Mapoly0013s0062



Description

AT-RICH INTERACTIVE DOMAIN-CONTAINING PROTEIN (ARID DOMAIN- CONTAINING PROTEIN) (DEAD RINGER PROTEIN) (B-CELL REGULATOR OF IGH TRANSCRIPTION) (BRIGHT)

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0005622 Intracellular
OrthoMCL OG5_169779
PFAM PF01388 ARID/BRIGHT DNA binding domain
PANTHER PTHR15348 AT-RICH INTERACTIVE DOMAIN-CONTAINING PROTEIN (ARID DOMAIN- CONTAINING PROTEIN) (DEAD RINGER PROTEIN) (B-CELL REGULATOR OF IGH TRANSCRIPTION) (BRIGHT)
PANTHER PTHR15348:SF0 SUBFAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpARID1 transcription factor, ARID Mapoly0013s0062.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0013s0062.1 scaffold_13:590704..599932  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0013s0062.2 scaffold_13:590704..600068  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0013s0062.1  

Gene structure:

mRNA scaffold_13:590704..599932  ( - strand )
three_prime_UTR scaffold_13:590704..591057  ( - strand )
CDS scaffold_13:591058..591162  ( - strand )
CDS scaffold_13:591425..591517  ( - strand )
CDS scaffold_13:591792..591842  ( - strand )
CDS scaffold_13:594473..594759  ( - strand )
CDS scaffold_13:594917..594962  ( - strand )
CDS scaffold_13:595213..595332  ( - strand )
CDS scaffold_13:595661..595801  ( - strand )
CDS scaffold_13:596403..596448  ( - strand )
CDS scaffold_13:597296..597348  ( - strand )
CDS scaffold_13:597497..597536  ( - strand )
CDS scaffold_13:598411..599111  ( - strand )
five_prime_UTR scaffold_13:599112..599168  ( - strand )
five_prime_UTR scaffold_13:599474..599932  ( - strand )

Sequences:

Gene

>Mapoly0013s0062.1
ATGAACGAGAGAGAGGTTCAGGCGGCAGTGGCCCGCGAGGTAGACAGACGACCATTGAGAGCAGCAGGAACAATGTGAGTTCGGAATATTATTTCTATCTAGGGCAGAGAGATTGGGATTGCGACATCTTGTTGGTGTGTAGGGAAAGGGTTGCGTAGGGTGGAGGAGAGTTCTGGAGGAGGAGGTGGTTGTCTCGGGCTACAGCAGAGGAAGCATGGCGGGGCCTCGGTAGAAATCATGTCGTGTGCATTTCGTCGGAAGGAGGGCTGATAATTTCGCTGTGGGTCGTAAAAGATCGCTTCAAGAAAATTTGTGGGAGGTCGGGAGGGCTGTGAGGGACGAACCTCGAACCATTAGGTCAGCTGGTCACCAGTAGCGCATTGTGATCAATCCAAAGAAGGAGTGGGTGTGGAGTCGATTGACATCGGGGGTTTGGGTTTTTTCGATTCGCTGGTTAGGGTACGTGTTTTGTACCTCTCGGTGTGGTTTTACACTCTGCACAACGGTCGTACGTGTGAGGTCACAACTGCTAGAGATTGCTGTTGGAACTGTGTTTCCTGATTCGCAAGTTCGACACAACTTTTATCACATCATTGTATCAAGCTTTCTCGTCAGCTGTAGTTACGTGTCTGTCGTTTGTTTGCTCTCGTGGTCTGGTTTATTGCTAGGTCACCCTCTCTATTCACCAGGCTGTTCTGCATTTTCGCCCTTCTCCAGTTTTTCATTCTTGAAAGCTAGTCCGTTTGCCTCCATTCCGAAATCAGATTTCCCAGCCAGGATTTTTGCACACATATTGCCATAGTGGAAAGAGGGTGGCTGTCATGACAGAACCTGAAACTGAAATTGGGAATGGAGCGTCGGCCACCATAGATAGCCAGCCTACAGTGACCGATGCACCGCAGGAGCCTGTTGAAGCTGAGGTGGTGAAAACTTCGAGTGGCGAGCATACGGAGAGTTTACGGCCTCGGGACGTGAAGCAAGCACCGAATGTGAGCACCGAGGGACTCTTCGCCAAGAAAGCTGAAAGCGAGGAAGTCGTCAACAAAGAAGACGACAAGAAGGTGGCAGAGATGAAAATAGACGAGAAGGATGTGGAGGAGAAGGAGGTCCAAGCGAAGGTGGGAGAAAGAAAAGACGGAGCCAAGAAAGAAAGAGTCTTGAAAGAAGAAGACAAACACGAGGAAGAATTAGAGGAAGAAGAAGAGGAGGAGGAAGAAGAAGAAGAGGAAGAAGAGGAGGAGGAAGAAGAACCATTACAAGCGAGAATGGTTTCATCAAAGGATGAAAAGATGGAGGAAGAAGAGGAAGAGGAAGAAGAAGAAGAGGAGGAAGAGGAGGAGGAGGAGGAGGTAGAAGAGGAAGAGGTGGAGGAGGAAGAGGTGGAAGAGGATGAGGTTGATGACAAGGACGGCAGCATTGAGGAGCAGATCGCTTTCACGAGGGTCCTCGAAAACTTCTTTAGGGATAGGAACTTGGAGTATAAAGCTCCGAAGTTTTACGGAGAAGAACTGAATGTTCTGAAGTAAGCCGAATTTACCATTATCCTCACACGTGATTTGCTCTTGTCTCTTTGGAAGTTCTAGCTGTTTTTGGAATTGACACAGAACTGTGGTAGACATGAATTCTATTTGGAATGGAGTTTGAGCAGGGAATATCGATTATCTTGCACTCCTGACTTCGTAGAGGGCACACAGACTGCACTATAGTTTTTTTTTGTCAACAAAGAGATATACTTCTGTTTTAATTTTTCTGTTTCCGAAGGATATAGTGCAGGGCTGGAGGCGTTGTCCTTTATCTGGTAGTAGTCGTTGTGTTCGAAAGTTCCTCTAATCACCTGTAACATCCGCCCTGCTTTCGCGTCTTCTCCGGTTTCTTGACACTAGGACTGCGTTTTTGAGTGTGCTTTGTGTCACATCTTTCCTAATTTACTCTGCCCCTTCCAATTGAGGTGCTTCGTCCAGTTTTGTAATATACCAACGGCATTTGAGATCTAAGATAATTATTTCGGCTCCTCTTCAGCCTACAAGTTTGTACTGTCAGTCATTATCTGATGGTCTTTAGGGACACCCTGGAAGTTTGTAGTGTCGTTAGTTGATCGGTGAAGTTTGTAGTATTCCAAATTCGCGTGTAAGAATGTCCTCGTCTACCTTACTGACATTATGTAACATCGGTTTCTATCCTGTTTCCTTCCTTGACCTGAATTCCATTTCACGCTCTGCTTCTGCCTTGATTGTCATTTCTAGTATTTTATTTATCTCGTTTGGTTTCTCAGTCAGCTCAGATTTTGTTGTGTCTTTCTCGTATGGGTAGCTTTAAGGTTCCAGTCAATCTCACAATGTGATAAGCCTTTAGCAACCTGTTTTGAATGACTTACATTCTTTGCGTGATATGTTCAGGTTATGGAAGGCAGTGACTTCTCTCGGGGGTTACGAACAGGTATTGTACTGAAAAGTGGCAAATGTTTGCTTTTATTGATAGATAATTCTCTTATAGATTCATTCATGATAAATTACTTGAAAGCCTAGAATGGATCTTTCAACTTTGAAAATTTCGTGAAAATCGATCGAGATACCCTTTGTTGTAGGTTACTTCTGGCAAGTTATGGCGACAAGTTGGCGAACAGTTCAAACCTCCCAAGTGAGTGATGTGATGCACGTTTGAGTTAAATCCTTGTCTTCCAACTTCGCTCAGTAAGGAGTAATTTATACCTGTAAATAGATGAGATTATACTTATCACTATTGATCTCATCAAAGAACTTAAAAGAAATGTATACTACTAACTTCACTGATGGCTATACATAAACACATGTACCCGGATGGTCGGCCTTTTAATTATTCTGACCTGATTACAAGTTAGTTCTTTCAGTTTGGGAAAGTATATATTTTGTAGTGAATCTCAGCTTGGTCAAATATCTTCTGAGCACATACGCGGTGTATAGAAACCTGTGCATGTGTGTACACACTGATGACGCTGGCGGGCTGCATGGCAATTAGATGCTTGCCATTCAGGTGGTTATGATGGTCACTAGTCCCCGTTTGCATACACAGTGCCGGCCCGTAGAGAGTGCACCTTAGTTCATTGCCCTTTTACTCCTGTATTCCTTGGTTGGTTATGGTTATTCTCATTGCTATGTGTCTGATCTTCGGGCTACGCGTCACTACCTAGGTGCTGTGGTTGATCGTCTGCTGTCTAATGTGACATCTGATACACCGAATATAGGATATAACTAAAGTTCTTGGAATAGCAATGTCTGGGATCCGAAAAGGTCTTAAGTTTTTTACCAATCTAACGTAAACTCACCTTTCAGCTTTGAAAGGTTTAAGTAGGTTGTCTGGGGTCTTTGCATCCTAAGGTATTTAGATTGTAGTCGGGGAGTTACTGAGGAGAGTCCTAAGAACGGCAGGCAACTGTTGAACTTCTGCTGTGAATGACATAGGAATACTTGAAGATGAGTATGTTCCTGATGTTGTTGTCGGATGCCAGGACTTGTACTACGATTTCATGGTCTTTCCGCGGCTTCTATGAGAAGGTAATTCCTTGAGAAAGCGTTGTAGTTGCTCAGTTTTTGCAGAGTTGGTTGATAAGATGGAATCATCCAAGTTCCCTGCTTGGTAGGTTGAATTGGCCACCTTAAGTCCTGTGACGTTGTTTATTGGGGTTCATGCGGTTTTCTGTTTTGAAAATAGGCAATACTGCGTTTGGTGTGTGGGGAAGCGAGGATCTTGTTAAGACCTCCCACAGGGTGTGGCCAGCTTAACTGCTGGGCTTTTCGTACTAAAATGTACTACTTCAACTCGTTGCGCTACTCTGATTAGTGATTAGAGTGGTGATCTGATTTGATCACCTCCATCATCAATCTGCACATTAGTGTTCGAGATATGTTGTACCTTTCCAAATAAGGTTCTCTTTCGAAGTAGTTATGGAAGTCGCCGCATAGGCTGATTACGGGATGAAGTTACATCTCTCCTGACCTTAGATTTTCTCAGCTCATCATCTATAGTATTTATCCCCAGAAGTTATGTTTGATTGTAGGCAGTAGCAACTCTAGCAAGTGCAGGTTACTCAAAAGATTTGCTTTTATCCATTTTCCAGTCGGCCGTACCTTGGTTTAATTGTTTCTGGCAATGCAGGCACTGTTGGATTATGAGAGATTTCAAACGGGTGGTTGTCTACCTTCAAGTTTTGGAGGAAAAGACCTAAACCAAGGAGATGCATTGCTTTCTGGATTTGAAAACCAAGCTGCAATGTCTCCGACGACTCCTTCTTCGCAGGTAATTTCAGCCACAAGGCAAGGCCGTGTGGTAACACGGAAGTGACGGTCACAGGAAGCACGGGATTAAGGCTTAGTTTGCTGAGGTCATCAGAGCAGGAAATAAGTGAAACATGCCCTTCTTACAGTCTTCGGAAGTCTGTGAATTATACATTAGATGCCGTAGATGTTCCATCGGTGTAACATTAAGACAAACTGTCAGTTGAAGAAGTCTTTGCCATGGTTTGTAATGGAGAACTACTCAGTAAGATGGGCTTTAACCTAGAAGCTTTTTGTAAAATTTACATGTGCGGTGTTACAATGATTCTGCTTCCTGGTGGCGGCCTCAGCCGAATGCAGCAGCAGCCTCTGGATCTGGGAGAGCGAGGAGAGACGCTGCTGCCCGTGCCATGCAAGGTTGGCACTCTCAAAGAGCTGGTAATGGAGAGGTTGGAGATCCCATAATCAAGGTAGAGCTTCTTGACCAGCATGTGGGAGTTACCAATGGTGGGGAAGTACTAAGTGTAGGTAGAGTCTCGAAGTGTTTGCCTCTTTTATGGAGTCTGCTTGGGCAAGTCCAACTTGTAGATGCCAAGTTGAGTTGGATGTCGGAAACTGATGCTTTTTACTTGGACTTTCAAAGTTACTCCTTATTAGACGCAGGTAAAACCGTCATGTACTGACGTAGATGTTGCCGGAATGGGAATGTGGGGTTGATAGGAAAAGAGCGGCGTGTTGAAGAAGGAGAAGCAGTTGAAGAGTTTGGGTATGCCCAACTTTGTTTCTTGTGTGTTATCTTGTCTTTTTTCTAATTGTTAATCCTTTGTAGGTGGCTTGGTCCCCATAAGTGTACATAATTTCTGATTCTCGAGTGTTGGAAACTACCTTCTGTACAATCCGTCTGTTTCAACTGTTTGCCCCAGGTGGAACGAAACGTAAGGAAACTGCTTCGTTGGTGGAGCGAGCTGTAAAGGTTGCTCGAGCAAAAGGAGTTAGGTCTCGGTCCTTGGATGACGTCCCTTCTGAGAACGCTCTTAGTGCCGGTGCAAATATCTCAAAGGCTGGGCCTTTGTTGAAGAAGTCAGCAAAGCAGGACCGGTCAAAGCACGGTACTAAAAGCACCAGCATGGAGCCAATGAAAGGTCTCAAATTAGTAATAACAGATGACGGCCCTCCTGCAGACTGGGTCAAAATTAATGCATACAGAAATGTAAGTACTGTGCTCGTCAGATACACTCCTATCATTGTTGTGTTCATGACTATTGTCAGTTTTTTAGTGATGCCATTACGCGACTGCTTCTTTCATTGTCCTATCTGTTTGTTGTTTAGCGTGCTATGGGTCGTTAAACTTTCTAAACGTTCGTCATCACCGGTTACAGAAGAATGTCAGTTTAAAAGTCCTTTCTTGTTCAGCAATATCCAGTTCCAAATGACTCTTGAACAGGATCCAGGCATACACCCTCCAGATTTCCTCTGTTTCTCCCTCAGACGATTTGCACTGCGTTTGTGGCCTTGTGGGGAGGTAGCTTGTCCCTTTGACTCGGTTTACAAAAATGGAGATGATTTATCATTGGGATGATAACACTTTTACAAAATCCACTATTTGTTTGATTGTCAAGTAAACTTTCCAGAGTTCTCGGTGGGTCTTAAGCTAAAAATTGTATGCTTAATATTTCATCTAATGGAATAACTTGGCACTTTGAACGCTGCCTGATACCGATCTGCTATGCTAGAATAGTTTGAAAAGCGTAAATGCAACTTCTTGTAAAAATTGGCTCAATACAACCTATTCATTGTATAATTATTTACTTCAAGTTATGTTTCATCGCTTATCAGGTATGTATCCTCTTGTGGGTCGTGACGTTGATATCAAATATGTCGATTAATATATAAAAGCTTCGATATACACCTAGAGCCCTTTCAGCTATAGAAGCTTTAACATATATATAGATATATATTTCAAATTTTATAACAAGTGATAATTCCTACTCCATATATTGCGTCGAAGTTTTTCGGACTCTGTATTAGCTAACTTGTTTTCATTAAGAGAAGTTAGTTCAGGTTGCCGACAATAAGTTTCTTCTTCACCGCCTTCTGTTTTAAATTCAAGTTCCAACAATCAAACATAAAATAGTGAAGTACCTTGGATTATGGTGCGCCTGTTGCGCGAGTTGGTTTTTTAGTCCAACCTCATACTTTTCAAGCGTTGGATGAAGCATATTCATGCGCAACCCAACTTGTAATATCCGCGCTTAGGCTTCGTGTGTTGAACGTAGCTAATAGGATTAAAGTCCCGAATTTGTAATTATTTCGATGAGGTTCCACTTGTTCTCTTCTCTAGCGAAGTGAACTTTGACGCCCATTTTTTGGTTTGTCCTTATACACAACAGATATTCGTAAAATATTTCCGTCGAGGATTTTTTCGAGGTGTTGAATGTCGAGATGAAAGATAAATGCTTTCATCTTTGGCAATAGTTGCCACTCTCAGTGGGTATGACATGCCTATCTATACGAGAGTGCGAAATATTTTACGTCATTTAGACTTCTCTGTCTGGAGGAAATATGTCGAACTTCGTGGAACACAATCCACGAACGTTTGATCTTCGTTGGTATATTCGCCATGTCTTATTAGTTTTCTAAATGGCCACTTAAACTTTCCTTATCGGGTTATTTTCTTCCACGTGTCAGGGAGCTAACATTGATTACGAACATTCTCTGGAATTCGATGCATTTTAAGCAATGTTCGTAATCAATGTTAGCTTTTCATACTTATCTCCTGTTTGAATCATGTGGTTTACCCTTCAGAAAGTCTTTCTTCAACCAACTTCCAGTGTCGGAACTGCAACATTTTCCACCTGGTTTTTGTCTGTTCAATTTCTACACATTACACTAAATTTAGTGTACTGTGGCAGTCCAAAACCTGTAAGTATGTTGACCCTCATGTCTCTTGACCTGCAGATGTGGAGCTGGTTGTTGAGCATCACCTCTGCCACCTGCATCTGATTCTTGGGGTTTTCAAGCACTGAAGATGAAAGTTTGCAGTCTTCAGTCTCTAATTTCAGTGACGGGTGGTTTCCACTCGTTTGAAGCTTTATATAGCTCTGTAGGGATTTTCCTGGGAATTATTATCTACAACCAAACGGCAATGAATAAGTAAAACCCATTTTGTTAAGTGTAATAGGTCCAATATCGTCGGTTTCACACATAGGAAGAGATCTATTCTGTTGGTGAACTTCATTCATCCTCCAGTTGCTCAACAACTAACGCTTGACTCGCCTAAGTTCAAAATCGACTTGAGGCCCTGGAACCCCTTCCTTTCGCTTCATTCTTCCGTGTTCATACGGCTCCATATGACGAGTACCACGCGGCTTTTCTTTTTCAAAAAGTAATTTTCTCATGAGTAGCTTCATGTCACAGCCTGCAGAGAGTAGACACTGTGCCCTAGCCGTGCCTTGCTAGGAATAACAGATTGAGAGGAGTAAGCTGGGGCAAAAAAGACTTCGATTTGTAAAAGTGGCCAAGATAGCTGTCTATCTAGAGAATAGGGGTTTTTTGGGACCCTAGTTTGTATAGCTTTTGCTGTTTGCCTTCTATCTACAATATTAGGAGTTTGTTCCCGAACTGTTTAAAATGAGATGTTGCAGCATTGTCTGCATCTAGTATCGTCTCTGGACAAATGAGTTCTGTGACCTACTTATTGTAGTCTTTAAGAATTTTCGGTTGTCCGTTAGTCACTTTGACCTCTTGCTTTGCCAGCTGAGGATATGTGAAGTTCATGAACGCTGCATTGTTTACCACAGTATTCTACTAACTTTTAAGTTGGATGAATGTACCTGGCAGACGGACGGCTACGAGATCTACGCCCTTGTTCCAGGCCTTGCTCGCGAAGAGGTAAAACTCTTCTGCCGAATTTGCGGACTATATCATGGCCAGTGGAGACATATCTTTTTTTTAACTATTCTATTTCAGTCGAAATTTACCTTTTAACTGTAGGACGCTTCTTCACATTTTACAAATTGTATATCACCAGGATATCAATTGTTTCTGCAGATATAATTATCGGTCATAGATGAAGGTTGCGCTAATGTATCTAGGCAATTATTTGCCTTCGGTCTGAGGAATGGTCTACTTTCTTCCTTGATTCACTAGTAGTGATGTCTGACAGGTAAGAATCCAGTGTGAAGAAGGTGGACGAGTGGTTATATGTGGATCCCCCGAACAGCCCAGCAATCCTTGGGGCGTTACAGCGTTTAGGAAGGTGAGCTTTTGCCTTAAAGAAGTGAAATGGCTTGTGTTGCAGAGACAACGCAGTGATGGACAGATGCCTCATTTATCCCTAGTTTGATACTAATAACTTGGTCCAATATGATTCATGAAGATTTTCCTTTTGTCTAGCTTAATCATCTCAATCTTTTCATAATGTCGTTGATTAAGTGAGACTCGCTTGACGTTAGCAGTAGGTGATTTACCTTGACCTTCTTGTGCAAGTTTTATATTTTGCCAATTTTGGTTGGATGCAGGTTATCAACTTGCCTTCTAAAATAGATGCTCATCACACGTCAGCTGTTGTAACTCTCTACGGACAGCTGTTCGTACGTGTGCCATTCGCTCATAGTTTCCAATAGTCTGATTCAACATTGAGGAGGAATTTCTAAGAGACCAAACTTACCAGTTCTGATATCTGCATCACTCGAGTATTCTGGGATTACTCGGTCAGGAGTTGCATCTACAGGAGCTCCGGTTTGTATAGTGTTAAGATAGGAAGCAAGCATTGAGGGCTGGTTGTAGGGCCCTGTTGGGAGCAGAATGTATATTCATGTAGTATTCAGATGAATGGGGAGATCGTCAAATAGATACAGAGAGATTTATCGAAAGTGTAGAGTTAAATTGTAGCTAATCAAAATACTTGTCGTATGACAAGTGGTTTCACTTTTCGAATGAAATTTGTCGATTCCCATTGAAATCAGGCCGTTGAGGTA

