Mapoly0013s0054



Description

Plant protein of unknown function (DUF822)

Reference DB

Database ID Description
OrthoMCL OG5_243987
PFAM PF05687 Plant protein of unknown function (DUF822)
PANTHER PTHR31506 FAMILY NOT NAMED
PANTHER PTHR31506:SF2

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZR1 transcription factor, BZR/BES Mapoly0013s0054.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0013s0054.1 scaffold_13:506835..512018  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0013s0054.1  

Gene structure:

mRNA scaffold_13:506835..512018  ( - strand )
three_prime_UTR scaffold_13:506835..507762  ( - strand )
CDS scaffold_13:507763..508491  ( - strand )
CDS scaffold_13:510570..510899  ( - strand )
five_prime_UTR scaffold_13:510900..512018  ( - strand )

Sequences:

Gene

>Mapoly0013s0054.1
ACAAAGGCATGCAGTAAGAGGATGAGCAGCAAGCAGCTCTGTGCACAGATCGGCTACTAGGTGGGATTGATTATGACTTGAATTGCGGAGGGGAGGAAGTGGACAATCAGTTATCTTTCCACAGAAATCTGCGCCGACGTGGGAGAAAACAGGGAGCGGGGAGAGTTAGTTAGGAACCAGAGAGAGAAAGAGAAGGTAGGAAAGAGAAAGGGAGTGAGAGGAGAGAGGGAGGAAACTGAACTCGCCAAGCGAAGGAAAAGCACGGCCAGACAGACATGCTCAGGCCTGCTCAGAGCTCTGCAGTCTAGTCCAGTCCAGTTCAGTCCACGTTTCCGGGGAAGTGAAATGATCTCTTCTCTATTAGCAGCAACACTTGCTGCTGCCGCTTTCTGGGCATTCTCAGCTCCGCCCTTACCTCTCCCTCCCCTCTCCTCTGCCTTCATCGATGTTAGGTTCTCATGATCTCATACTTTAACCCAGGACCATTCCTCTTCGTTGTCTAAGCAACACCTTTCCTCTACCCCTGCTCGTTGCAGAGCACAGCAGAGCAGCATCAGTTCAGTTCAGTTCAGTTCAGTCCAGTCCTGTTCAGCATACCAGAGCTGCAAGAGAATACTGGTCAGTCATCTCGGTACGAGCTTCAGTCCAGAGAGTGACACACACAGCCAGCCACGGGGACGAACACCGAGTGATTTGAGGGAGAGCGAGAGCGAAGAACTAGTTCGCAGTGAACGATGGTTGGGACTCTGTTCATGCGCTCCGGCTGAACAAGATCGAGCTCGCTCGCTCGCTCGGAGTGCAGAGGGTGCACATCTCTGACCTCGAAGAGTAGCCAACGAGTGACAACAAGTGACGGAGTGAGCTGTAAGGAGGTCGAGGAGAAAGAGGACTGGACTGGGTATGGTGCAAATCTAGAGCAGCAGCAATCTGGGAGGACGGGGTTGAAAATCGCAGCTCGGGGAGCAGCATGGGACATGCAGTGTGCTGCCCCATTCGGGCTTGTTGCGTCGTGGACGGTGAGCTGAATGAGGAGGTAGAAGGGGCAGGTTGAGTTGCGCCTCGACTCCCTGGAGTCTGTCGAGAGGAGGGGGGAGGTACGGGGAGGGGACGAGGCGACTAATGCAGGAGAGCGTGTCAGGAGAAGCTGGTGCTGGTGGAGGAGGAGGAGGAGGAGGAGGTTGTGGTGGTGCCTCCGGTGGGGGCAGTGAGGACGGGAAAGATCGCAAAGATAAAGAGAGAGAAATGGCCAAGCTCAGTGCGAGCGAGAAGGAAAAAACCAAGCTGCGCGAGCGGCAAAGGCGAGCTATCACCACGAAAATCTTCGCGGGTTTGAGAAAGCACGGAGGCTACAATCTGCCTCCCCGTGCCGACATTAACGACGTCTTGAAGGCCTTGGCTCAGGAGGCGGGGTGGACCGTGGAGGCCGATGGCACGACCTATCGCACCCAGGTACGAGAACTCTCCGCACCCTCAGCCCGTCTCTTTCTCCCACCCACCAGGTTCCCACATTTGATCTGTTCCCTCTCAGATTTGTGCCACAATGTGGCTCCGTGAGTCCTGGACCTGGCTTCAATCCCATTTCTCAGGGTGGTGGACCCCGTGCAGGATCCCACGCCTTCTTCTTCCCGCCCTCGCTCGCCACCTGTTAACTGTGCCAGCAGCAGCTGGATTCGCATGCACCTCAAACCCTCTCACAAACTTATGACTTGCGCAATCGCGCGCTGCGTCGATCTCAGGTTGCTATGCAGCTCCAGCACCTTCGCCTGCACGTCAATCCCGAGCCATACGACAGCGCCCGTAATCGTCGTGTGGCCCTGGTGTTTGGCCTCCGGACGGGCTTTCGGGATGATTCAGGAGCTCTCTTCTCGTTTTGTGAAATTTCCATCGTGTCGGTGAATCTTGGTCTGCACTGGCGGTGCTGTCCAAACCAGCGCTCTTCTGAAGCACTCGGTGGTTGTCTCTTTTCGTCGCGAAAAGAACCGATCTGATGCATGACCGTGATGCCCAGCATCAGCCATATCTACCGCGCAGCCTCGTTCCACAATCTCAGCGACGCAGAGCAGGCAGCCATGGAGAATCTTCGTGGGAGGCGATGAAGCGGGGCTTCAGTCTTGGCACGCGAGGGTTGCAGTGTCATCCACGGCCTTCTGAGCGCTTTCCTCGAAGCCATCGCAAGCCCGTCAGCCAAGGCCGTTCGCAGCGCCTCGGTCGATCTGGAAGCGTAACCGCGAAGCCAAGCTCGCCGAACGTTGATTGGAGCGTCCTTCGAGCGGCTTGGGCGAGCCCGATTGATGATTTGAAAGGCGCCACTCGGCGCACAAGGCTTTTGAATGTGCATGAATTATCGTGCACTTTGCTCAGCAGTTCCCTCTGACTGGAAACGAGCTTCTTTCTCGTTCAGTGTCTTCCAATTTTGCCTGCAATCCTCGTTTCATGTCACTTCGTTTCCTTCGGTGGACGGAAGACGAAAGGATTCGATGGTGAATCCTTAGCCTGTCTGATGGCGTAGAAAACAATCTCTGCTGAATCTTCTCGTAGACGGCTGTGTGTGTTGAGGAAGTTACAGTCGAAATTTTTGAAGCGGGAATTTTCTTGGGTCTGATTTTCTCAGTGAGCAGTCCACGCCACCGCCTTGCATTCAGCGAGCAAGACGAGGCTGGCTAAGTGTCAATCAATTCTTCTCAATGCTTGGTTGATCAGCTGAATACATCTGTCAGTGTAGTTCCTTGAGCTGACGACTTCTCATGATGCTTGGAGCCTGTTCTTTAGTAGCAGTTATTTCGTCTACGTAGAGGTGCCCTCCATCAAGAATGAGTTCTCCAATGTTCTCTTCGTTGCACCCGTACATTCGAGTTACTTTGTTTCGTGTATTTTGGTGAGGAGTTTCCTTGATGAAGCTTGGAAATCTCTCACGGAGCCCGATTGCAATGCACGTCTTTGGGCATCGAGAAGCGAAGTTCACCTGAACGAAGAACTGTGATTTCAGCTTCCTGATGCAAGCTGAGAGTGTAGAAGCATCATACCTCAAGGCGCTGAACTGCAAAGAAAGAATTTGCAAATATGTCGTGAGTACTATCTGTTTTGAGAATAGAACTTATACGACCTCGGTGGAAAAACAATAGAACGCCGTGTTGGAAGAACCAACCTCTCTACGAGTGCTTTGGGGGCTTTCTGGGTTCTATTCAACGAACCCCACAGCGCCAAACCTTATTCAGCAGACTCGTACGTCTGCTGATCACCAGTGAGAACACTGTCCTGAGTTCGCGAAGGAGTTTTTGTGTCCAATGCTCGGTCGCAGTCAACGAAGAAAGACGTCCGAGGTCGTCAGGACTCGGCTGACTGCATTGATCACGGAATGAATGTCTGCCTGCTTGCGTGCGATCGTCGTCTGAGGACGCATTAAGTAAAAGTCGGTTGCAGAGAGGAGGGGAATGATACGATCTCGTGTCGTAAAAGCGAATCTGTAAGTTGGAGTTCTGAAAGTTTTCTGATTAGACGTGGTGGTGTTGTGCTGTTGGGGGAAACAGGGAGCTCTGCAGCAACCGAGCAGCAGTCATGGGGGTCACCACTCACTTCGGCAGCAGAGCCTGTCGTCGCAGGGTCGGGTGGCCATGCTGCCGGGCAACACGAGCATGCCGGCGAGCTTCAGCTGCAGCCTCACGGGGCTGACGGGCCTGACGGGGCTGCTGCCACCGGATGGCAACGAGTTAAGAGAGGGCAACTGCTCGACCACGGCATCGCCCCGGCGTGTGGGAGGTGGTGGCGGCGGGCAGCAATCCAACAGCTCATCGATGACGACTCTCATGCATCCGAATTCCGCTTGCCTCTCGTCGCCATTCGCGTCCCCGGCCTCGAGCGAGGGCGCCCCCAGCGTGCGCCTCAACAATCCGTTCATGGGGGGCGGCATGCCGGGCGGCTTCCTCTCGTGCGGGCCTGTCCCGTCGGACGGAGGCGGAGGAGGGCGCGATCGCGACTCGGGCGCTCTGAAGGACGAATCGGCCGCTTACTTCAGCGCCGACACTCTCGAGGCCCGCGAGTACGCGGCCAGGAACGGGGCTATGGCGAATCACATGAACAACATGCTGTTCGGGGGCGGGCATTCGCCGCAACAAGCTTTGCAGAATAGCCATCGATTCGGCAACCCGCGGCTCACCATGCCCTCACTCGCCATGCTCTCGTCCTACGCCCAGGAACATCGGGCTTCCAACAACAATACTCCACTCGGCTCTCCTCAGCGTCATGGTGGGCCTGGCTAGCAGGGGATTGAATGCGTTCGGAGCTGTCATTCTGGGGACGGACGAAGGAAGGGGAGGGAGGTCGGGTCAAAGGGAAAGTGAGGCCATCATGTAGTAGACAGGAAGGACACGACACGAGTACCAGATAGAGTAATGTTTCAGAACGGGGGGGGAGAGGGAGGGAGGGAGGGAGGGAGGTAGGAAGGGGGAGATGTGTTTCAGAGGGGGAGAAGTTTCATAGAGTTTCGTATGAATGGGCCATGGCAGTGGGTGGAATTCGACTTTGGTCGTTCAGTCCCTATCAGGGTCGGTGTGTGGGGTAGAGCATTCAGTTCTCGATGTCCAGCAGCAGGGAGATGTTGGTGGATGGGATGAGGAAGGAAGGGAAGTGGTTCGGAGCCGAGCCGAGCATTTGTTGAGATGACATTGATCGGATGAGATGAGCTGAATGAGTGGGGCCTCGCCAGCACAGCAGCAGCAGCAGCATTCCATCGTCAATTACTACTCTACTACCACTACTCCTGCACGAGTTGTAGATGTCTGACTGACTATGTCTCCACCGCAATCGCTCACCTGCTCGAGAGGCCGTGACGACCAGATTATCTTGCTGGATGATGACCAAATCTCCGCTTAAAAGACTAAGAAACCTCAAGGCAGAAGAGTTGATTTGTGCCTGCAATGCAAACGCGAGTATATGCGTTTCTGGGTCGAAATGTTGAGAGCGACTTTTTTTTGTTCTCTCACCTGTGGCTGCTGCCAATGCTGCTGCTGCTAGTCATTCGATAACTCATTTTTGTTAATGGGACGTTCGGTAGAAGACATCTCATTTTGTGGAGTCGGAAAGTAATCCTTACTTACAGACTGGAAGCATTCCATGTAAGCACGCACTCGAAGCTTATACAAATTTGTCAGATTTAATGATAAATCACCTTGACGAATTTGACGCCAC

