Mapoly0013s0153



Description

Abscisic-aldehyde oxidase.

Reference DB

Database ID Description
EC 1.2.3.14 Abscisic-aldehyde oxidase.
GO GO:0009055 Electron carrier activity
GO GO:0016491 Oxidoreductase activity
GO GO:0046872 Metal ion binding
GO GO:0051536 Iron-sulfur cluster binding
GO GO:0055114 Oxidation-reduction process
KEGGORTH K09842
OrthoMCL OG5_127252
PFAM PF00111 2Fe-2S iron-sulfur cluster binding domain
PFAM PF00941 FAD binding domain in molybdopterin dehydrogenase
PFAM PF01315 Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain
PFAM PF01799
PFAM PF02738 Molybdopterin-binding domain of aldehyde dehydrogenase
PFAM PF03450 CO dehydrogenase flavoprotein C-terminal domain
PANTHER PTHR11908 XANTHINE DEHYDROGENASE
PANTHER PTHR11908:SF63

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpAO abscisic aldehyde oxidase Mapoly0013s0153.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0013s0153.1 scaffold_13:1687878..1698896  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0013s0153.2 scaffold_13:1687878..1698896  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0013s0153.3 scaffold_13:1687888..1698896  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0013s0153.4 scaffold_13:1687888..1698896  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0013s0153.1  

Gene structure:

mRNA scaffold_13:1687878..1698896  ( - strand )
three_prime_UTR scaffold_13:1687878..1688492  ( - strand )
CDS scaffold_13:1688493..1688743  ( - strand )
CDS scaffold_13:1689369..1689558  ( - strand )
CDS scaffold_13:1689702..1689800  ( - strand )
CDS scaffold_13:1690964..1691059  ( - strand )
CDS scaffold_13:1691284..1692261  ( - strand )
CDS scaffold_13:1692437..1692655  ( - strand )
CDS scaffold_13:1692887..1693090  ( - strand )
CDS scaffold_13:1693345..1693610  ( - strand )
CDS scaffold_13:1694169..1696043  ( - strand )
CDS scaffold_13:1698192..1698363  ( - strand )
five_prime_UTR scaffold_13:1698364..1698896  ( - strand )

Sequences:

