTGGCGACAGGAGTTCCTCAGGCGATACCAAGCGTTGCAGGTGTACCTCAATCAGCCAATTGGCTTGAACAAGCCTTGATTAACGCTCCCAATAAACCGCTCGACGAGGATCTTGGCGGGCCTCCAGAACTGGGAGAAGAAGATGCCGATTGGCTTGGAGACTTGTTGTCCGATGACGATGAAAAGAAAAAGAGACAAGATGGCGGATCTCCTCCTCAATTATTTGTCCCTACAAGAGTTCTTCCACCAGAAGGCCAAGAATCAGAAGATGATCTCATGAACTTGAATGAGATATTGAATCAGCGCCCAGACCTTGAAAATCCCGGAGAAGATACCCTCAAATTTCTTGAACTGAATGACTTACCCAAGCCTGGAGATCCAACTTGGGAGGAATTTTTGGAATCTCGACGTCCAGCTCCAATCAGAACACCAGACCGTATTAACACGGATCAGCCTGCACAAGATGGAGTTAGACAGCTGACTGTCGACGAGATTCTTGCTCTTCGTACACCGTTTAATCGATCGGGGGATTCTCCTGATGCGCAATCTGCAGACACGTTACATCCCACAGACGCCCATAAACTTCGGTTATTGGACTGGATGCGGTACCTCGTCGCAGCGCAGCGTAGACCCAGATATTTGGACCGACCTGAGCAAGGAGAAAGATTACTGAAAGTTTTCGAAGAATTCGATAAGTCCTTCACGGATGCCAGTCAACAGCTGAACGTACTACCAACTGTCGAACACCAGGAGAGCTCGAATTCCATTCGCCTTAAGATCTGGAAGGAACAGCGACAGAGAACGCCTGCCAGACAACTACGCCCACTACCTTTGACTCATTATGAAGGGCAGATTAGTGAATGGGCAAAATATCTGGAGACAATGAGAGATACTCCTCTACAATTCGAAAGCAGGGAGAGCAGAAATTCGTTCGCCAGTATACTGCGAGGACTGAGGATGGAACTTCTGAACACCATCAAAACAGTGTTCGCCGATTATATTAAGCCACCCGATCCTCCCGCCGCTCCTCCCGCCGCTCCTCCCGCTGCTTCCGATCCCGCCGCTCCTCCCGCTGATCCCTTCGCTCGCCCTCGTCGCGGTCGTAAGGCTCGTCCCGAAGCCCCTGCACCCGCCAATCCTTCACCTGGTCCTCCCGCTGTTCCTCGGGGTCCTCCCTGGTCCCCTCCTCCGGGGCTGTTTGTGGTAAATCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAATCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAACCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAACCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAACCCAGCGGGTAGTCCTGGTCAGGAGGATGCTGCAGCCCAGCAAGCAGCCTCGATCCAAGGGTCAGAGCTCGGGATGAAGATTGTGGACTGGTCGTTGTACATCTGTGCAATGAGGTTTACATGGCAAAGGCTGTCGGGCAGAATCCAGCCGGCCTATGCCCGAGACTACTACTCTGCATTCACAGAGCTGCACAACCACCTGAGGCCTGTGATGAGCAGAACTCTGACTCAGCAAGAGTCCAGCACGACTCTGGAAGCAATGGGATTGAACGGGTACCGCATAGACTATCGACGTCGACTGCGATCGTCTACGCGGTTGATAGCTCTCCTGCACGCAGAGCACGACTTGATGCTGCTGCAGAAGGCTGACATGTGGTATTTCTCCTCCTGGATCCAGTACTTGGCCTCGCTGGCCTTAGACAGCCCGGTTGTCGTTCCCGGCAACCGGATACAGTTCCTGATCGTATACCACTCTTTCTACGACGAAATGTACGACACCGCCTGCGCACTCCTGGGGAGACCCCTGGGTAGACTTCTGGATGTGGAGCCCATACGTCACGGCTTGGACTGGCAGGGAAAACGGCGGGTTGTGGATCAAGCTCCGGCCGGTGCCGCACCGATGGAGGTCCGCCAGTCGTCGCCAGCCGATTCGCAGTCCGAGTCGGACGGACCGCCAGGGACCGTAGGTCCGATTTTCAATCCTGTATTTGGGAGAATGAGGATGCCAGACAGGAAGCGACGATTAGAGGCTGAGAAAATTGCTAAACTAGCTGCTGAGAACGATCCCAGATCCTTGAATCACCCCGCCGTGGAGGCCCGAGTAGCGCCGGAGTACCGAGAGACGACTGTGGTGACACTCTTCGAAACTGTGGAACATCGAACCAAAAACTTCAGGGCAATGGGGGACGCACGAGCACGAGCACGAGCAAATAATGAGGAGGAGGCACAAATAGGTGTTCCCCGATATTTGACTGCAGAACAGGTGGCTGACCAGCAGGAGTATCACAATCTGTTCCTCCGAGAACTGAAGAGATTGGAGATGGACGTTTCGCTTGCCGTCTTGGGAATAGCCAAGTATCAGCATATGCCTCTCCCCCTGCAGAATGACCTCAGATTTTACATCATCGCCTACCACAAATTCATAAAAGGTGAAGTGGATCATTGTCACCACCTATGTCCTCAAACTCTACCCGCGGCAACCTGCAACTGCTATTCTACAAAGTTGGGCCCTTTAAATGCTTTCATAGATCGCCAACTTTTGCACAAAAAAGCATTGGACATGTATGTAAGAGACGTGAGTAAACTACTTTTTGATTGGTGTCATGCAAATAATGTTAAAACACTTCGTGTTCCAAAATATGTGGAAGAAGCTTTCAGAGAATGGAATGAAGTTCATCGTAAAAGGACAAACGCTTCACTCCAAGAATGGCAAGAGCTTAGTAGGAAGACTGGAATCCCAATGAAACAGATTAAAGTTTCAGTACGAGGCTTTAAAAGAATGATTGCCGGTGAAAGAAGAACAGATCCAGTAACAGGTCTTAGCGTCCAAGCACAACAAGCAAATGAACCAGAACAGCCCCAACAAGCTGCACAACCAGAACGAATTGCACCACGACAGCCTCCTTGGGTTCAGGAAGTTGGAACTCAAGTGTACAATTTTTTAAAATCTTGGGCAGACGAACATCGAGAATATGCGTTTCCGATTGACATTGAAATGGACCAATTGACGAAATATACAGGAATGACTAAGAGTCAAGTTGGCAGATGGCTGAAGGACTATCGAGTTGTTAATAATTATTTCAGTGTTTTTTCTTGTTCTATCCAGGCCAAATTGAATAGGCAAGGTAACGGAGAAGGAATGGGCCCAAGGTATGCATTAGTAGGTGCTCCAATTCAGAATCCTCAGATAAATTTTTCTCGTAATCGGAGGAACAACAATGGGAATCGTAATAATGAGGCGGAAAGAAAGGCAAAGTCAGATGAAGATGTGGTCATGGCAGATCCAGCCGGTCCAGCCGGTCCAGCCGATGCCCCATTGCAGCCTGTAGAGGATGTGGTCATGGCAGATCAAGCCGATCCAGGCGATGCTCCATTGCAGCCGGTAGAGGATGTGGATTTGGATATGGCAGAGTGGCAGGGTTTTATAGAAAATAATCTCAAAGAGAACGAGGAAAGATTCCGGAACGATGCTGCGTACCTGGACCAACAGGCGATCCCTCAGAGGAATTATGTCATCAACGAGGATGGACAAATAGTTCCAGTCGATGCAGGCGTCGCGCAGCAAATTCAACCCTTGGTCCAACCAGGACAAGCGTCCCAACCAGGCTCACCGGCACGAGGAGGCGGACCCGCGGGTGCCGTCGATCCCATACTGCCGGACATTCAACCGCGCCCACTGGGAGACGGGGGCGGACCCGCGGGCGCAGTCGATCCCATACTGCCGGACATTCAACATAGCCCACTGAGAGACGGGAGCGGACCTGTGGGCGCAGTCGATCCCATACTGCCGGGCAATCAACCGCGCCCACTGGGAGACGGGGGCGGACCCGCGGGCGCAGTCGATCCCAGACCAGCGGATCCCGAGCAAAACCCTCTGGATGGCGCGCGCGGTGAGATCCAAGCCTTGAACCAACAGGGCCAGCTGCCGCCGGCCGTTGCCGCGGAAGCGGTGGCCAATATCGACAACCAGGGGGCCGCAGGCCGCAGGGCGGACGACGATGGGGAGAATCTCGCGGAACTCGCGAATGGCGCGATTATCGACCTAAACGCTCGAGAACGCATATTGACAAACAAATGGGAGCCCCTTCTCGCCCACGAGACGGACCTCCGCTTGCGCTATACGTCGCTGATCAATTACGCAATTTTCAAAAGCCACGCAAAAAATTTTCTGCGCGAACGGAGCAACGAATTGAACAAGCTCGTCGTATCTCACTTGGCCTTTTCAAAGCGTACTCCTGTTCATACGTTCGTGGATTGTGTGGATGCAAACGAAGTGCGTGCGTGTTGTTACGATAAAAGATATGGTGACATAGATATCATTCAAGGGGAGAAGGAACGACTGGACGCTAGCTTCCAGAGATTTGATGCGATGATTATCAGATGGGTGTCAATTTATTGCAATACTATTGACAAAAGATCCAGAGTTACGTTACCAGGGTTTGTCGTCCGCTATCTAGACGCCTGGTGCATCCAGCATCCAGAAGTTGGCGTTGTAACCCACGAAGACTACACTCGTTTTGAAAGTGAGGTCGGCGTACAACTCAGACAGGGATCGAGTTTTTTAAGGTTTTGGAGACAACAATGCGTGAAAAACAAACGAGCAAAAGCAGCAGGGGCTAAGAGGGAGATACAAGTATTTCAAACCAATTGGATGAAAGAATGGTTTGAACAAAATTTGAATCGAGCATACATTACCGTTGATAATTTACGAGAGTTGACGCAGAACACGGGTTTGACTAGATCACAGGTAATAAGATGGCTTAAAAATAAGAGATTTATCAACAAATTTAGAAGAATTGAACGAAATGGGATTTATTGGAGATTCCGACCTTGGCAGCCTGGTGACGAACTTAAGGAGAATTTAGCTTATAACACGAACCTGGGGAATCCAGGAGATGACGAAGATCCTCAAGAAGATGTCCTTGCTGCTGGCTAGTTTTACGATTTTCACTTCTTAAATCATCTTTAAAAATATTTAATCTCTGAAACCAAAAAAAACTGGAGGTGTTTTAATCTTTTCATTTTATTTGACAACAAAAATTTTACATGAATTTGTAAATTTTTTTGTTCGCTTCTTTGTATAGACTCGTATTTCATTGATTTTGTAAAGCTGATCTTATATGCTTCTATAAATCGAATAATTTTGCG

CDS

>Mapoly0013s0027.1
ATGTCGTCGAAGAAGCGAAAGGACCGTGGGGAGGATGAGGGACAAGGGCAGGCAGATGCACCTGCACCAGCAGGCTCTGGGGCGAGTGGCGGTGGCCGGAGTCCAGCTCGTGCCACCGGATCTCCGAAATCCGGCGGCCCGTCCGGTCGGAGTCCGAGTAGATCACCGAAAGCCGTCGATTCTGCCGGGCAGCCGCAGCCTGCGAGTCCAGGAAAAAGTGCTCCCGGCAAATCTAAGAACGCGGGTCAGGGTTCGAGTGCGTCCGGAGGTTCATCACCCGCGTCCAGGAGCGCGGGTCCTAGTTCTGGCAGGACCTCGGGTCAGTCCACACCACGAGCTGGAGATGTAGATCCTGGAGATGGCTCACAACCTCCACCGAAGAAGAAGCAGAATTCAGGGCGGAGTTCAGGCCAAGCCACACCTCGAGCTGGTAGCCCTGGGCAAGCACAAGCGAGTGGTTCCGATCAGCCATCGCAAACACAGATGTCTGCGGGAGGGGCAGCAAACCCAAACCCTGATGCTGGGCTCATTCCAGCACTTCAGACTGCGTCAATAAACCCTGGCTCTGACCCCCAGGCCTTCCAAAGCTTCCGGCTGACCGAGCAAGAAGTACGTCGTGCCATTGAATGTGCTACAGTTCAAAACCTGGCGACAGGAGTTCCTCAGGCGATACCAAGCGTTGCAGGTGTACCTCAATCAGCCAATTGGCTTGAACAAGCCTTGATTAACGCTCCCAATAAACCGCTCGACGAGGATCTTGGCGGGCCTCCAGAACTGGGAGAAGAAGATGCCGATTGGCTTGGAGACTTGTTGTCCGATGACGATGAAAAGAAAAAGAGACAAGATGGCGGATCTCCTCCTCAATTATTTGTCCCTACAAGAGTTCTTCCACCAGAAGGCCAAGAATCAGAAGATGATCTCATGAACTTGAATGAGATATTGAATCAGCGCCCAGACCTTGAAAATCCCGGAGAAGATACCCTCAAATTTCTTGAACTGAATGACTTACCCAAGCCTGGAGATCCAACTTGGGAGGAATTTTTGGAATCTCGACGTCCAGCTCCAATCAGAACACCAGACCGTATTAACACGGATCAGCCTGCACAAGATGGAGTTAGACAGCTGACTGTCGACGAGATTCTTGCTCTTCGTACACCGTTTAATCGATCGGGGGATTCTCCTGATGCGCAATCTGCAGACACGTTACATCCCACAGACGCCCATAAACTTCGGTTATTGGACTGGATGCGGTACCTCGTCGCAGCGCAGCGTAGACCCAGATATTTGGACCGACCTGAGCAAGGAGAAAGATTACTGAAAGTTTTCGAAGAATTCGATAAGTCCTTCACGGATGCCAGTCAACAGCTGAACGTACTACCAACTGTCGAACACCAGGAGAGCTCGAATTCCATTCGCCTTAAGATCTGGAAGGAACAGCGACAGAGAACGCCTGCCAGACAACTACGCCCACTACCTTTGACTCATTATGAAGGGCAGATTAGTGAATGGGCAAAATATCTGGAGACAATGAGAGATACTCCTCTACAATTCGAAAGCAGGGAGAGCAGAAATTCGTTCGCCAGTATACTGCGAGGACTGAGGATGGAACTTCTGAACACCATCAAAACAGTGTTCGCCGATTATATTAAGCCACCCGATCCTCCCGCCGCTCCTCCCGCCGCTCCTCCCGCTGCTTCCGATCCCGCCGCTCCTCCCGCTGATCCCTTCGCTCGCCCTCGTCGCGGTCGTAAGGCTCGTCCCGAAGCCCCTGCACCCGCCAATCCTTCACCTGGTCCTCCCGCTGTTCCTCGGGGTCCTCCCTGGTCCCCTCCTCCGGGGCTGTTTGTGGTAAATCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAATCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAACCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAACCCAGCGGGTAGTCCTGGTCAGGGGGATGCTGCAGCACAGCAAGCAGGCTCGGTCCAAGGGTCAGAAAACCCAGCGGGTAGTCCTGGTCAGGAGGATGCTGCAGCCCAGCAAGCAGCCTCGATCCAAGGGTCAGAGCTCGGGATGAAGATTGTGGACTGGTCGTTGTACATCTGTGCAATGAGGTTTACATGGCAAAGGCTGTCGGGCAGAATCCAGCCGGCCTATGCCCGAGACTACTACTCTGCATTCACAGAGCTGCACAACCACCTGAGGCCTGTGATGAGCAGAACTCTGACTCAGCAAGAGTCCAGCACGACTCTGGAAGCAATGGGATTGAACGGGTACCGCATAGACTATCGACGTCGACTGCGATCGTCTACGCGGTTGATAGCTCTCCTGCACGCAGAGCACGACTTGATGCTGCTGCAGAAGGCTGACATGTGGTATTTCTCCTCCTGGATCCAGTACTTGGCCTCGCTGGCCTTAGACAGCCCGGTTGTCGTTCCCGGCAACCGGATACAGTTCCTGATCGTATACCACTCTTTCTACGACGAAATGTACGACACCGCCTGCGCACTCCTGGGGAGACCCCTGGGTAGACTTCTGGATGTGGAGCCCATACGTCACGGCTTGGACTGGCAGGGAAAACGGCGGGTTGTGGATCAAGCTCCGGCCGGTGCCGCACCGATGGAGGTCCGCCAGTCGTCGCCAGCCGATTCGCAGTCCGAGTCGGACGGACCGCCAGGGACCGTAGGTCCGATTTTCAATCCTGTATTTGGGAGAATGAGGATGCCAGACAGGAAGCGACGATTAGAGGCTGAGAAAATTGCTAAACTAGCTGCTGAGAACGATCCCAGATCCTTGAATCACCCCGCCGTGGAGGCCCGAGTAGCGCCGGAGTACCGAGAGACGACTGTGGTGACACTCTTCGAAACTGTGGAACATCGAACCAAAAACTTCAGGGCAATGGGGGACGCACGAGCACGAGCACGAGCAAATAATGAGGAGGAGGCACAAATAGGTGTTCCCCGATATTTGACTGCAGAACAGGTGGCTGACCAGCAGGAGTATCACAATCTGTTCCTCCGAGAACTGAAGAGATTGGAGATGGACGTTTCGCTTGCCGTCTTGGGAATAGCCAAGTATCAGCATATGCCTCTCCCCCTGCAGAATGACCTCAGATTTTACATCATCGCCTACCACAAATTCATAAAAGGTGAAGTGGATCATTGTCACCACCTATGTCCTCAAACTCTACCCGCGGCAACCTGCAACTGCTATTCTACAAAGTTGGGCCCTTTAAATGCTTTCATAGATCGCCAACTTTTGCACAAAAAAGCATTGGACATGTATGTAAGAGACGTGAGTAAACTACTTTTTGATTGGTGTCATGCAAATAATGTTAAAACACTTCGTGTTCCAAAATATGTGGAAGAAGCTTTCAGAGAATGGAATGAAGTTCATCGTAAAAGGACAAACGCTTCACTCCAAGAATGGCAAGAGCTTAGTAGGAAGACTGGAATCCCAATGAAACAGATTAAAGTTTCAGTACGAGGCTTTAAAAGAATGATTGCCGGTGAAAGAAGAACAGATCCAGTAACAGGTCTTAGCGTCCAAGCACAACAAGCAAATGAACCAGAACAGCCCCAACAAGCTGCACAACCAGAACGAATTGCACCACGACAGCCTCCTTGGGTTCAGGAAGTTGGAACTCAAGTGTACAATTTTTTAAAATCTTGGGCAGACGAACATCGAGAATATGCGTTTCCGATTGACATTGAAATGGACCAATTGACGAAATATACAGGAATGACTAAGAGTCAAGTTGGCAGATGGCTGAAGGACTATCGAGTTGTTAATAATTATTTCAGTGTTTTTTCTTGTTCTATCCAGGCCAAATTGAATAGGCAAGGTAACGGAGAAGGAATGGGCCCAAGGTATGCATTAGTAGGTGCTCCAATTCAGAATCCTCAGATAAATTTTTCTCGTAATCGGAGGAACAACAATGGGAATCGTAATAATGAGGCGGAAAGAAAGGCAAAGTCAGATGAAGATGTGGTCATGGCAGATCCAGCCGGTCCAGCCGGTCCAGCCGATGCCCCATTGCAGCCTGTAGAGGATGTGGTCATGGCAGATCAAGCCGATCCAGGCGATGCTCCATTGCAGCCGGTAGAGGATGTGGATTTGGATATGGCAGAGTGGCAGGGTTTTATAGAAAATAATCTCAAAGAGAACGAGGAAAGATTCCGGAACGATGCTGCGTACCTGGACCAACAGGCGATCCCTCAGAGGAATTATGTCATCAACGAGGATGGACAAATAGTTCCAGTCGATGCAGGCGTCGCGCAGCAAATTCAACCCTTGGTCCAACCAGGACAAGCGTCCCAACCAGGCTCACCGGCACGAGGAGGCGGACCCGCGGGTGCCGTCGATCCCATACTGCCGGACATTCAACCGCGCCCACTGGGAGACGGGGGCGGACCCGCGGGCGCAGTCGATCCCATACTGCCGGACATTCAACATAGCCCACTGAGAGACGGGAGCGGACCTGTGGGCGCAGTCGATCCCATACTGCCGGGCAATCAACCGCGCCCACTGGGAGACGGGGGCGGACCCGCGGGCGCAGTCGATCCCAGACCAGCGGATCCCGAGCAAAACCCTCTGGATGGCGCGCGCGGTGAGATCCAAGCCTTGAACCAACAGGGCCAGCTGCCGCCGGCCGTTGCCGCGGAAGCGGTGGCCAATATCGACAACCAGGGGGCCGCAGGCCGCAGGGCGGACGACGATGGGGAGAATCTCGCGGAACTCGCGAATGGCGCGATTATCGACCTAAACGCTCGAGAACGCATATTGACAAACAAATGGGAGCCCCTTCTCGCCCACGAGACGGACCTCCGCTTGCGCTATACGTCGCTGATCAATTACGCAATTTTCAAAAGCCACGCAAAAAATTTTCTGCGCGAACGGAGCAACGAATTGAACAAGCTCGTCGTATCTCACTTGGCCTTTTCAAAGCGTACTCCTGTTCATACGTTCGTGGATTGTGTGGATGCAAACGAAGTGCGTGCGTGTTGTTACGATAAAAGATATGGTGACATAGATATCATTCAAGGGGAGAAGGAACGACTGGACGCTAGCTTCCAGAGATTTGATGCGATGATTATCAGATGGGTGTCAATTTATTGCAATACTATTGACAAAAGATCCAGAGTTACGTTACCAGGGTTTGTCGTCCGCTATCTAGACGCCTGGTGCATCCAGCATCCAGAAGTTGGCGTTGTAACCCACGAAGACTACACTCGTTTTGAAAGTGAGGTCGGCGTACAACTCAGACAGGGATCGAGTTTTTTAAGGTTTTGGAGACAACAATGCGTGAAAAACAAACGAGCAAAAGCAGCAGGGGCTAAGAGGGAGATACAAGTATTTCAAACCAATTGGATGAAAGAATGGTTTGAACAAAATTTGAATCGAGCATACATTACCGTTGATAATTTACGAGAGTTGACGCAGAACACGGGTTTGACTAGATCACAGGTAATAAGATGGCTTAAAAATAAGAGATTTATCAACAAATTTAGAAGAATTGAACGAAATGGGATTTATTGGAGATTCCGACCTTGGCAGCCTGGTGACGAACTTAAGGAGAATTTAGCTTATAACACGAACCTGGGGAATCCAGGAGATGACGAAGATCCTCAAGAAGATGTCCTTGCTGCTGGCTAG

Protein

>Mapoly0013s0027.1