mRNA

>Mapoly0013s0054.1
ACAAAGGCATGCAGTAAGAGGATGAGCAGCAAGCAGCTCTGTGCACAGATCGGCTACTAGGTGGGATTGATTATGACTTGAATTGCGGAGGGGAGGAAGTGGACAATCAGTTATCTTTCCACAGAAATCTGCGCCGACGTGGGAGAAAACAGGGAGCGGGGAGAGTTAGTTAGGAACCAGAGAGAGAAAGAGAAGGTAGGAAAGAGAAAGGGAGTGAGAGGAGAGAGGGAGGAAACTGAACTCGCCAAGCGAAGGAAAAGCACGGCCAGACAGACATGCTCAGGCCTGCTCAGAGCTCTGCAGTCTAGTCCAGTCCAGTTCAGTCCACGTTTCCGGGGAAGTGAAATGATCTCTTCTCTATTAGCAGCAACACTTGCTGCTGCCGCTTTCTGGGCATTCTCAGCTCCGCCCTTACCTCTCCCTCCCCTCTCCTCTGCCTTCATCGATGTTAGGTTCTCATGATCTCATACTTTAACCCAGGACCATTCCTCTTCGTTGTCTAAGCAACACCTTTCCTCTACCCCTGCTCGTTGCAGAGCACAGCAGAGCAGCATCAGTTCAGTTCAGTTCAGTTCAGTCCAGTCCTGTTCAGCATACCAGAGCTGCAAGAGAATACTGGTCAGTCATCTCGGTACGAGCTTCAGTCCAGAGAGTGACACACACAGCCAGCCACGGGGACGAACACCGAGTGATTTGAGGGAGAGCGAGAGCGAAGAACTAGTTCGCAGTGAACGATGGTTGGGACTCTGTTCATGCGCTCCGGCTGAACAAGATCGAGCTCGCTCGCTCGCTCGGAGTGCAGAGGGTGCACATCTCTGACCTCGAAGAGTAGCCAACGAGTGACAACAAGTGACGGAGTGAGCTGTAAGGAGGTCGAGGAGAAAGAGGACTGGACTGGGTATGGTGCAAATCTAGAGCAGCAGCAATCTGGGAGGACGGGGTTGAAAATCGCAGCTCGGGGAGCAGCATGGGACATGCAGTGTGCTGCCCCATTCGGGCTTGTTGCGTCGTGGACGGTGAGCTGAATGAGGAGGTAGAAGGGGCAGGTTGAGTTGCGCCTCGACTCCCTGGAGTCTGTCGAGAGGAGGGGGGAGGTACGGGGAGGGGACGAGGCGACTAATGCAGGAGAGCGTGTCAGGAGAAGCTGGTGCTGGTGGAGGAGGAGGAGGAGGAGGAGGTTGTGGTGGTGCCTCCGGTGGGGGCAGTGAGGACGGGAAAGATCGCAAAGATAAAGAGAGAGAAATGGCCAAGCTCAGTGCGAGCGAGAAGGAAAAAACCAAGCTGCGCGAGCGGCAAAGGCGAGCTATCACCACGAAAATCTTCGCGGGTTTGAGAAAGCACGGAGGCTACAATCTGCCTCCCCGTGCCGACATTAACGACGTCTTGAAGGCCTTGGCTCAGGAGGCGGGGTGGACCGTGGAGGCCGATGGCACGACCTATCGCACCCAGGGAGCTCTGCAGCAACCGAGCAGCAGTCATGGGGGTCACCACTCACTTCGGCAGCAGAGCCTGTCGTCGCAGGGTCGGGTGGCCATGCTGCCGGGCAACACGAGCATGCCGGCGAGCTTCAGCTGCAGCCTCACGGGGCTGACGGGCCTGACGGGGCTGCTGCCACCGGATGGCAACGAGTTAAGAGAGGGCAACTGCTCGACCACGGCATCGCCCCGGCGTGTGGGAGGTGGTGGCGGCGGGCAGCAATCCAACAGCTCATCGATGACGACTCTCATGCATCCGAATTCCGCTTGCCTCTCGTCGCCATTCGCGTCCCCGGCCTCGAGCGAGGGCGCCCCCAGCGTGCGCCTCAACAATCCGTTCATGGGGGGCGGCATGCCGGGCGGCTTCCTCTCGTGCGGGCCTGTCCCGTCGGACGGAGGCGGAGGAGGGCGCGATCGCGACTCGGGCGCTCTGAAGGACGAATCGGCCGCTTACTTCAGCGCCGACACTCTCGAGGCCCGCGAGTACGCGGCCAGGAACGGGGCTATGGCGAATCACATGAACAACATGCTGTTCGGGGGCGGGCATTCGCCGCAACAAGCTTTGCAGAATAGCCATCGATTCGGCAACCCGCGGCTCACCATGCCCTCACTCGCCATGCTCTCGTCCTACGCCCAGGAACATCGGGCTTCCAACAACAATACTCCACTCGGCTCTCCTCAGCGTCATGGTGGGCCTGGCTAGCAGGGGATTGAATGCGTTCGGAGCTGTCATTCTGGGGACGGACGAAGGAAGGGGAGGGAGGTCGGGTCAAAGGGAAAGTGAGGCCATCATGTAGTAGACAGGAAGGACACGACACGAGTACCAGATAGAGTAATGTTTCAGAACGGGGGGGGAGAGGGAGGGAGGGAGGGAGGGAGGTAGGAAGGGGGAGATGTGTTTCAGAGGGGGAGAAGTTTCATAGAGTTTCGTATGAATGGGCCATGGCAGTGGGTGGAATTCGACTTTGGTCGTTCAGTCCCTATCAGGGTCGGTGTGTGGGGTAGAGCATTCAGTTCTCGATGTCCAGCAGCAGGGAGATGTTGGTGGATGGGATGAGGAAGGAAGGGAAGTGGTTCGGAGCCGAGCCGAGCATTTGTTGAGATGACATTGATCGGATGAGATGAGCTGAATGAGTGGGGCCTCGCCAGCACAGCAGCAGCAGCAGCATTCCATCGTCAATTACTACTCTACTACCACTACTCCTGCACGAGTTGTAGATGTCTGACTGACTATGTCTCCACCGCAATCGCTCACCTGCTCGAGAGGCCGTGACGACCAGATTATCTTGCTGGATGATGACCAAATCTCCGCTTAAAAGACTAAGAAACCTCAAGGCAGAAGAGTTGATTTGTGCCTGCAATGCAAACGCGAGTATATGCGTTTCTGGGTCGAAATGTTGAGAGCGACTTTTTTTTGTTCTCTCACCTGTGGCTGCTGCCAATGCTGCTGCTGCTAGTCATTCGATAACTCATTTTTGTTAATGGGACGTTCGGTAGAAGACATCTCATTTTGTGGAGTCGGAAAGTAATCCTTACTTACAGACTGGAAGCATTCCATGTAAGCACGCACTCGAAGCTTATACAAATTTGTCAGATTTAATGATAAATCACCTTGACGAATTTGACGCCAC