Gene

>Mapoly0013s0153.1
CGCTTTACACCCTGGCCCAGGATGTAGTCGACAATCATTCAGAGCAGGATAGTTTCTCGGAAAAGTGGCTGGAGTAGTACTACATATGAAGCGCTCCTGCCACGCTGGCAGAATCTGGCAGAATCTGGTGCACCGACCTTCAGACATTCCAGTATCTGTGTGTTGACGACAGCGGGTGATGACAACAAGACTGCCCTGTTACCATGTTCGAAACTGATTCGAATCGTGGGAATTCATATTTAACTAGGTCCTCTCTTTTTTACTGGAAAAGAGCTTACGACCAATCGACAGCAGAGTGGGAGCGTGGCAGTGGGAGTGGTGGTGGTGGTCGACCGATTCCTGGAACATCGACGCTGGACCGATGCCTGGAACATCGACGCTGGACGAGACCAATTGAACCGGCCTTGGTGGCGGAATGATCGAGAGGTGTTCCAAACTACAGTGAATTACGAAGCTGAGAATGCTCTCTGATGATTGACATTGGGCATCAAGTACGAAGAGGATAATACATTGACCGTGCATATTCCTGTTGGATGCAGATAGGAGTTGACATCTGTGCAATGGGAAAAGCGGTGAGATCAAGTGTGGTGTTCGCTATCAACGGACGACGAGTTGAGCTCACTGACGTCGATCCACGGACGAGTGTACTGAATTACATTCGCGAGGAGACGGAATTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTACTGTCATGTTCTCAACGAAGACTCTGTAACTAATTTCTCCGTTGCTTCTTCTAAGCAGCGGGCCTTTAGCGTGCGCATCATATTTTGGCTAAAAGGCCTTTACATTCTACAGCTTGAAAACAACTTTCAGGTTCTCTTGTGCTGCTTGAAATTTCTACCGCTCTTACCAGGTTTGGAGCTAAGTCCTGTCTTCTGATCGCGCAACTTGTTGTTTACATCTCTTGCTTCCTGTTTGTAGGCAGTAATTGGTTCTGTAATGGTTTGCTTTAATTCACTTTGGGTCTTCTATGGCTCTGAGCAGACGTCTGAGACGTCTTGTCGCATCTCTGGACTTTTCATGGTTATGTAGCTGCTTGCTTGATTGATGGGGAAGTCAACGTAAAAATGGATTGTGCATTCGCCCCCTTGGATGTAGAGAGGAGTTAAGCTCTCTGCAATGGGGAAAGCGGTGAGATCCAGTGTGGTGTTCGCTCTCAATGGACAAAGAGTTGAGCTCAGCGACGTCGATCCGCGAACGAGTGTGTTGAGCTACATTCGCGAAGAGACAGACTTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTACTGTCTTCTTCTCTTGGAAGACTTTGGGATTAGTGTCCTCTTTCTGAGCTTCTTTTGAGCTGTGGCAGTTCAGCGTGCATCATATGTTGCTTGACTGGCCTGTAGATTCTATAAGTTGGAACTCACTGTCACTTATTATTGTTCTATTGTTCTTACCAGGATCGAGCTGTCATCCCATCTTAGCGTGCAGTCTATTGTCTACATACCTTGCTTCCTGTATGCAGTAATTGCTTGTATATTGGCTTTAAGTTTACTCCGGGCATATAAGCACGAAGGCGTCGCAGAGCTTGTTTGTGAAAACTTCTTGTTGCATCTCTCGACTTTCCATGTTTCGGTAGCTGCTTGATTGATTGATGGGAAGCCAACGTAGAAAATGGAAAACATGTGTTTGAAGAAGACTGACATTTGTTAATTCCAGTAATTGCTTGCATGTTCAGATGGTTTTGTAATAATTTGCCGACATCCAAACTAACACAGCCTCTTTGGCGATGCTGTCCAGTAGTTTGAAGAAGTTTTCTCCTTTGTTCTAGGTGTCTTCTCTGGCTGCTCCTAAATCCTTTGTTTCTGAGCTAGAACTTCCTGACTCTGGTCTCGCAGCACCGCGATTCCTATCTGCATGCAATTTAGTGCTTAACTGTGTGAAGCGAAACTGGTCATGAGTTAGAAGAGACGATTGCTCGCTCTGTATGTTTTCAGGCATATTGACAAGTCACAATCACCTGATTCTTATCCCTTCAACAACGTATGCAACCCGTCACTTTCTGAATCCAAGCTTTCTGTGCGAAATGTTCAAATGCTTGTATCAATTTCTGGGAATCTCGTGCTCTGAAGAAGTCACAAACGTTTGAACCCAGAATCGAGTGCCCGGAGGGTTGTAGAATTAACGGAGGGTAGTATTACGTCATCAATACGTTGCCAATTGTTTGTAGATTTACTCGCCATAAATCTGAATTCGAATGAACGGTCTAATTTACTAAGTTGAGGCTAAGACATGAGCGTGCACTTTCATGTATGTGTAACGGCGAGCTTGCCACTACTGGTTAGCAAGCTCTCTGCTGGCTCATTCGAACGAAGCGTGTGTTCAAACTTTAACGAAGCGTGTGTTCAAATTTTAACGAGGCTTCGTCACGTCCCGCTTTCTTTCTCTTCCCCACGTCAATAATTTCAAATTCACGAGCTGCATGTGTTACACAATTTGGTTGGCTGGATCGGAGGTGTCTGTTTAAATATACGCGTTTGTGGTGCTTGCGTTAGGATTTAACCAAGTGATTACATCTGAACTCTAACGAGTATGATAATTTGCCACGGTGGAGAGCTCCTACACAAGTGGAGGAGGCATTTCGAACTTTTGCAATATCTAATCCATGTTACAGAATTTTAGTCTAGCAAATGGCTTTTACGCTATTAATTTTGAGTTCGAGTTAACGTGGATCTTTGAGGATTAGGATGACCACCGGAAGTAATCAAATCAGTTCAACTCCTTTTGCCCAAAGAAGTGCAAACTGGATATTTCCGTTGCCATTGGTTACTATTTTTTCAAATTAATTTTGTGGATGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGCAAGTTTCTCATGGGAATACTCTTATTTTTCTTAACGCTGGAAGCTGTAAGATCATTTTGTGAGCTTGCAAGAACGTGAACTATCACACCAATAGGACATAGGCCGTCCCATCTGTGGGTCTAATCGTCTCTTGTGTGAATGTTGAGTCACATTGCTTGAGCATATACTTGTCATACATTGCTATGAAGTACGTGGGGAGCTACCTAAACAATGCTTTTTGATTATAGGCTCGACAACCATTGCGCATTTGAAACTTTCGCTCACATGTTGGTAGTATAATCTCTTCTAGTTTCTTCATCATCCTAGACTATTAATTTATGCGCAGAAACAGGTCGATAAGAGGAGAACGCATCATTGCAAACATAGAAGTCTTGTTCCACCATTTAGTTTGCATGATCAGTAGACTATTTAAACAAATGTCCTTTGGAACCCACTATAGTAGGAGTGAAAATTCCCGATTAGCATCTATCGAAGCGGGGAGTAAGGGAGGGTTTAGGGTTTAGTTCGTGTGAAGAGAGGTTTGATTGTAACCCAACTCTCGGATCTTTTACCTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTTTGCCTCCTTAACTTCCAAAACCTCCACTGCTGTTTTTGGCTCTTAAGTCAAAGTTATTTGGATGTAGCACTTTGAGTGATAGGGGCGAATTTTAGTGTTGAAGTTTCACTCATTATTTTCGGGCATTTATACCTTGTTTTTTCTCTTTACTGAACTGCATTTCGATTTATTTTAGTTCCTTCCGTCATAGAAACTTCCCTCGTTTTGCCGAAAGAACTAATGTCTCCCTTTTTGTATAACTTATGTGACAGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGGTGTGAATGTGATCCTATACTTGTGAATTATACTTTTTGATCTTATGCATCTTGCCCTCGAGTTTTGCTTTTAACCCCGAAGTGGTGACTCTTCAATGTCTAAACTAGATGTATTGCAGTCCAATGATGATTTCTCAGCTTCCATAGCTTTCGAAGTGTTGATTGTCATAAACTACCGTCTGACACCTCATTTATTGTACATTCCACCTCACGAAGTCCTTTCGTCTGTAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTGAGTGTTCTCTTAAGTGATACTTTGATTTCTGGTGATTGTTTTTTGGTATGGCCCTTTTAAATAATCTTGTGTGTCAAGTCTGAGTTGATTTTTTTCACTTGAACATACCTATTAGAAGGAACCCACTTCTCAGTAGTTTGCCGTTATCTGAATATCGGAATTTTTTCTTCAGGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGTACAATCTCGTTCTTTGTTCCTGTATTGACGGACTTTGTACTAACATCTACTAAGAAGTTAACAGACCATGTTCAGATCCTGCTCATCACGAGCAGTTCTCAGGTCCATATCAATAGGGATGTACCATCAAAGATAGATCATGTAAATAATAAGTAGAGAAGAGAAATGTTAGGGTTGGAATTTGAAGTTTTTAACTCTTTCCTCTCATGTCAAATTCTCCAGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTAACTACTATACATATAAACTCTTCCTGTAGCTTCATATTTTCCCACCCAAAACATGCGAATTGTCTCTTCAACTTTCTCGTCGAAGGTCTTATGTTTGCATCCTTAAATGAAACGTAGATGCTCAACTTGTTTGCTTTATACCCAACAGACTCTTCACATAGATGCCTGTCTCAAAGTAGATTCTAGGATGGTGGCGTAAAACAATAAACCTTGCAAGCTTAGTCATCCAGAAGAAGTTGCGTTGTTTTTACGGATGGAGATACATGCATGCATAGGTTATTAGTATTCCAGTACGCAATAAGATTATGTCATCCATTGATATTCTTCTCATTCACATGTTACCATCGAGGGGTTTCGCACTTATATTTGCATGTTTAGATTAACATGTAGCCAAATAAGGTCTTGTTTTGACCTTAACATATATATTATAGACGTTTAAGTTGTTTTACATTACCTGCAAAATACTTATCTTTTCTTCCATCTGGGAAATTTTTTCCATTAAAAGAAATCAAGATATGTCGATATTTACAAGCCCTACTTCTTCCTCATGGTTATATTTGACATCGTCTTTGACTTGCTTTACATCCAACATACTCAATGAGATTTTAGAGTAGTGGAGGATACCTCTTGCACACGATATGGTATCAGTACATAACTTTTACACAGTACATTCCTCATGCTGCTTCTTACGATTAGTATTACATTTTTAAATTCGGAAAGAAACCTATCCTGAGAACATTACATCACAGTATAGATGGTAATATCAGAAGACTGAGTCTTTTCTTACATTTGTCAAAACAGAACGTTTTCAGTATCCGGCACCGAGGTGATAGCCAGTGGTGTTAATTTAATGAGAATAGGAACAGTACAAATTCGTGCTCACAATTTGCAGAGTAGTTTCAACAATCGCTAATTTCACGGTTATTGGTTAGGCATGTGACTGCAGCCACCGTGCAAAGAACAATTCTGAAGAAATTTTCCTTACATCTGAACTCTATATCTTTGTTCTTGTCTCATCTGTCCCTGAAGTAGAGTACTGCAACCGGACTCGGGTTTACCAAGCATATTGAAGGTGGATTGTGTCGGCCTGTGTTTCTTTTGGTTTACAAAGTGTATATATATTTCAGTATTTTGGAGATTGTTAACATGAATGTCATCAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGGTATGACTGATGCCAGGATATCTAGGCCTCTTGCTCTGCCCAAGTTGTTCCTAAGGTGATTCATGACATGAACGCGTGTAAACGGTACATTTCTGTCAGGTGGATGATTATTTTAACATGATCTTCAAATGTTGTGTACACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAAGTGAGTATGGATTTCTCAGATTTCCTTCTTTCTCAGAATTGGAGTGAGGTGAATATATTTTGCAACACCATGCAGTTAGTTTCCCATGATTGCGTCTTTTATTTTAATTTTCTCGTTCATCCTGGCAAGAATTTTAATGCCAGGATCTGAATAGAACGTATTTGGGTTCATCAACTTGAGTATGTGTCATACTTATCAAATTTTATGTACATACCGATGCATTGTCTCTGAGGCCATGGCTAGTATACCAATTAGCAGAAATGTTCATCAGGTACAATGTGGAGTGCCTGGTTCATGATTGCATGTTAAATTGTTGTTCTCTCATTCATATTGGTCAGGTTCGTAAGTGCCAATAATTGATTACATTATAATTCGACTTAGCAACCTGAATATGTCCAACATCTTAACTTTTGGATGTTTATACTGAGGCGTTGTGTGGTTGTCATGGCTAGTATGCCCATTATCAGAGGGATTCGAGAGGTACAGTGTAGAGTACCGAGTTCTTGGATGTATGATGAGCTTGTACGTGTTGAGGATTATCTTCGAGCTTCATTGACATTAGAAAGATTTTTGTTATGTGTAAAGGTCTCATGTGTTCTAACTTGCGTGTGGTTGTATTGAGCAGCTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAGACTCATCATAGAACTATAACTTTGAGGGCATCGGTATCGGTATCTCGGGTCAGGGTCGTTCTGCATTACAGTTGAAGAGTAACCTGTATATACTGGACCCAGAGCATGCCAGTTTGTGAGTCATTTCTTGTGTGATTGTTTACAGTAGGAATGTTCTCTGTATAGCTAGATTTGAGCCTTCACTTCGTTGGCCCGAGAAGGCTATATTCATACGAGGTCCATATGCTTACCCACCAACGTACATTACAGTCAATATCAAGGACTTCGAGTCTCACTCTGTTGCGGTACTGTACATAGGCTTGTGAATGGAAGGTTGGATCTTGTTTTTACGATGTCTTCATTGAAGCCACGCCGATTGGACCTTCGTAGCCAACGTAGTCTCGTAGTTGTGAAACATGAACTCTTTGCTGCATCTGTCTTGTTGTTGTAAAGACTCAACAATGCTTCGGATGCTTGTTTGCCTGTTGAGTCACGGAAACTACAAGATGGATCTAGAGATACTTAAGCCACCTCCAACTATCACGCCGTACTCTCTCCCTCGTAACCCGTTAAAAGTTGTACTTATTTTTGCGATATTTCAGGCGAGTTTGCACCCTTGAGTAGAACATACCATGC