mRNA

>Mapoly0013s0062.1
ATGAACGAGAGAGAGGTTCAGGCGGCAGTGGCCCGCGAGGTAGACAGACGACCATTGAGAGCAGCAGGAACAATGTGAGTTCGGAATATTATTTCTATCTAGGGCAGAGAGATTGGGATTGCGACATCTTGTTGGTGTGTAGGGAAAGGGTTGCGTAGGGTGGAGGAGAGTTCTGGAGGAGGAGGTGGTTGTCTCGGGCTACAGCAGAGGAAGCATGGCGGGGCCTCGGTAGAAATCATGTCGTGTGCATTTCGTCGGAAGGAGGGCTGATAATTTCGCTGTGGGTCGTAAAAGATCGCTTCAAGAAAATTTGTGGGAGGTCGGGAGGGCTGTGAGGGACGAACCTCGAACCATTAGGTCAGCTGGTCACCAGTAGCGCATTGTGATCAATCCAAAGAAGGAGTGGGTGTGGAGTCGATTGACATCGGGGGTTTGGGTTTTTTCGATTCGCTGGTTAGGATTTCCCAGCCAGGATTTTTGCACACATATTGCCATAGTGGAAAGAGGGTGGCTGTCATGACAGAACCTGAAACTGAAATTGGGAATGGAGCGTCGGCCACCATAGATAGCCAGCCTACAGTGACCGATGCACCGCAGGAGCCTGTTGAAGCTGAGGTGGTGAAAACTTCGAGTGGCGAGCATACGGAGAGTTTACGGCCTCGGGACGTGAAGCAAGCACCGAATGTGAGCACCGAGGGACTCTTCGCCAAGAAAGCTGAAAGCGAGGAAGTCGTCAACAAAGAAGACGACAAGAAGGTGGCAGAGATGAAAATAGACGAGAAGGATGTGGAGGAGAAGGAGGTCCAAGCGAAGGTGGGAGAAAGAAAAGACGGAGCCAAGAAAGAAAGAGTCTTGAAAGAAGAAGACAAACACGAGGAAGAATTAGAGGAAGAAGAAGAGGAGGAGGAAGAAGAAGAAGAGGAAGAAGAGGAGGAGGAAGAAGAACCATTACAAGCGAGAATGGTTTCATCAAAGGATGAAAAGATGGAGGAAGAAGAGGAAGAGGAAGAAGAAGAAGAGGAGGAAGAGGAGGAGGAGGAGGAGGTAGAAGAGGAAGAGGTGGAGGAGGAAGAGGTGGAAGAGGATGAGGTTGATGACAAGGACGGCAGCATTGAGGAGCAGATCGCTTTCACGAGGGTCCTCGAAAACTTCTTTAGGGATAGGAACTTGGAGTATAAAGCTCCGAAGTTTTACGGAGAAGAACTGAATGTTCTGAAGTTATGGAAGGCAGTGACTTCTCTCGGGGGTTACGAACAGGTTACTTCTGGCAAGTTATGGCGACAAGTTGGCGAACAGTTCAAACCTCCCAAGACTTGTACTACGATTTCATGGTCTTTCCGCGGCTTCTATGAGAAGGCACTGTTGGATTATGAGAGATTTCAAACGGGTGGTTGTCTACCTTCAAGTTTTGGAGGAAAAGACCTAAACCAAGGAGATGCATTGCTTTCTGGATTTGAAAACCAAGCTGCAATGTCTCCGACGACTCCTTCTTCGCAGCCGAATGCAGCAGCAGCCTCTGGATCTGGGAGAGCGAGGAGAGACGCTGCTGCCCGTGCCATGCAAGGTTGGCACTCTCAAAGAGCTGGTAATGGAGAGGTTGGAGATCCCATAATCAAGGAAAAGAGCGGCGTGTTGAAGAAGGAGAAGCAGTTGAAGAGTTTGGGTGGAACGAAACGTAAGGAAACTGCTTCGTTGGTGGAGCGAGCTGTAAAGGTTGCTCGAGCAAAAGGAGTTAGGTCTCGGTCCTTGGATGACGTCCCTTCTGAGAACGCTCTTAGTGCCGGTGCAAATATCTCAAAGGCTGGGCCTTTGTTGAAGAAGTCAGCAAAGCAGGACCGGTCAAAGCACGGTACTAAAAGCACCAGCATGGAGCCAATGAAAGGTCTCAAATTAGTAATAACAGATGACGGCCCTCCTGCAGACTGGGTCAAAATTAATGCATACAGAAATACGGACGGCTACGAGATCTACGCCCTTGTTCCAGGCCTTGCTCGCGAAGAGGTAAGAATCCAGTGTGAAGAAGGTGGACGAGTGGTTATATGTGGATCCCCCGAACAGCCCAGCAATCCTTGGGGCGTTACAGCGTTTAGGAAGGTTATCAACTTGCCTTCTAAAATAGATGCTCATCACACGTCAGCTGTTGTAACTCTCTACGGACAGCTGTTCGTACGTGTGCCATTCGCTCATAGTTTCCAATAGTCTGATTCAACATTGAGGAGGAATTTCTAAGAGACCAAACTTACCAGTTCTGATATCTGCATCACTCGAGTATTCTGGGATTACTCGGTCAGGAGTTGCATCTACAGGAGCTCCGGTTTGTATAGTGTTAAGATAGGAAGCAAGCATTGAGGGCTGGTTGTAGGGCCCTGTTGGGAGCAGAATGTATATTCATGTAGTATTCAGATGAATGGGGAGATCGTCAAATAGATACAGAGAGATTTATCGAAAGTGTAGAGTTAAATTGTAGCTAATCAAAATACTTGTCGTATGACAAGTGGTTTCACTTTTCGAATGAAATTTGTCGATTCCCATTGAAATCAGGCCGTTGAGGTA

CDS

>Mapoly0013s0062.1
ATGACAGAACCTGAAACTGAAATTGGGAATGGAGCGTCGGCCACCATAGATAGCCAGCCTACAGTGACCGATGCACCGCAGGAGCCTGTTGAAGCTGAGGTGGTGAAAACTTCGAGTGGCGAGCATACGGAGAGTTTACGGCCTCGGGACGTGAAGCAAGCACCGAATGTGAGCACCGAGGGACTCTTCGCCAAGAAAGCTGAAAGCGAGGAAGTCGTCAACAAAGAAGACGACAAGAAGGTGGCAGAGATGAAAATAGACGAGAAGGATGTGGAGGAGAAGGAGGTCCAAGCGAAGGTGGGAGAAAGAAAAGACGGAGCCAAGAAAGAAAGAGTCTTGAAAGAAGAAGACAAACACGAGGAAGAATTAGAGGAAGAAGAAGAGGAGGAGGAAGAAGAAGAAGAGGAAGAAGAGGAGGAGGAAGAAGAACCATTACAAGCGAGAATGGTTTCATCAAAGGATGAAAAGATGGAGGAAGAAGAGGAAGAGGAAGAAGAAGAAGAGGAGGAAGAGGAGGAGGAGGAGGAGGTAGAAGAGGAAGAGGTGGAGGAGGAAGAGGTGGAAGAGGATGAGGTTGATGACAAGGACGGCAGCATTGAGGAGCAGATCGCTTTCACGAGGGTCCTCGAAAACTTCTTTAGGGATAGGAACTTGGAGTATAAAGCTCCGAAGTTTTACGGAGAAGAACTGAATGTTCTGAAGTTATGGAAGGCAGTGACTTCTCTCGGGGGTTACGAACAGGTTACTTCTGGCAAGTTATGGCGACAAGTTGGCGAACAGTTCAAACCTCCCAAGACTTGTACTACGATTTCATGGTCTTTCCGCGGCTTCTATGAGAAGGCACTGTTGGATTATGAGAGATTTCAAACGGGTGGTTGTCTACCTTCAAGTTTTGGAGGAAAAGACCTAAACCAAGGAGATGCATTGCTTTCTGGATTTGAAAACCAAGCTGCAATGTCTCCGACGACTCCTTCTTCGCAGCCGAATGCAGCAGCAGCCTCTGGATCTGGGAGAGCGAGGAGAGACGCTGCTGCCCGTGCCATGCAAGGTTGGCACTCTCAAAGAGCTGGTAATGGAGAGGTTGGAGATCCCATAATCAAGGAAAAGAGCGGCGTGTTGAAGAAGGAGAAGCAGTTGAAGAGTTTGGGTGGAACGAAACGTAAGGAAACTGCTTCGTTGGTGGAGCGAGCTGTAAAGGTTGCTCGAGCAAAAGGAGTTAGGTCTCGGTCCTTGGATGACGTCCCTTCTGAGAACGCTCTTAGTGCCGGTGCAAATATCTCAAAGGCTGGGCCTTTGTTGAAGAAGTCAGCAAAGCAGGACCGGTCAAAGCACGGTACTAAAAGCACCAGCATGGAGCCAATGAAAGGTCTCAAATTAGTAATAACAGATGACGGCCCTCCTGCAGACTGGGTCAAAATTAATGCATACAGAAATACGGACGGCTACGAGATCTACGCCCTTGTTCCAGGCCTTGCTCGCGAAGAGGTAAGAATCCAGTGTGAAGAAGGTGGACGAGTGGTTATATGTGGATCCCCCGAACAGCCCAGCAATCCTTGGGGCGTTACAGCGTTTAGGAAGGTTATCAACTTGCCTTCTAAAATAGATGCTCATCACACGTCAGCTGTTGTAACTCTCTACGGACAGCTGTTCGTACGTGTGCCATTCGCTCATAGTTTCCAATAG

Protein

>Mapoly0013s0062.1
MTEPETEIGNGASATIDSQPTVTDAPQEPVEAEVVKTSSGEHTESLRPRDVKQAPNVSTEGLFAKKAESEEVVNKEDDKKVAEMKIDEKDVEEKEVQAKVGERKDGAKKERVLKEEDKHEEELEEEEEEEEEEEEEEEEEEEEPLQARMVSSKDEKMEEEEEEEEEEEEEEEEEEEVEEEEVEEEEVEEDEVDDKDGSIEEQIAFTRVLENFFRDRNLEYKAPKFYGEELNVLKLWKAVTSLGGYEQVTSGKLWRQVGEQFKPPKTCTTISWSFRGFYEKALLDYERFQTGGCLPSSFGGKDLNQGDALLSGFENQAAMSPTTPSSQPNAAAASGSGRARRDAAARAMQGWHSQRAGNGEVGDPIIKEKSGVLKKEKQLKSLGGTKRKETASLVERAVKVARAKGVRSRSLDDVPSENALSAGANISKAGPLLKKSAKQDRSKHGTKSTSMEPMKGLKLVITDDGPPADWVKINAYRNTDGYEIYALVPGLAREEVRIQCEEGGRVVICGSPEQPSNPWGVTAFRKVINLPSKIDAHHTSAVVTLYGQLFVRVPFAHSFQ

Mapoly0013s0062.2  

Gene structure:

mRNA scaffold_13:590704..600068  ( - strand )
three_prime_UTR scaffold_13:590704..591057  ( - strand )
CDS scaffold_13:591058..591162  ( - strand )
CDS scaffold_13:591425..591517  ( - strand )
CDS scaffold_13:591792..591842  ( - strand )
CDS scaffold_13:594473..594759  ( - strand )
CDS scaffold_13:594917..594962  ( - strand )
CDS scaffold_13:595213..595332  ( - strand )
CDS scaffold_13:595661..595801  ( - strand )
CDS scaffold_13:596403..596448  ( - strand )
CDS scaffold_13:597296..597348  ( - strand )
CDS scaffold_13:597497..597536  ( - strand )
CDS scaffold_13:598411..598862  ( - strand )
five_prime_UTR scaffold_13:598863..599030  ( - strand )
five_prime_UTR scaffold_13:599474..600068  ( - strand )

Sequences:

Gene

>Mapoly0013s0062.2
CAAATCAGAACCGGACAGGAGGCTCACATCGTCTCTTGGTTAAGGTCCTCTCTTCTAAGGCCGAGTCGCGTGGAAATGTCGGACTTTCCGCTCTAACAAAGGGGAGGGAATGCTCTGAAGACGAGTAGGGAAGGACATGAACGAGAGAGAGGTTCAGGCGGCAGTGGCCCGCGAGGTAGACAGACGACCATTGAGAGCAGCAGGAACAATGTGAGTTCGGAATATTATTTCTATCTAGGGCAGAGAGATTGGGATTGCGACATCTTGTTGGTGTGTAGGGAAAGGGTTGCGTAGGGTGGAGGAGAGTTCTGGAGGAGGAGGTGGTTGTCTCGGGCTACAGCAGAGGAAGCATGGCGGGGCCTCGGTAGAAATCATGTCGTGTGCATTTCGTCGGAAGGAGGGCTGATAATTTCGCTGTGGGTCGTAAAAGATCGCTTCAAGAAAATTTGTGGGAGGTCGGGAGGGCTGTGAGGGACGAACCTCGAACCATTAGGTCAGCTGGTCACCAGTAGCGCATTGTGATCAATCCAAAGAAGGAGTGGGTGTGGAGTCGATTGACATCGGGGGTTTGGGTTTTTTCGATTCGCTGGTTAGGGTACGTGTTTTGTACCTCTCGGTGTGGTTTTACACTCTGCACAACGGTCGTACGTGTGAGGTCACAACTGCTAGAGATTGCTGTTGGAACTGTGTTTCCTGATTCGCAAGTTCGACACAACTTTTATCACATCATTGTATCAAGCTTTCTCGTCAGCTGTAGTTACGTGTCTGTCGTTTGTTTGCTCTCGTGGTCTGGTTTATTGCTAGGTCACCCTCTCTATTCACCAGGCTGTTCTGCATTTTCGCCCTTCTCCAGTTTTTCATTCTTGAAAGCTAGTCCGTTTGCCTCCATTCCGAAATCAGATTTCCCAGCCAGGATTTTTGCACACATATTGCCATAGTGGAAAGAGGGTGGCTGTCATGACAGAACCTGAAACTGAAATTGGGAATGGAGCGTCGGCCACCATAGATAGCCAGCCTACAGTGACCGATGCACCGCAGGAGCCTGTTGAAGCTGAGGTGGTGAAAACTTCGAGTGGCGAGCATACGGAGAGTTTACGGCCTCGGGACGTGAAGCAAGCACCGAATGTGAGCACCGAGGGACTCTTCGCCAAGAAAGCTGAAAGCGAGGAAGTCGTCAACAAAGAAGACGACAAGAAGGTGGCAGAGATGAAAATAGACGAGAAGGATGTGGAGGAGAAGGAGGTCCAAGCGAAGGTGGGAGAAAGAAAAGACGGAGCCAAGAAAGAAAGAGTCTTGAAAGAAGAAGACAAACACGAGGAAGAATTAGAGGAAGAAGAAGAGGAGGAGGAAGAAGAAGAAGAGGAAGAAGAGGAGGAGGAAGAAGAACCATTACAAGCGAGAATGGTTTCATCAAAGGATGAAAAGATGGAGGAAGAAGAGGAAGAGGAAGAAGAAGAAGAGGAGGAAGAGGAGGAGGAGGAGGAGGTAGAAGAGGAAGAGGTGGAGGAGGAAGAGGTGGAAGAGGATGAGGTTGATGACAAGGACGGCAGCATTGAGGAGCAGATCGCTTTCACGAGGGTCCTCGAAAACTTCTTTAGGGATAGGAACTTGGAGTATAAAGCTCCGAAGTTTTACGGAGAAGAACTGAATGTTCTGAAGTAAGCCGAATTTACCATTATCCTCACACGTGATTTGCTCTTGTCTCTTTGGAAGTTCTAGCTGTTTTTGGAATTGACACAGAACTGTGGTAGACATGAATTCTATTTGGAATGGAGTTTGAGCAGGGAATATCGATTATCTTGCACTCCTGACTTCGTAGAGGGCACACAGACTGCACTATAGTTTTTTTTTGTCAACAAAGAGATATACTTCTGTTTTAATTTTTCTGTTTCCGAAGGATATAGTGCAGGGCTGGAGGCGTTGTCCTTTATCTGGTAGTAGTCGTTGTGTTCGAAAGTTCCTCTAATCACCTGTAACATCCGCCCTGCTTTCGCGTCTTCTCCGGTTTCTTGACACTAGGACTGCGTTTTTGAGTGTGCTTTGTGTCACATCTTTCCTAATTTACTCTGCCCCTTCCAATTGAGGTGCTTCGTCCAGTTTTGTAATATACCAACGGCATTTGAGATCTAAGATAATTATTTCGGCTCCTCTTCAGCCTACAAGTTTGTACTGTCAGTCATTATCTGATGGTCTTTAGGGACACCCTGGAAGTTTGTAGTGTCGTTAGTTGATCGGTGAAGTTTGTAGTATTCCAAATTCGCGTGTAAGAATGTCCTCGTCTACCTTACTGACATTATGTAACATCGGTTTCTATCCTGTTTCCTTCCTTGACCTGAATTCCATTTCACGCTCTGCTTCTGCCTTGATTGTCATTTCTAGTATTTTATTTATCTCGTTTGGTTTCTCAGTCAGCTCAGATTTTGTTGTGTCTTTCTCGTATGGGTAGCTTTAAGGTTCCAGTCAATCTCACAATGTGATAAGCCTTTAGCAACCTGTTTTGAATGACTTACATTCTTTGCGTGATATGTTCAGGTTATGGAAGGCAGTGACTTCTCTCGGGGGTTACGAACAGGTATTGTACTGAAAAGTGGCAAATGTTTGCTTTTATTGATAGATAATTCTCTTATAGATTCATTCATGATAAATTACTTGAAAGCCTAGAATGGATCTTTCAACTTTGAAAATTTCGTGAAAATCGATCGAGATACCCTTTGTTGTAGGTTACTTCTGGCAAGTTATGGCGACAAGTTGGCGAACAGTTCAAACCTCCCAAGTGAGTGATGTGATGCACGTTTGAGTTAAATCCTTGTCTTCCAACTTCGCTCAGTAAGGAGTAATTTATACCTGTAAATAGATGAGATTATACTTATCACTATTGATCTCATCAAAGAACTTAAAAGAAATGTATACTACTAACTTCACTGATGGCTATACATAAACACATGTACCCGGATGGTCGGCCTTTTAATTATTCTGACCTGATTACAAGTTAGTTCTTTCAGTTTGGGAAAGTATATATTTTGTAGTGAATCTCAGCTTGGTCAAATATCTTCTGAGCACATACGCGGTGTATAGAAACCTGTGCATGTGTGTACACACTGATGACGCTGGCGGGCTGCATGGCAATTAGATGCTTGCCATTCAGGTGGTTATGATGGTCACTAGTCCCCGTTTGCATACACAGTGCCGGCCCGTAGAGAGTGCACCTTAGTTCATTGCCCTTTTACTCCTGTATTCCTTGGTTGGTTATGGTTATTCTCATTGCTATGTGTCTGATCTTCGGGCTACGCGTCACTACCTAGGTGCTGTGGTTGATCGTCTGCTGTCTAATGTGACATCTGATACACCGAATATAGGATATAACTAAAGTTCTTGGAATAGCAATGTCTGGGATCCGAAAAGGTCTTAAGTTTTTTACCAATCTAACGTAAACTCACCTTTCAGCTTTGAAAGGTTTAAGTAGGTTGTCTGGGGTCTTTGCATCCTAAGGTATTTAGATTGTAGTCGGGGAGTTACTGAGGAGAGTCCTAAGAACGGCAGGCAACTGTTGAACTTCTGCTGTGAATGACATAGGAATACTTGAAGATGAGTATGTTCCTGATGTTGTTGTCGGATGCCAGGACTTGTACTACGATTTCATGGTCTTTCCGCGGCTTCTATGAGAAGGTAATTCCTTGAGAAAGCGTTGTAGTTGCTCAGTTTTTGCAGAGTTGGTTGATAAGATGGAATCATCCAAGTTCCCTGCTTGGTAGGTTGAATTGGCCACCTTAAGTCCTGTGACGTTGTTTATTGGGGTTCATGCGGTTTTCTGTTTTGAAAATAGGCAATACTGCGTTTGGTGTGTGGGGAAGCGAGGATCTTGTTAAGACCTCCCACAGGGTGTGGCCAGCTTAACTGCTGGGCTTTTCGTACTAAAATGTACTACTTCAACTCGTTGCGCTACTCTGATTAGTGATTAGAGTGGTGATCTGATTTGATCACCTCCATCATCAATCTGCACATTAGTGTTCGAGATATGTTGTACCTTTCCAAATAAGGTTCTCTTTCGAAGTAGTTATGGAAGTCGCCGCATAGGCTGATTACGGGATGAAGTTACATCTCTCCTGACCTTAGATTTTCTCAGCTCATCATCTATAGTATTTATCCCCAGAAGTTATGTTTGATTGTAGGCAGTAGCAACTCTAGCAAGTGCAGGTTACTCAAAAGATTTGCTTTTATCCATTTTCCAGTCGGCCGTACCTTGGTTTAATTGTTTCTGGCAATGCAGGCACTGTTGGATTATGAGAGATTTCAAACGGGTGGTTGTCTACCTTCAAGTTTTGGAGGAAAAGACCTAAACCAAGGAGATGCATTGCTTTCTGGATTTGAAAACCAAGCTGCAATGTCTCCGACGACTCCTTCTTCGCAGGTAATTTCAGCCACAAGGCAAGGCCGTGTGGTAACACGGAAGTGACGGTCACAGGAAGCACGGGATTAAGGCTTAGTTTGCTGAGGTCATCAGAGCAGGAAATAAGTGAAACATGCCCTTCTTACAGTCTTCGGAAGTCTGTGAATTATACATTAGATGCCGTAGATGTTCCATCGGTGTAACATTAAGACAAACTGTCAGTTGAAGAAGTCTTTGCCATGGTTTGTAATGGAGAACTACTCAGTAAGATGGGCTTTAACCTAGAAGCTTTTTGTAAAATTTACATGTGCGGTGTTACAATGATTCTGCTTCCTGGTGGCGGCCTCAGCCGAATGCAGCAGCAGCCTCTGGATCTGGGAGAGCGAGGAGAGACGCTGCTGCCCGTGCCATGCAAGGTTGGCACTCTCAAAGAGCTGGTAATGGAGAGGTTGGAGATCCCATAATCAAGGTAGAGCTTCTTGACCAGCATGTGGGAGTTACCAATGGTGGGGAAGTACTAAGTGTAGGTAGAGTCTCGAAGTGTTTGCCTCTTTTATGGAGTCTGCTTGGGCAAGTCCAACTTGTAGATGCCAAGTTGAGTTGGATGTCGGAAACTGATGCTTTTTACTTGGACTTTCAAAGTTACTCCTTATTAGACGCAGGTAAAACCGTCATGTACTGACGTAGATGTTGCCGGAATGGGAATGTGGGGTTGATAGGAAAAGAGCGGCGTGTTGAAGAAGGAGAAGCAGTTGAAGAGTTTGGGTATGCCCAACTTTGTTTCTTGTGTGTTATCTTGTCTTTTTTCTAATTGTTAATCCTTTGTAGGTGGCTTGGTCCCCATAAGTGTACATAATTTCTGATTCTCGAGTGTTGGAAACTACCTTCTGTACAATCCGTCTGTTTCAACTGTTTGCCCCAGGTGGAACGAAACGTAAGGAAACTGCTTCGTTGGTGGAGCGAGCTGTAAAGGTTGCTCGAGCAAAAGGAGTTAGGTCTCGGTCCTTGGATGACGTCCCTTCTGAGAACGCTCTTAGTGCCGGTGCAAATATCTCAAAGGCTGGGCCTTTGTTGAAGAAGTCAGCAAAGCAGGACCGGTCAAAGCACGGTACTAAAAGCACCAGCATGGAGCCAATGAAAGGTCTCAAATTAGTAATAACAGATGACGGCCCTCCTGCAGACTGGGTCAAAATTAATGCATACAGAAATGTAAGTACTGTGCTCGTCAGATACACTCCTATCATTGTTGTGTTCATGACTATTGTCAGTTTTTTAGTGATGCCATTACGCGACTGCTTCTTTCATTGTCCTATCTGTTTGTTGTTTAGCGTGCTATGGGTCGTTAAACTTTCTAAACGTTCGTCATCACCGGTTACAGAAGAATGTCAGTTTAAAAGTCCTTTCTTGTTCAGCAATATCCAGTTCCAAATGACTCTTGAACAGGATCCAGGCATACACCCTCCAGATTTCCTCTGTTTCTCCCTCAGACGATTTGCACTGCGTTTGTGGCCTTGTGGGGAGGTAGCTTGTCCCTTTGACTCGGTTTACAAAAATGGAGATGATTTATCATTGGGATGATAACACTTTTACAAAATCCACTATTTGTTTGATTGTCAAGTAAACTTTCCAGAGTTCTCGGTGGGTCTTAAGCTAAAAATTGTATGCTTAATATTTCATCTAATGGAATAACTTGGCACTTTGAACGCTGCCTGATACCGATCTGCTATGCTAGAATAGTTTGAAAAGCGTAAATGCAACTTCTTGTAAAAATTGGCTCAATACAACCTATTCATTGTATAATTATTTACTTCAAGTTATGTTTCATCGCTTATCAGGTATGTATCCTCTTGTGGGTCGTGACGTTGATATCAAATATGTCGATTAATATATAAAAGCTTCGATATACACCTAGAGCCCTTTCAGCTATAGAAGCTTTAACATATATATAGATATATATTTCAAATTTTATAACAAGTGATAATTCCTACTCCATATATTGCGTCGAAGTTTTTCGGACTCTGTATTAGCTAACTTGTTTTCATTAAGAGAAGTTAGTTCAGGTTGCCGACAATAAGTTTCTTCTTCACCGCCTTCTGTTTTAAATTCAAGTTCCAACAATCAAACATAAAATAGTGAAGTACCTTGGATTATGGTGCGCCTGTTGCGCGAGTTGGTTTTTTAGTCCAACCTCATACTTTTCAAGCGTTGGATGAAGCATATTCATGCGCAACCCAACTTGTAATATCCGCGCTTAGGCTTCGTGTGTTGAACGTAGCTAATAGGATTAAAGTCCCGAATTTGTAATTATTTCGATGAGGTTCCACTTGTTCTCTTCTCTAGCGAAGTGAACTTTGACGCCCATTTTTTGGTTTGTCCTTATACACAACAGATATTCGTAAAATATTTCCGTCGAGGATTTTTTCGAGGTGTTGAATGTCGAGATGAAAGATAAATGCTTTCATCTTTGGCAATAGTTGCCACTCTCAGTGGGTATGACATGCCTATCTATACGAGAGTGCGAAATATTTTACGTCATTTAGACTTCTCTGTCTGGAGGAAATATGTCGAACTTCGTGGAACACAATCCACGAACGTTTGATCTTCGTTGGTATATTCGCCATGTCTTATTAGTTTTCTAAATGGCCACTTAAACTTTCCTTATCGGGTTATTTTCTTCCACGTGTCAGGGAGCTAACATTGATTACGAACATTCTCTGGAATTCGATGCATTTTAAGCAATGTTCGTAATCAATGTTAGCTTTTCATACTTATCTCCTGTTTGAATCATGTGGTTTACCCTTCAGAAAGTCTTTCTTCAACCAACTTCCAGTGTCGGAACTGCAACATTTTCCACCTGGTTTTTGTCTGTTCAATTTCTACACATTACACTAAATTTAGTGTACTGTGGCAGTCCAAAACCTGTAAGTATGTTGACCCTCATGTCTCTTGACCTGCAGATGTGGAGCTGGTTGTTGAGCATCACCTCTGCCACCTGCATCTGATTCTTGGGGTTTTCAAGCACTGAAGATGAAAGTTTGCAGTCTTCAGTCTCTAATTTCAGTGACGGGTGGTTTCCACTCGTTTGAAGCTTTATATAGCTCTGTAGGGATTTTCCTGGGAATTATTATCTACAACCAAACGGCAATGAATAAGTAAAACCCATTTTGTTAAGTGTAATAGGTCCAATATCGTCGGTTTCACACATAGGAAGAGATCTATTCTGTTGGTGAACTTCATTCATCCTCCAGTTGCTCAACAACTAACGCTTGACTCGCCTAAGTTCAAAATCGACTTGAGGCCCTGGAACCCCTTCCTTTCGCTTCATTCTTCCGTGTTCATACGGCTCCATATGACGAGTACCACGCGGCTTTTCTTTTTCAAAAAGTAATTTTCTCATGAGTAGCTTCATGTCACAGCCTGCAGAGAGTAGACACTGTGCCCTAGCCGTGCCTTGCTAGGAATAACAGATTGAGAGGAGTAAGCTGGGGCAAAAAAGACTTCGATTTGTAAAAGTGGCCAAGATAGCTGTCTATCTAGAGAATAGGGGTTTTTTGGGACCCTAGTTTGTATAGCTTTTGCTGTTTGCCTTCTATCTACAATATTAGGAGTTTGTTCCCGAACTGTTTAAAATGAGATGTTGCAGCATTGTCTGCATCTAGTATCGTCTCTGGACAAATGAGTTCTGTGACCTACTTATTGTAGTCTTTAAGAATTTTCGGTTGTCCGTTAGTCACTTTGACCTCTTGCTTTGCCAGCTGAGGATATGTGAAGTTCATGAACGCTGCATTGTTTACCACAGTATTCTACTAACTTTTAAGTTGGATGAATGTACCTGGCAGACGGACGGCTACGAGATCTACGCCCTTGTTCCAGGCCTTGCTCGCGAAGAGGTAAAACTCTTCTGCCGAATTTGCGGACTATATCATGGCCAGTGGAGACATATCTTTTTTTTAACTATTCTATTTCAGTCGAAATTTACCTTTTAACTGTAGGACGCTTCTTCACATTTTACAAATTGTATATCACCAGGATATCAATTGTTTCTGCAGATATAATTATCGGTCATAGATGAAGGTTGCGCTAATGTATCTAGGCAATTATTTGCCTTCGGTCTGAGGAATGGTCTACTTTCTTCCTTGATTCACTAGTAGTGATGTCTGACAGGTAAGAATCCAGTGTGAAGAAGGTGGACGAGTGGTTATATGTGGATCCCCCGAACAGCCCAGCAATCCTTGGGGCGTTACAGCGTTTAGGAAGGTGAGCTTTTGCCTTAAAGAAGTGAAATGGCTTGTGTTGCAGAGACAACGCAGTGATGGACAGATGCCTCATTTATCCCTAGTTTGATACTAATAACTTGGTCCAATATGATTCATGAAGATTTTCCTTTTGTCTAGCTTAATCATCTCAATCTTTTCATAATGTCGTTGATTAAGTGAGACTCGCTTGACGTTAGCAGTAGGTGATTTACCTTGACCTTCTTGTGCAAGTTTTATATTTTGCCAATTTTGGTTGGATGCAGGTTATCAACTTGCCTTCTAAAATAGATGCTCATCACACGTCAGCTGTTGTAACTCTCTACGGACAGCTGTTCGTACGTGTGCCATTCGCTCATAGTTTCCAATAGTCTGATTCAACATTGAGGAGGAATTTCTAAGAGACCAAACTTACCAGTTCTGATATCTGCATCACTCGAGTATTCTGGGATTACTCGGTCAGGAGTTGCATCTACAGGAGCTCCGGTTTGTATAGTGTTAAGATAGGAAGCAAGCATTGAGGGCTGGTTGTAGGGCCCTGTTGGGAGCAGAATGTATATTCATGTAGTATTCAGATGAATGGGGAGATCGTCAAATAGATACAGAGAGATTTATCGAAAGTGTAGAGTTAAATTGTAGCTAATCAAAATACTTGTCGTATGACAAGTGGTTTCACTTTTCGAATGAAATTTGTCGATTCCCATTGAAATCAGGCCGTTGAGGTA