MSSKKRKDRGEDEGQGQADAPAPAGSGASGGGRSPARATGSPKSGGPSGRSPSRSPKAVDSAGQPQPASPGKSAPGKSKNAGQGSSASGGSSPASRSAGPSSGRTSGQSTPRAGDVDPGDGSQPPPKKKQNSGRSSGQATPRAGSPGQAQASGSDQPSQTQMSAGGAANPNPDAGLIPALQTASINPGSDPQAFQSFRLTEQEVRRAIECATVQNLATGVPQAIPSVAGVPQSANWLEQALINAPNKPLDEDLGGPPELGEEDADWLGDLLSDDDEKKKRQDGGSPPQLFVPTRVLPPEGQESEDDLMNLNEILNQRPDLENPGEDTLKFLELNDLPKPGDPTWEEFLESRRPAPIRTPDRINTDQPAQDGVRQLTVDEILALRTPFNRSGDSPDAQSADTLHPTDAHKLRLLDWMRYLVAAQRRPRYLDRPEQGERLLKVFEEFDKSFTDASQQLNVLPTVEHQESSNSIRLKIWKEQRQRTPARQLRPLPLTHYEGQISEWAKYLETMRDTPLQFESRESRNSFASILRGLRMELLNTIKTVFADYIKPPDPPAAPPAAPPAASDPAAPPADPFARPRRGRKARPEAPAPANPSPGPPAVPRGPPWSPPPGLFVVNPAGSPGQGDAAAQQAGSVQGSENPAGSPGQGDAAAQQAGSVQGSENPAGSPGQGDAAAQQAGSVQGSENPAGSPGQGDAAAQQAGSVQGSENPAGSPGQEDAAAQQAASIQGSELGMKIVDWSLYICAMRFTWQRLSGRIQPAYARDYYSAFTELHNHLRPVMSRTLTQQESSTTLEAMGLNGYRIDYRRRLRSSTRLIALLHAEHDLMLLQKADMWYFSSWIQYLASLALDSPVVVPGNRIQFLIVYHSFYDEMYDTACALLGRPLGRLLDVEPIRHGLDWQGKRRVVDQAPAGAAPMEVRQSSPADSQSESDGPPGTVGPIFNPVFGRMRMPDRKRRLEAEKIAKLAAENDPRSLNHPAVEARVAPEYRETTVVTLFETVEHRTKNFRAMGDARARARANNEEEAQIGVPRYLTAEQVADQQEYHNLFLRELKRLEMDVSLAVLGIAKYQHMPLPLQNDLRFYIIAYHKFIKGEVDHCHHLCPQTLPAATCNCYSTKLGPLNAFIDRQLLHKKALDMYVRDVSKLLFDWCHANNVKTLRVPKYVEEAFREWNEVHRKRTNASLQEWQELSRKTGIPMKQIKVSVRGFKRMIAGERRTDPVTGLSVQAQQANEPEQPQQAAQPERIAPRQPPWVQEVGTQVYNFLKSWADEHREYAFPIDIEMDQLTKYTGMTKSQVGRWLKDYRVVNNYFSVFSCSIQAKLNRQGNGEGMGPRYALVGAPIQNPQINFSRNRRNNNGNRNNEAERKAKSDEDVVMADPAGPAGPADAPLQPVEDVVMADQADPGDAPLQPVEDVDLDMAEWQGFIENNLKENEERFRNDAAYLDQQAIPQRNYVINEDGQIVPVDAGVAQQIQPLVQPGQASQPGSPARGGGPAGAVDPILPDIQPRPLGDGGGPAGAVDPILPDIQHSPLRDGSGPVGAVDPILPGNQPRPLGDGGGPAGAVDPRPADPEQNPLDGARGEIQALNQQGQLPPAVAAEAVANIDNQGAAGRRADDDGENLAELANGAIIDLNARERILTNKWEPLLAHETDLRLRYTSLINYAIFKSHAKNFLRERSNELNKLVVSHLAFSKRTPVHTFVDCVDANEVRACCYDKRYGDIDIIQGEKERLDASFQRFDAMIIRWVSIYCNTIDKRSRVTLPGFVVRYLDAWCIQHPEVGVVTHEDYTRFESEVGVQLRQGSSFLRFWRQQCVKNKRAKAAGAKREIQVFQTNWMKEWFEQNLNRAYITVDNLRELTQNTGLTRSQVIRWLKNKRFINKFRRIERNGIYWRFRPWQPGDELKENLAYNTNLGNPGDDEDPQEDVLAAG

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>