mRNA

>Mapoly0013s0153.1
CGCTTTACACCCTGGCCCAGGATGTAGTCGACAATCATTCAGAGCAGGATAGTTTCTCGGAAAAGTGGCTGGAGTAGTACTACATATGAAGCGCTCCTGCCACGCTGGCAGAATCTGGCAGAATCTGGTGCACCGACCTTCAGACATTCCAGTATCTGTGTGTTGACGACAGCGGGTGATGACAACAAGACTGCCCTGTTACCATGTTCGAAACTGATTCGAATCGTGGGAATTCATATTTAACTAGGTCCTCTCTTTTTTACTGGAAAAGAGCTTACGACCAATCGACAGCAGAGTGGGAGCGTGGCAGTGGGAGTGGTGGTGGTGGTCGACCGATTCCTGGAACATCGACGCTGGACCGATGCCTGGAACATCGACGCTGGACGAGACCAATTGAACCGGCCTTGGTGGCGGAATGATCGAGAGGTGTTCCAAACTACAGTGAATTACGAAGCTGAGAATGCTCTCTGATGATTGACATTGGGCATCAAGTACGAAGAGGATAATACATTGACCGTGCATATTCCTGTTGGATGCAGATAGGAGTTGACATCTGTGCAATGGGAAAAGCGGTGAGATCAAGTGTGGTGTTCGCTATCAACGGACGACGAGTTGAGCTCACTGACGTCGATCCACGGACGAGTGTACTGAATTACATTCGCGAGGAGACGGAATTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAACTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAGACTCATCATAGAACTATAACTTTGAGGGCATCGGTATCGGTATCTCGGGTCAGGGTCGTTCTGCATTACAGTTGAAGAGTAACCTGTATATACTGGACCCAGAGCATGCCAGTTTGTGAGTCATTTCTTGTGTGATTGTTTACAGTAGGAATGTTCTCTGTATAGCTAGATTTGAGCCTTCACTTCGTTGGCCCGAGAAGGCTATATTCATACGAGGTCCATATGCTTACCCACCAACGTACATTACAGTCAATATCAAGGACTTCGAGTCTCACTCTGTTGCGGTACTGTACATAGGCTTGTGAATGGAAGGTTGGATCTTGTTTTTACGATGTCTTCATTGAAGCCACGCCGATTGGACCTTCGTAGCCAACGTAGTCTCGTAGTTGTGAAACATGAACTCTTTGCTGCATCTGTCTTGTTGTTGTAAAGACTCAACAATGCTTCGGATGCTTGTTTGCCTGTTGAGTCACGGAAACTACAAGATGGATCTAGAGATACTTAAGCCACCTCCAACTATCACGCCGTACTCTCTCCCTCGTAACCCGTTAAAAGTTGTACTTATTTTTGCGATATTTCAGGCGAGTTTGCACCCTTGAGTAGAACATACCATGC

CDS

>Mapoly0013s0153.1
ATGCAGATAGGAGTTGACATCTGTGCAATGGGAAAAGCGGTGAGATCAAGTGTGGTGTTCGCTATCAACGGACGACGAGTTGAGCTCACTGACGTCGATCCACGGACGAGTGTACTGAATTACATTCGCGAGGAGACGGAATTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAACTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAG

Protein

>Mapoly0013s0153.1
MQIGVDICAMGKAVRSSVVFAINGRRVELTDVDPRTSVLNYIREETEFKGTKRGCGEGGCGSCVVLLSKYDSKSNKIEEYTINSCLAPICSVDGCAITTTEGLKNGKEPHAVHTRLAEFHASQCGFCTPGMAVSIYSCLKNSSKKSSMGAESTKPTVAEAQKAIAGNLCRCTGYRPILDVCKSFAADVDIEDLGVNTFWESSELAKESSLNLYQSEKDPEFPTFLKIQAGDYLEVKSVRAEEVTAWRSASTLSELFTMYEEETKGKNRDVNFVAGNTSSGVYKDFKPSVYIDINKIPELHSVVETDCTLEVGSAVSLSKLITIMDARGGPVYSELAKHLRKVANEHVRNRASVGGNLILAQKRGFASDVATILLGAGSQVTIATSRDSCIKDMEEFLAGVSPDTTILQCIRIPSWAQYSKDGKEKLFFKTYRSSPRKNGNAVSSVNAAFLGIFQTPEVDNGYTVGKVQQLRLAFGHLGAPHAMRAKRTEKYLLQKTVNPDVLKNAVKILREDILSSAKDDDLYTATYKASVAVSYLFQFFEPLLPSSNLTSSQVGTPCMNGGDTLSNGSKVHSRDVTGTKSKSEVHNKGDTCTNGNSEVHNKGDTDSNGNSEVHDKGDTGTNGAAMNGTNSDESAVRSFGRTSGNGIGIGEGFWGAQSFPHYDEFSPLSKPAAKDAAVLQASGEAVYTGDIPSPPGTLHAALVYSKKALAKVKALEASDALTSPGATSFFCAKDCIAENVSVVNNIAGLEFREPLFAEETVHFVGECLGVLVADTHEHAVLAAEKVKVDYDNSTLGPPILSVEDAAGMNSFKISPLAVMGTASVGDELIKGEYRMENIELFAGSQYYFYMETHTALAVPDEDDCITVYSSNHSPEVLHDTLSAALGIPMHNIRVITRRLGGSFGGKNTRSLIVATACALAAFKLKKPVRMTLDRNTDMVLSGGRHESKATYSVEFNKDGKITSLETNVLMNGGYPDDYRDLLGLLLTKAMKCYNWTSWRHVSKVCRTNLPARSMMRAPGEIQGNFFAESIVEHVATYLGLDRDKVREINMHTHESAKLFYGPSTTGKAELFTLPKIVQRTKDLSNFESRKLNVHSFNKRSMWVKRGISLTHVIYPNMQSAKVARVSLFKDGSVAVASGGTEMGQGLFTKVKQATAYGLSLLWGENATGKVDLSKIRIVENDSISLANAGTTNAGTTSEGTCEAVVNACKMLVKNLTPIYLKLKANGGESPRWEDVVKLAKGSRVVLTAEARNGEIGPATEYMACGACASEVEVDLLTGSVKVLQADLVYDCGKSLNPAVDIGQIEGSFVQGIGYYLTEQIKWDENGVLLTNGTWTYKPPTIDNIPQKFNVELLNSAVDSSRILSSKTAGEAPLVLSTSVHLAVREAIKSARADLQHLPPVPGHCGPENMKGSTDPLLIRNSVTSMENVKRLCGLYNVEQYLEKLSIESS