mRNA

>Mapoly0013s0062.2
CAAATCAGAACCGGACAGGAGGCTCACATCGTCTCTTGGTTAAGGTCCTCTCTTCTAAGGCCGAGTCGCGTGGAAATGTCGGACTTTCCGCTCTAACAAAGGGGAGGGAATGCTCTGAAGACGAGTAGGGAAGGACATGAACGAGAGAGAGGTTCAGGCGGCAGTGGCCCGCGAGGTAGACAGACGACCATTGAGAGCAGCAGGAACAATGTGAGTTCGGAATATTATTTCTATCTAGGGCAGAGAGATTGGGATTGCGACATCTTGTTGGTGTGTAGGGAAAGGGTTGCGTAGGGTGGAGGAGAGTTCTGGAGGAGGAGGTGGTTGTCTCGGGCTACAGCAGAGGAAGCATGGCGGGGCCTCGGTAGAAATCATGTCGTGTGCATTTCGTCGGAAGGAGGGCTGATAATTTCGCTGTGGGTCGTAAAAGATCGCTTCAAGAAAATTTGTGGGAGGTCGGGAGGGCTGTGAGGGACGAACCTCGAACCATTAGGTCAGCTGGTCACCAGTAGCGCATTGTGATCAATCCAAAGAAGGAGTGGGTGTGGAGTCGATTGACATCGGGGGTTTGGGTTTTTTCGATTCGCTGGTTAGGGAGCCTGTTGAAGCTGAGGTGGTGAAAACTTCGAGTGGCGAGCATACGGAGAGTTTACGGCCTCGGGACGTGAAGCAAGCACCGAATGTGAGCACCGAGGGACTCTTCGCCAAGAAAGCTGAAAGCGAGGAAGTCGTCAACAAAGAAGACGACAAGAAGGTGGCAGAGATGAAAATAGACGAGAAGGATGTGGAGGAGAAGGAGGTCCAAGCGAAGGTGGGAGAAAGAAAAGACGGAGCCAAGAAAGAAAGAGTCTTGAAAGAAGAAGACAAACACGAGGAAGAATTAGAGGAAGAAGAAGAGGAGGAGGAAGAAGAAGAAGAGGAAGAAGAGGAGGAGGAAGAAGAACCATTACAAGCGAGAATGGTTTCATCAAAGGATGAAAAGATGGAGGAAGAAGAGGAAGAGGAAGAAGAAGAAGAGGAGGAAGAGGAGGAGGAGGAGGAGGTAGAAGAGGAAGAGGTGGAGGAGGAAGAGGTGGAAGAGGATGAGGTTGATGACAAGGACGGCAGCATTGAGGAGCAGATCGCTTTCACGAGGGTCCTCGAAAACTTCTTTAGGGATAGGAACTTGGAGTATAAAGCTCCGAAGTTTTACGGAGAAGAACTGAATGTTCTGAAGTTATGGAAGGCAGTGACTTCTCTCGGGGGTTACGAACAGGTTACTTCTGGCAAGTTATGGCGACAAGTTGGCGAACAGTTCAAACCTCCCAAGACTTGTACTACGATTTCATGGTCTTTCCGCGGCTTCTATGAGAAGGCACTGTTGGATTATGAGAGATTTCAAACGGGTGGTTGTCTACCTTCAAGTTTTGGAGGAAAAGACCTAAACCAAGGAGATGCATTGCTTTCTGGATTTGAAAACCAAGCTGCAATGTCTCCGACGACTCCTTCTTCGCAGCCGAATGCAGCAGCAGCCTCTGGATCTGGGAGAGCGAGGAGAGACGCTGCTGCCCGTGCCATGCAAGGTTGGCACTCTCAAAGAGCTGGTAATGGAGAGGTTGGAGATCCCATAATCAAGGAAAAGAGCGGCGTGTTGAAGAAGGAGAAGCAGTTGAAGAGTTTGGGTGGAACGAAACGTAAGGAAACTGCTTCGTTGGTGGAGCGAGCTGTAAAGGTTGCTCGAGCAAAAGGAGTTAGGTCTCGGTCCTTGGATGACGTCCCTTCTGAGAACGCTCTTAGTGCCGGTGCAAATATCTCAAAGGCTGGGCCTTTGTTGAAGAAGTCAGCAAAGCAGGACCGGTCAAAGCACGGTACTAAAAGCACCAGCATGGAGCCAATGAAAGGTCTCAAATTAGTAATAACAGATGACGGCCCTCCTGCAGACTGGGTCAAAATTAATGCATACAGAAATACGGACGGCTACGAGATCTACGCCCTTGTTCCAGGCCTTGCTCGCGAAGAGGTAAGAATCCAGTGTGAAGAAGGTGGACGAGTGGTTATATGTGGATCCCCCGAACAGCCCAGCAATCCTTGGGGCGTTACAGCGTTTAGGAAGGTTATCAACTTGCCTTCTAAAATAGATGCTCATCACACGTCAGCTGTTGTAACTCTCTACGGACAGCTGTTCGTACGTGTGCCATTCGCTCATAGTTTCCAATAGTCTGATTCAACATTGAGGAGGAATTTCTAAGAGACCAAACTTACCAGTTCTGATATCTGCATCACTCGAGTATTCTGGGATTACTCGGTCAGGAGTTGCATCTACAGGAGCTCCGGTTTGTATAGTGTTAAGATAGGAAGCAAGCATTGAGGGCTGGTTGTAGGGCCCTGTTGGGAGCAGAATGTATATTCATGTAGTATTCAGATGAATGGGGAGATCGTCAAATAGATACAGAGAGATTTATCGAAAGTGTAGAGTTAAATTGTAGCTAATCAAAATACTTGTCGTATGACAAGTGGTTTCACTTTTCGAATGAAATTTGTCGATTCCCATTGAAATCAGGCCGTTGAGGTA

CDS

>Mapoly0013s0062.2
ATGAAAATAGACGAGAAGGATGTGGAGGAGAAGGAGGTCCAAGCGAAGGTGGGAGAAAGAAAAGACGGAGCCAAGAAAGAAAGAGTCTTGAAAGAAGAAGACAAACACGAGGAAGAATTAGAGGAAGAAGAAGAGGAGGAGGAAGAAGAAGAAGAGGAAGAAGAGGAGGAGGAAGAAGAACCATTACAAGCGAGAATGGTTTCATCAAAGGATGAAAAGATGGAGGAAGAAGAGGAAGAGGAAGAAGAAGAAGAGGAGGAAGAGGAGGAGGAGGAGGAGGTAGAAGAGGAAGAGGTGGAGGAGGAAGAGGTGGAAGAGGATGAGGTTGATGACAAGGACGGCAGCATTGAGGAGCAGATCGCTTTCACGAGGGTCCTCGAAAACTTCTTTAGGGATAGGAACTTGGAGTATAAAGCTCCGAAGTTTTACGGAGAAGAACTGAATGTTCTGAAGTTATGGAAGGCAGTGACTTCTCTCGGGGGTTACGAACAGGTTACTTCTGGCAAGTTATGGCGACAAGTTGGCGAACAGTTCAAACCTCCCAAGACTTGTACTACGATTTCATGGTCTTTCCGCGGCTTCTATGAGAAGGCACTGTTGGATTATGAGAGATTTCAAACGGGTGGTTGTCTACCTTCAAGTTTTGGAGGAAAAGACCTAAACCAAGGAGATGCATTGCTTTCTGGATTTGAAAACCAAGCTGCAATGTCTCCGACGACTCCTTCTTCGCAGCCGAATGCAGCAGCAGCCTCTGGATCTGGGAGAGCGAGGAGAGACGCTGCTGCCCGTGCCATGCAAGGTTGGCACTCTCAAAGAGCTGGTAATGGAGAGGTTGGAGATCCCATAATCAAGGAAAAGAGCGGCGTGTTGAAGAAGGAGAAGCAGTTGAAGAGTTTGGGTGGAACGAAACGTAAGGAAACTGCTTCGTTGGTGGAGCGAGCTGTAAAGGTTGCTCGAGCAAAAGGAGTTAGGTCTCGGTCCTTGGATGACGTCCCTTCTGAGAACGCTCTTAGTGCCGGTGCAAATATCTCAAAGGCTGGGCCTTTGTTGAAGAAGTCAGCAAAGCAGGACCGGTCAAAGCACGGTACTAAAAGCACCAGCATGGAGCCAATGAAAGGTCTCAAATTAGTAATAACAGATGACGGCCCTCCTGCAGACTGGGTCAAAATTAATGCATACAGAAATACGGACGGCTACGAGATCTACGCCCTTGTTCCAGGCCTTGCTCGCGAAGAGGTAAGAATCCAGTGTGAAGAAGGTGGACGAGTGGTTATATGTGGATCCCCCGAACAGCCCAGCAATCCTTGGGGCGTTACAGCGTTTAGGAAGGTTATCAACTTGCCTTCTAAAATAGATGCTCATCACACGTCAGCTGTTGTAACTCTCTACGGACAGCTGTTCGTACGTGTGCCATTCGCTCATAGTTTCCAATAG

Protein

>Mapoly0013s0062.2
MKIDEKDVEEKEVQAKVGERKDGAKKERVLKEEDKHEEELEEEEEEEEEEEEEEEEEEEEPLQARMVSSKDEKMEEEEEEEEEEEEEEEEEEEVEEEEVEEEEVEEDEVDDKDGSIEEQIAFTRVLENFFRDRNLEYKAPKFYGEELNVLKLWKAVTSLGGYEQVTSGKLWRQVGEQFKPPKTCTTISWSFRGFYEKALLDYERFQTGGCLPSSFGGKDLNQGDALLSGFENQAAMSPTTPSSQPNAAAASGSGRARRDAAARAMQGWHSQRAGNGEVGDPIIKEKSGVLKKEKQLKSLGGTKRKETASLVERAVKVARAKGVRSRSLDDVPSENALSAGANISKAGPLLKKSAKQDRSKHGTKSTSMEPMKGLKLVITDDGPPADWVKINAYRNTDGYEIYALVPGLAREEVRIQCEEGGRVVICGSPEQPSNPWGVTAFRKVINLPSKIDAHHTSAVVTLYGQLFVRVPFAHSFQ

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>