CDS

>Mapoly0013s0054.1
ATGCAGGAGAGCGTGTCAGGAGAAGCTGGTGCTGGTGGAGGAGGAGGAGGAGGAGGAGGTTGTGGTGGTGCCTCCGGTGGGGGCAGTGAGGACGGGAAAGATCGCAAAGATAAAGAGAGAGAAATGGCCAAGCTCAGTGCGAGCGAGAAGGAAAAAACCAAGCTGCGCGAGCGGCAAAGGCGAGCTATCACCACGAAAATCTTCGCGGGTTTGAGAAAGCACGGAGGCTACAATCTGCCTCCCCGTGCCGACATTAACGACGTCTTGAAGGCCTTGGCTCAGGAGGCGGGGTGGACCGTGGAGGCCGATGGCACGACCTATCGCACCCAGGGAGCTCTGCAGCAACCGAGCAGCAGTCATGGGGGTCACCACTCACTTCGGCAGCAGAGCCTGTCGTCGCAGGGTCGGGTGGCCATGCTGCCGGGCAACACGAGCATGCCGGCGAGCTTCAGCTGCAGCCTCACGGGGCTGACGGGCCTGACGGGGCTGCTGCCACCGGATGGCAACGAGTTAAGAGAGGGCAACTGCTCGACCACGGCATCGCCCCGGCGTGTGGGAGGTGGTGGCGGCGGGCAGCAATCCAACAGCTCATCGATGACGACTCTCATGCATCCGAATTCCGCTTGCCTCTCGTCGCCATTCGCGTCCCCGGCCTCGAGCGAGGGCGCCCCCAGCGTGCGCCTCAACAATCCGTTCATGGGGGGCGGCATGCCGGGCGGCTTCCTCTCGTGCGGGCCTGTCCCGTCGGACGGAGGCGGAGGAGGGCGCGATCGCGACTCGGGCGCTCTGAAGGACGAATCGGCCGCTTACTTCAGCGCCGACACTCTCGAGGCCCGCGAGTACGCGGCCAGGAACGGGGCTATGGCGAATCACATGAACAACATGCTGTTCGGGGGCGGGCATTCGCCGCAACAAGCTTTGCAGAATAGCCATCGATTCGGCAACCCGCGGCTCACCATGCCCTCACTCGCCATGCTCTCGTCCTACGCCCAGGAACATCGGGCTTCCAACAACAATACTCCACTCGGCTCTCCTCAGCGTCATGGTGGGCCTGGCTAG

Protein

>Mapoly0013s0054.1
MQESVSGEAGAGGGGGGGGGCGGASGGGSEDGKDRKDKEREMAKLSASEKEKTKLRERQRRAITTKIFAGLRKHGGYNLPPRADINDVLKALAQEAGWTVEADGTTYRTQGALQQPSSSHGGHHSLRQQSLSSQGRVAMLPGNTSMPASFSCSLTGLTGLTGLLPPDGNELREGNCSTTASPRRVGGGGGGQQSNSSSMTTLMHPNSACLSSPFASPASSEGAPSVRLNNPFMGGGMPGGFLSCGPVPSDGGGGGRDRDSGALKDESAAYFSADTLEAREYAARNGAMANHMNNMLFGGGHSPQQALQNSHRFGNPRLTMPSLAMLSSYAQEHRASNNNTPLGSPQRHGGPG

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>