Mapoly0013s0153.2  

Gene structure:

mRNA scaffold_13:1687878..1698896  ( - strand )
three_prime_UTR scaffold_13:1687878..1688492  ( - strand )
CDS scaffold_13:1688493..1688743  ( - strand )
CDS scaffold_13:1689369..1689558  ( - strand )
CDS scaffold_13:1689702..1689800  ( - strand )
CDS scaffold_13:1690964..1691059  ( - strand )
CDS scaffold_13:1691284..1692261  ( - strand )
CDS scaffold_13:1692437..1692655  ( - strand )
CDS scaffold_13:1692887..1693090  ( - strand )
CDS scaffold_13:1693345..1693610  ( - strand )
CDS scaffold_13:1694169..1696043  ( - strand )
CDS scaffold_13:1697608..1697752  ( - strand )
five_prime_UTR scaffold_13:1697753..1697773  ( - strand )
five_prime_UTR scaffold_13:1698192..1698896  ( - strand )

Sequences:

Gene

>Mapoly0013s0153.2
CGCTTTACACCCTGGCCCAGGATGTAGTCGACAATCATTCAGAGCAGGATAGTTTCTCGGAAAAGTGGCTGGAGTAGTACTACATATGAAGCGCTCCTGCCACGCTGGCAGAATCTGGCAGAATCTGGTGCACCGACCTTCAGACATTCCAGTATCTGTGTGTTGACGACAGCGGGTGATGACAACAAGACTGCCCTGTTACCATGTTCGAAACTGATTCGAATCGTGGGAATTCATATTTAACTAGGTCCTCTCTTTTTTACTGGAAAAGAGCTTACGACCAATCGACAGCAGAGTGGGAGCGTGGCAGTGGGAGTGGTGGTGGTGGTCGACCGATTCCTGGAACATCGACGCTGGACCGATGCCTGGAACATCGACGCTGGACGAGACCAATTGAACCGGCCTTGGTGGCGGAATGATCGAGAGGTGTTCCAAACTACAGTGAATTACGAAGCTGAGAATGCTCTCTGATGATTGACATTGGGCATCAAGTACGAAGAGGATAATACATTGACCGTGCATATTCCTGTTGGATGCAGATAGGAGTTGACATCTGTGCAATGGGAAAAGCGGTGAGATCAAGTGTGGTGTTCGCTATCAACGGACGACGAGTTGAGCTCACTGACGTCGATCCACGGACGAGTGTACTGAATTACATTCGCGAGGAGACGGAATTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTACTGTCATGTTCTCAACGAAGACTCTGTAACTAATTTCTCCGTTGCTTCTTCTAAGCAGCGGGCCTTTAGCGTGCGCATCATATTTTGGCTAAAAGGCCTTTACATTCTACAGCTTGAAAACAACTTTCAGGTTCTCTTGTGCTGCTTGAAATTTCTACCGCTCTTACCAGGTTTGGAGCTAAGTCCTGTCTTCTGATCGCGCAACTTGTTGTTTACATCTCTTGCTTCCTGTTTGTAGGCAGTAATTGGTTCTGTAATGGTTTGCTTTAATTCACTTTGGGTCTTCTATGGCTCTGAGCAGACGTCTGAGACGTCTTGTCGCATCTCTGGACTTTTCATGGTTATGTAGCTGCTTGCTTGATTGATGGGGAAGTCAACGTAAAAATGGATTGTGCATTCGCCCCCTTGGATGTAGAGAGGAGTTAAGCTCTCTGCAATGGGGAAAGCGGTGAGATCCAGTGTGGTGTTCGCTCTCAATGGACAAAGAGTTGAGCTCAGCGACGTCGATCCGCGAACGAGTGTGTTGAGCTACATTCGCGAAGAGACAGACTTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTACTGTCTTCTTCTCTTGGAAGACTTTGGGATTAGTGTCCTCTTTCTGAGCTTCTTTTGAGCTGTGGCAGTTCAGCGTGCATCATATGTTGCTTGACTGGCCTGTAGATTCTATAAGTTGGAACTCACTGTCACTTATTATTGTTCTATTGTTCTTACCAGGATCGAGCTGTCATCCCATCTTAGCGTGCAGTCTATTGTCTACATACCTTGCTTCCTGTATGCAGTAATTGCTTGTATATTGGCTTTAAGTTTACTCCGGGCATATAAGCACGAAGGCGTCGCAGAGCTTGTTTGTGAAAACTTCTTGTTGCATCTCTCGACTTTCCATGTTTCGGTAGCTGCTTGATTGATTGATGGGAAGCCAACGTAGAAAATGGAAAACATGTGTTTGAAGAAGACTGACATTTGTTAATTCCAGTAATTGCTTGCATGTTCAGATGGTTTTGTAATAATTTGCCGACATCCAAACTAACACAGCCTCTTTGGCGATGCTGTCCAGTAGTTTGAAGAAGTTTTCTCCTTTGTTCTAGGTGTCTTCTCTGGCTGCTCCTAAATCCTTTGTTTCTGAGCTAGAACTTCCTGACTCTGGTCTCGCAGCACCGCGATTCCTATCTGCATGCAATTTAGTGCTTAACTGTGTGAAGCGAAACTGGTCATGAGTTAGAAGAGACGATTGCTCGCTCTGTATGTTTTCAGGCATATTGACAAGTCACAATCACCTGATTCTTATCCCTTCAACAACGTATGCAACCCGTCACTTTCTGAATCCAAGCTTTCTGTGCGAAATGTTCAAATGCTTGTATCAATTTCTGGGAATCTCGTGCTCTGAAGAAGTCACAAACGTTTGAACCCAGAATCGAGTGCCCGGAGGGTTGTAGAATTAACGGAGGGTAGTATTACGTCATCAATACGTTGCCAATTGTTTGTAGATTTACTCGCCATAAATCTGAATTCGAATGAACGGTCTAATTTACTAAGTTGAGGCTAAGACATGAGCGTGCACTTTCATGTATGTGTAACGGCGAGCTTGCCACTACTGGTTAGCAAGCTCTCTGCTGGCTCATTCGAACGAAGCGTGTGTTCAAACTTTAACGAAGCGTGTGTTCAAATTTTAACGAGGCTTCGTCACGTCCCGCTTTCTTTCTCTTCCCCACGTCAATAATTTCAAATTCACGAGCTGCATGTGTTACACAATTTGGTTGGCTGGATCGGAGGTGTCTGTTTAAATATACGCGTTTGTGGTGCTTGCGTTAGGATTTAACCAAGTGATTACATCTGAACTCTAACGAGTATGATAATTTGCCACGGTGGAGAGCTCCTACACAAGTGGAGGAGGCATTTCGAACTTTTGCAATATCTAATCCATGTTACAGAATTTTAGTCTAGCAAATGGCTTTTACGCTATTAATTTTGAGTTCGAGTTAACGTGGATCTTTGAGGATTAGGATGACCACCGGAAGTAATCAAATCAGTTCAACTCCTTTTGCCCAAAGAAGTGCAAACTGGATATTTCCGTTGCCATTGGTTACTATTTTTTCAAATTAATTTTGTGGATGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGCAAGTTTCTCATGGGAATACTCTTATTTTTCTTAACGCTGGAAGCTGTAAGATCATTTTGTGAGCTTGCAAGAACGTGAACTATCACACCAATAGGACATAGGCCGTCCCATCTGTGGGTCTAATCGTCTCTTGTGTGAATGTTGAGTCACATTGCTTGAGCATATACTTGTCATACATTGCTATGAAGTACGTGGGGAGCTACCTAAACAATGCTTTTTGATTATAGGCTCGACAACCATTGCGCATTTGAAACTTTCGCTCACATGTTGGTAGTATAATCTCTTCTAGTTTCTTCATCATCCTAGACTATTAATTTATGCGCAGAAACAGGTCGATAAGAGGAGAACGCATCATTGCAAACATAGAAGTCTTGTTCCACCATTTAGTTTGCATGATCAGTAGACTATTTAAACAAATGTCCTTTGGAACCCACTATAGTAGGAGTGAAAATTCCCGATTAGCATCTATCGAAGCGGGGAGTAAGGGAGGGTTTAGGGTTTAGTTCGTGTGAAGAGAGGTTTGATTGTAACCCAACTCTCGGATCTTTTACCTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTTTGCCTCCTTAACTTCCAAAACCTCCACTGCTGTTTTTGGCTCTTAAGTCAAAGTTATTTGGATGTAGCACTTTGAGTGATAGGGGCGAATTTTAGTGTTGAAGTTTCACTCATTATTTTCGGGCATTTATACCTTGTTTTTTCTCTTTACTGAACTGCATTTCGATTTATTTTAGTTCCTTCCGTCATAGAAACTTCCCTCGTTTTGCCGAAAGAACTAATGTCTCCCTTTTTGTATAACTTATGTGACAGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGGTGTGAATGTGATCCTATACTTGTGAATTATACTTTTTGATCTTATGCATCTTGCCCTCGAGTTTTGCTTTTAACCCCGAAGTGGTGACTCTTCAATGTCTAAACTAGATGTATTGCAGTCCAATGATGATTTCTCAGCTTCCATAGCTTTCGAAGTGTTGATTGTCATAAACTACCGTCTGACACCTCATTTATTGTACATTCCACCTCACGAAGTCCTTTCGTCTGTAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTGAGTGTTCTCTTAAGTGATACTTTGATTTCTGGTGATTGTTTTTTGGTATGGCCCTTTTAAATAATCTTGTGTGTCAAGTCTGAGTTGATTTTTTTCACTTGAACATACCTATTAGAAGGAACCCACTTCTCAGTAGTTTGCCGTTATCTGAATATCGGAATTTTTTCTTCAGGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGTACAATCTCGTTCTTTGTTCCTGTATTGACGGACTTTGTACTAACATCTACTAAGAAGTTAACAGACCATGTTCAGATCCTGCTCATCACGAGCAGTTCTCAGGTCCATATCAATAGGGATGTACCATCAAAGATAGATCATGTAAATAATAAGTAGAGAAGAGAAATGTTAGGGTTGGAATTTGAAGTTTTTAACTCTTTCCTCTCATGTCAAATTCTCCAGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTAACTACTATACATATAAACTCTTCCTGTAGCTTCATATTTTCCCACCCAAAACATGCGAATTGTCTCTTCAACTTTCTCGTCGAAGGTCTTATGTTTGCATCCTTAAATGAAACGTAGATGCTCAACTTGTTTGCTTTATACCCAACAGACTCTTCACATAGATGCCTGTCTCAAAGTAGATTCTAGGATGGTGGCGTAAAACAATAAACCTTGCAAGCTTAGTCATCCAGAAGAAGTTGCGTTGTTTTTACGGATGGAGATACATGCATGCATAGGTTATTAGTATTCCAGTACGCAATAAGATTATGTCATCCATTGATATTCTTCTCATTCACATGTTACCATCGAGGGGTTTCGCACTTATATTTGCATGTTTAGATTAACATGTAGCCAAATAAGGTCTTGTTTTGACCTTAACATATATATTATAGACGTTTAAGTTGTTTTACATTACCTGCAAAATACTTATCTTTTCTTCCATCTGGGAAATTTTTTCCATTAAAAGAAATCAAGATATGTCGATATTTACAAGCCCTACTTCTTCCTCATGGTTATATTTGACATCGTCTTTGACTTGCTTTACATCCAACATACTCAATGAGATTTTAGAGTAGTGGAGGATACCTCTTGCACACGATATGGTATCAGTACATAACTTTTACACAGTACATTCCTCATGCTGCTTCTTACGATTAGTATTACATTTTTAAATTCGGAAAGAAACCTATCCTGAGAACATTACATCACAGTATAGATGGTAATATCAGAAGACTGAGTCTTTTCTTACATTTGTCAAAACAGAACGTTTTCAGTATCCGGCACCGAGGTGATAGCCAGTGGTGTTAATTTAATGAGAATAGGAACAGTACAAATTCGTGCTCACAATTTGCAGAGTAGTTTCAACAATCGCTAATTTCACGGTTATTGGTTAGGCATGTGACTGCAGCCACCGTGCAAAGAACAATTCTGAAGAAATTTTCCTTACATCTGAACTCTATATCTTTGTTCTTGTCTCATCTGTCCCTGAAGTAGAGTACTGCAACCGGACTCGGGTTTACCAAGCATATTGAAGGTGGATTGTGTCGGCCTGTGTTTCTTTTGGTTTACAAAGTGTATATATATTTCAGTATTTTGGAGATTGTTAACATGAATGTCATCAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGGTATGACTGATGCCAGGATATCTAGGCCTCTTGCTCTGCCCAAGTTGTTCCTAAGGTGATTCATGACATGAACGCGTGTAAACGGTACATTTCTGTCAGGTGGATGATTATTTTAACATGATCTTCAAATGTTGTGTACACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAAGTGAGTATGGATTTCTCAGATTTCCTTCTTTCTCAGAATTGGAGTGAGGTGAATATATTTTGCAACACCATGCAGTTAGTTTCCCATGATTGCGTCTTTTATTTTAATTTTCTCGTTCATCCTGGCAAGAATTTTAATGCCAGGATCTGAATAGAACGTATTTGGGTTCATCAACTTGAGTATGTGTCATACTTATCAAATTTTATGTACATACCGATGCATTGTCTCTGAGGCCATGGCTAGTATACCAATTAGCAGAAATGTTCATCAGGTACAATGTGGAGTGCCTGGTTCATGATTGCATGTTAAATTGTTGTTCTCTCATTCATATTGGTCAGGTTCGTAAGTGCCAATAATTGATTACATTATAATTCGACTTAGCAACCTGAATATGTCCAACATCTTAACTTTTGGATGTTTATACTGAGGCGTTGTGTGGTTGTCATGGCTAGTATGCCCATTATCAGAGGGATTCGAGAGGTACAGTGTAGAGTACCGAGTTCTTGGATGTATGATGAGCTTGTACGTGTTGAGGATTATCTTCGAGCTTCATTGACATTAGAAAGATTTTTGTTATGTGTAAAGGTCTCATGTGTTCTAACTTGCGTGTGGTTGTATTGAGCAGCTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAGACTCATCATAGAACTATAACTTTGAGGGCATCGGTATCGGTATCTCGGGTCAGGGTCGTTCTGCATTACAGTTGAAGAGTAACCTGTATATACTGGACCCAGAGCATGCCAGTTTGTGAGTCATTTCTTGTGTGATTGTTTACAGTAGGAATGTTCTCTGTATAGCTAGATTTGAGCCTTCACTTCGTTGGCCCGAGAAGGCTATATTCATACGAGGTCCATATGCTTACCCACCAACGTACATTACAGTCAATATCAAGGACTTCGAGTCTCACTCTGTTGCGGTACTGTACATAGGCTTGTGAATGGAAGGTTGGATCTTGTTTTTACGATGTCTTCATTGAAGCCACGCCGATTGGACCTTCGTAGCCAACGTAGTCTCGTAGTTGTGAAACATGAACTCTTTGCTGCATCTGTCTTGTTGTTGTAAAGACTCAACAATGCTTCGGATGCTTGTTTGCCTGTTGAGTCACGGAAACTACAAGATGGATCTAGAGATACTTAAGCCACCTCCAACTATCACGCCGTACTCTCTCCCTCGTAACCCGTTAAAAGTTGTACTTATTTTTGCGATATTTCAGGCGAGTTTGCACCCTTGAGTAGAACATACCATGC

mRNA

>Mapoly0013s0153.2
CGCTTTACACCCTGGCCCAGGATGTAGTCGACAATCATTCAGAGCAGGATAGTTTCTCGGAAAAGTGGCTGGAGTAGTACTACATATGAAGCGCTCCTGCCACGCTGGCAGAATCTGGCAGAATCTGGTGCACCGACCTTCAGACATTCCAGTATCTGTGTGTTGACGACAGCGGGTGATGACAACAAGACTGCCCTGTTACCATGTTCGAAACTGATTCGAATCGTGGGAATTCATATTTAACTAGGTCCTCTCTTTTTTACTGGAAAAGAGCTTACGACCAATCGACAGCAGAGTGGGAGCGTGGCAGTGGGAGTGGTGGTGGTGGTCGACCGATTCCTGGAACATCGACGCTGGACCGATGCCTGGAACATCGACGCTGGACGAGACCAATTGAACCGGCCTTGGTGGCGGAATGATCGAGAGGTGTTCCAAACTACAGTGAATTACGAAGCTGAGAATGCTCTCTGATGATTGACATTGGGCATCAAGTACGAAGAGGATAATACATTGACCGTGCATATTCCTGTTGGATGCAGATAGGAGTTGACATCTGTGCAATGGGAAAAGCGGTGAGATCAAGTGTGGTGTTCGCTATCAACGGACGACGAGTTGAGCTCACTGACGTCGATCCACGGACGAGTGTACTGAATTACATTCGCGAGGAGACGGAATTTAAGGGCACGAAGCGTGGTTGTGGTGAAGAGAGGAGTTAAGCTCTCTGCAATGGGGAAAGCGGTGAGATCCAGTGTGGTGTTCGCTCTCAATGGACAAAGAGTTGAGCTCAGCGACGTCGATCCGCGAACGAGTGTGTTGAGCTACATTCGCGAAGAGACAGACTTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAACTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAGACTCATCATAGAACTATAACTTTGAGGGCATCGGTATCGGTATCTCGGGTCAGGGTCGTTCTGCATTACAGTTGAAGAGTAACCTGTATATACTGGACCCAGAGCATGCCAGTTTGTGAGTCATTTCTTGTGTGATTGTTTACAGTAGGAATGTTCTCTGTATAGCTAGATTTGAGCCTTCACTTCGTTGGCCCGAGAAGGCTATATTCATACGAGGTCCATATGCTTACCCACCAACGTACATTACAGTCAATATCAAGGACTTCGAGTCTCACTCTGTTGCGGTACTGTACATAGGCTTGTGAATGGAAGGTTGGATCTTGTTTTTACGATGTCTTCATTGAAGCCACGCCGATTGGACCTTCGTAGCCAACGTAGTCTCGTAGTTGTGAAACATGAACTCTTTGCTGCATCTGTCTTGTTGTTGTAAAGACTCAACAATGCTTCGGATGCTTGTTTGCCTGTTGAGTCACGGAAACTACAAGATGGATCTAGAGATACTTAAGCCACCTCCAACTATCACGCCGTACTCTCTCCCTCGTAACCCGTTAAAAGTTGTACTTATTTTTGCGATATTTCAGGCGAGTTTGCACCCTTGAGTAGAACATACCATGC

CDS

>Mapoly0013s0153.2
ATGGGGAAAGCGGTGAGATCCAGTGTGGTGTTCGCTCTCAATGGACAAAGAGTTGAGCTCAGCGACGTCGATCCGCGAACGAGTGTGTTGAGCTACATTCGCGAAGAGACAGACTTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAACTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAG

Protein

>Mapoly0013s0153.2
MGKAVRSSVVFALNGQRVELSDVDPRTSVLSYIREETDFKGTKRGCGEGGCGSCVVLLSKYDSKSNKIEEYTINSCLAPICSVDGCAITTTEGLKNGKEPHAVHTRLAEFHASQCGFCTPGMAVSIYSCLKNSSKKSSMGAESTKPTVAEAQKAIAGNLCRCTGYRPILDVCKSFAADVDIEDLGVNTFWESSELAKESSLNLYQSEKDPEFPTFLKIQAGDYLEVKSVRAEEVTAWRSASTLSELFTMYEEETKGKNRDVNFVAGNTSSGVYKDFKPSVYIDINKIPELHSVVETDCTLEVGSAVSLSKLITIMDARGGPVYSELAKHLRKVANEHVRNRASVGGNLILAQKRGFASDVATILLGAGSQVTIATSRDSCIKDMEEFLAGVSPDTTILQCIRIPSWAQYSKDGKEKLFFKTYRSSPRKNGNAVSSVNAAFLGIFQTPEVDNGYTVGKVQQLRLAFGHLGAPHAMRAKRTEKYLLQKTVNPDVLKNAVKILREDILSSAKDDDLYTATYKASVAVSYLFQFFEPLLPSSNLTSSQVGTPCMNGGDTLSNGSKVHSRDVTGTKSKSEVHNKGDTCTNGNSEVHNKGDTDSNGNSEVHDKGDTGTNGAAMNGTNSDESAVRSFGRTSGNGIGIGEGFWGAQSFPHYDEFSPLSKPAAKDAAVLQASGEAVYTGDIPSPPGTLHAALVYSKKALAKVKALEASDALTSPGATSFFCAKDCIAENVSVVNNIAGLEFREPLFAEETVHFVGECLGVLVADTHEHAVLAAEKVKVDYDNSTLGPPILSVEDAAGMNSFKISPLAVMGTASVGDELIKGEYRMENIELFAGSQYYFYMETHTALAVPDEDDCITVYSSNHSPEVLHDTLSAALGIPMHNIRVITRRLGGSFGGKNTRSLIVATACALAAFKLKKPVRMTLDRNTDMVLSGGRHESKATYSVEFNKDGKITSLETNVLMNGGYPDDYRDLLGLLLTKAMKCYNWTSWRHVSKVCRTNLPARSMMRAPGEIQGNFFAESIVEHVATYLGLDRDKVREINMHTHESAKLFYGPSTTGKAELFTLPKIVQRTKDLSNFESRKLNVHSFNKRSMWVKRGISLTHVIYPNMQSAKVARVSLFKDGSVAVASGGTEMGQGLFTKVKQATAYGLSLLWGENATGKVDLSKIRIVENDSISLANAGTTNAGTTSEGTCEAVVNACKMLVKNLTPIYLKLKANGGESPRWEDVVKLAKGSRVVLTAEARNGEIGPATEYMACGACASEVEVDLLTGSVKVLQADLVYDCGKSLNPAVDIGQIEGSFVQGIGYYLTEQIKWDENGVLLTNGTWTYKPPTIDNIPQKFNVELLNSAVDSSRILSSKTAGEAPLVLSTSVHLAVREAIKSARADLQHLPPVPGHCGPENMKGSTDPLLIRNSVTSMENVKRLCGLYNVEQYLEKLSIESS

Mapoly0013s0153.3  

Gene structure:

mRNA scaffold_13:1687888..1698896  ( - strand )
three_prime_UTR scaffold_13:1687888..1688492  ( - strand )
CDS scaffold_13:1688493..1688743  ( - strand )
CDS scaffold_13:1689369..1689558  ( - strand )
CDS scaffold_13:1689702..1689800  ( - strand )
CDS scaffold_13:1690964..1691059  ( - strand )
CDS scaffold_13:1691284..1692261  ( - strand )
CDS scaffold_13:1692437..1692655  ( - strand )
CDS scaffold_13:1692887..1693090  ( - strand )
CDS scaffold_13:1693345..1693610  ( - strand )
CDS scaffold_13:1694169..1696043  ( - strand )
CDS scaffold_13:1697608..1697752  ( - strand )
five_prime_UTR scaffold_13:1697753..1697773  ( - strand )
five_prime_UTR scaffold_13:1698192..1698357  ( - strand )
five_prime_UTR scaffold_13:1698471..1698896  ( - strand )

Sequences:

Gene

>Mapoly0013s0153.3
CGCTTTACACCCTGGCCCAGGATGTAGTCGACAATCATTCAGAGCAGGATAGTTTCTCGGAAAAGTGGCTGGAGTAGTACTACATATGAAGCGCTCCTGCCACGCTGGCAGAATCTGGCAGAATCTGGTGCACCGACCTTCAGACATTCCAGTATCTGTGTGTTGACGACAGCGGGTGATGACAACAAGACTGCCCTGTTACCATGTTCGAAACTGATTCGAATCGTGGGAATTCATATTTAACTAGGTCCTCTCTTTTTTACTGGAAAAGAGCTTACGACCAATCGACAGCAGAGTGGGAGCGTGGCAGTGGGAGTGGTGGTGGTGGTCGACCGATTCCTGGAACATCGACGCTGGACCGATGCCTGGAACATCGACGCTGGACGAGACCAATTGAACCGGCCTTGGTGGCGGAATGATCGAGAGGTGTTCCAAACTACAGTGAATTACGAAGCTGAGAATGCTCTCTGATGATTGACATTGGGCATCAAGTACGAAGAGGATAATACATTGACCGTGCATATTCCTGTTGGATGCAGATAGGAGTTGACATCTGTGCAATGGGAAAAGCGGTGAGATCAAGTGTGGTGTTCGCTATCAACGGACGACGAGTTGAGCTCACTGACGTCGATCCACGGACGAGTGTACTGAATTACATTCGCGAGGAGACGGAATTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTACTGTCATGTTCTCAACGAAGACTCTGTAACTAATTTCTCCGTTGCTTCTTCTAAGCAGCGGGCCTTTAGCGTGCGCATCATATTTTGGCTAAAAGGCCTTTACATTCTACAGCTTGAAAACAACTTTCAGGTTCTCTTGTGCTGCTTGAAATTTCTACCGCTCTTACCAGGTTTGGAGCTAAGTCCTGTCTTCTGATCGCGCAACTTGTTGTTTACATCTCTTGCTTCCTGTTTGTAGGCAGTAATTGGTTCTGTAATGGTTTGCTTTAATTCACTTTGGGTCTTCTATGGCTCTGAGCAGACGTCTGAGACGTCTTGTCGCATCTCTGGACTTTTCATGGTTATGTAGCTGCTTGCTTGATTGATGGGGAAGTCAACGTAAAAATGGATTGTGCATTCGCCCCCTTGGATGTAGAGAGGAGTTAAGCTCTCTGCAATGGGGAAAGCGGTGAGATCCAGTGTGGTGTTCGCTCTCAATGGACAAAGAGTTGAGCTCAGCGACGTCGATCCGCGAACGAGTGTGTTGAGCTACATTCGCGAAGAGACAGACTTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTACTGTCTTCTTCTCTTGGAAGACTTTGGGATTAGTGTCCTCTTTCTGAGCTTCTTTTGAGCTGTGGCAGTTCAGCGTGCATCATATGTTGCTTGACTGGCCTGTAGATTCTATAAGTTGGAACTCACTGTCACTTATTATTGTTCTATTGTTCTTACCAGGATCGAGCTGTCATCCCATCTTAGCGTGCAGTCTATTGTCTACATACCTTGCTTCCTGTATGCAGTAATTGCTTGTATATTGGCTTTAAGTTTACTCCGGGCATATAAGCACGAAGGCGTCGCAGAGCTTGTTTGTGAAAACTTCTTGTTGCATCTCTCGACTTTCCATGTTTCGGTAGCTGCTTGATTGATTGATGGGAAGCCAACGTAGAAAATGGAAAACATGTGTTTGAAGAAGACTGACATTTGTTAATTCCAGTAATTGCTTGCATGTTCAGATGGTTTTGTAATAATTTGCCGACATCCAAACTAACACAGCCTCTTTGGCGATGCTGTCCAGTAGTTTGAAGAAGTTTTCTCCTTTGTTCTAGGTGTCTTCTCTGGCTGCTCCTAAATCCTTTGTTTCTGAGCTAGAACTTCCTGACTCTGGTCTCGCAGCACCGCGATTCCTATCTGCATGCAATTTAGTGCTTAACTGTGTGAAGCGAAACTGGTCATGAGTTAGAAGAGACGATTGCTCGCTCTGTATGTTTTCAGGCATATTGACAAGTCACAATCACCTGATTCTTATCCCTTCAACAACGTATGCAACCCGTCACTTTCTGAATCCAAGCTTTCTGTGCGAAATGTTCAAATGCTTGTATCAATTTCTGGGAATCTCGTGCTCTGAAGAAGTCACAAACGTTTGAACCCAGAATCGAGTGCCCGGAGGGTTGTAGAATTAACGGAGGGTAGTATTACGTCATCAATACGTTGCCAATTGTTTGTAGATTTACTCGCCATAAATCTGAATTCGAATGAACGGTCTAATTTACTAAGTTGAGGCTAAGACATGAGCGTGCACTTTCATGTATGTGTAACGGCGAGCTTGCCACTACTGGTTAGCAAGCTCTCTGCTGGCTCATTCGAACGAAGCGTGTGTTCAAACTTTAACGAAGCGTGTGTTCAAATTTTAACGAGGCTTCGTCACGTCCCGCTTTCTTTCTCTTCCCCACGTCAATAATTTCAAATTCACGAGCTGCATGTGTTACACAATTTGGTTGGCTGGATCGGAGGTGTCTGTTTAAATATACGCGTTTGTGGTGCTTGCGTTAGGATTTAACCAAGTGATTACATCTGAACTCTAACGAGTATGATAATTTGCCACGGTGGAGAGCTCCTACACAAGTGGAGGAGGCATTTCGAACTTTTGCAATATCTAATCCATGTTACAGAATTTTAGTCTAGCAAATGGCTTTTACGCTATTAATTTTGAGTTCGAGTTAACGTGGATCTTTGAGGATTAGGATGACCACCGGAAGTAATCAAATCAGTTCAACTCCTTTTGCCCAAAGAAGTGCAAACTGGATATTTCCGTTGCCATTGGTTACTATTTTTTCAAATTAATTTTGTGGATGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGCAAGTTTCTCATGGGAATACTCTTATTTTTCTTAACGCTGGAAGCTGTAAGATCATTTTGTGAGCTTGCAAGAACGTGAACTATCACACCAATAGGACATAGGCCGTCCCATCTGTGGGTCTAATCGTCTCTTGTGTGAATGTTGAGTCACATTGCTTGAGCATATACTTGTCATACATTGCTATGAAGTACGTGGGGAGCTACCTAAACAATGCTTTTTGATTATAGGCTCGACAACCATTGCGCATTTGAAACTTTCGCTCACATGTTGGTAGTATAATCTCTTCTAGTTTCTTCATCATCCTAGACTATTAATTTATGCGCAGAAACAGGTCGATAAGAGGAGAACGCATCATTGCAAACATAGAAGTCTTGTTCCACCATTTAGTTTGCATGATCAGTAGACTATTTAAACAAATGTCCTTTGGAACCCACTATAGTAGGAGTGAAAATTCCCGATTAGCATCTATCGAAGCGGGGAGTAAGGGAGGGTTTAGGGTTTAGTTCGTGTGAAGAGAGGTTTGATTGTAACCCAACTCTCGGATCTTTTACCTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTTTGCCTCCTTAACTTCCAAAACCTCCACTGCTGTTTTTGGCTCTTAAGTCAAAGTTATTTGGATGTAGCACTTTGAGTGATAGGGGCGAATTTTAGTGTTGAAGTTTCACTCATTATTTTCGGGCATTTATACCTTGTTTTTTCTCTTTACTGAACTGCATTTCGATTTATTTTAGTTCCTTCCGTCATAGAAACTTCCCTCGTTTTGCCGAAAGAACTAATGTCTCCCTTTTTGTATAACTTATGTGACAGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGGTGTGAATGTGATCCTATACTTGTGAATTATACTTTTTGATCTTATGCATCTTGCCCTCGAGTTTTGCTTTTAACCCCGAAGTGGTGACTCTTCAATGTCTAAACTAGATGTATTGCAGTCCAATGATGATTTCTCAGCTTCCATAGCTTTCGAAGTGTTGATTGTCATAAACTACCGTCTGACACCTCATTTATTGTACATTCCACCTCACGAAGTCCTTTCGTCTGTAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTGAGTGTTCTCTTAAGTGATACTTTGATTTCTGGTGATTGTTTTTTGGTATGGCCCTTTTAAATAATCTTGTGTGTCAAGTCTGAGTTGATTTTTTTCACTTGAACATACCTATTAGAAGGAACCCACTTCTCAGTAGTTTGCCGTTATCTGAATATCGGAATTTTTTCTTCAGGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGTACAATCTCGTTCTTTGTTCCTGTATTGACGGACTTTGTACTAACATCTACTAAGAAGTTAACAGACCATGTTCAGATCCTGCTCATCACGAGCAGTTCTCAGGTCCATATCAATAGGGATGTACCATCAAAGATAGATCATGTAAATAATAAGTAGAGAAGAGAAATGTTAGGGTTGGAATTTGAAGTTTTTAACTCTTTCCTCTCATGTCAAATTCTCCAGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTAACTACTATACATATAAACTCTTCCTGTAGCTTCATATTTTCCCACCCAAAACATGCGAATTGTCTCTTCAACTTTCTCGTCGAAGGTCTTATGTTTGCATCCTTAAATGAAACGTAGATGCTCAACTTGTTTGCTTTATACCCAACAGACTCTTCACATAGATGCCTGTCTCAAAGTAGATTCTAGGATGGTGGCGTAAAACAATAAACCTTGCAAGCTTAGTCATCCAGAAGAAGTTGCGTTGTTTTTACGGATGGAGATACATGCATGCATAGGTTATTAGTATTCCAGTACGCAATAAGATTATGTCATCCATTGATATTCTTCTCATTCACATGTTACCATCGAGGGGTTTCGCACTTATATTTGCATGTTTAGATTAACATGTAGCCAAATAAGGTCTTGTTTTGACCTTAACATATATATTATAGACGTTTAAGTTGTTTTACATTACCTGCAAAATACTTATCTTTTCTTCCATCTGGGAAATTTTTTCCATTAAAAGAAATCAAGATATGTCGATATTTACAAGCCCTACTTCTTCCTCATGGTTATATTTGACATCGTCTTTGACTTGCTTTACATCCAACATACTCAATGAGATTTTAGAGTAGTGGAGGATACCTCTTGCACACGATATGGTATCAGTACATAACTTTTACACAGTACATTCCTCATGCTGCTTCTTACGATTAGTATTACATTTTTAAATTCGGAAAGAAACCTATCCTGAGAACATTACATCACAGTATAGATGGTAATATCAGAAGACTGAGTCTTTTCTTACATTTGTCAAAACAGAACGTTTTCAGTATCCGGCACCGAGGTGATAGCCAGTGGTGTTAATTTAATGAGAATAGGAACAGTACAAATTCGTGCTCACAATTTGCAGAGTAGTTTCAACAATCGCTAATTTCACGGTTATTGGTTAGGCATGTGACTGCAGCCACCGTGCAAAGAACAATTCTGAAGAAATTTTCCTTACATCTGAACTCTATATCTTTGTTCTTGTCTCATCTGTCCCTGAAGTAGAGTACTGCAACCGGACTCGGGTTTACCAAGCATATTGAAGGTGGATTGTGTCGGCCTGTGTTTCTTTTGGTTTACAAAGTGTATATATATTTCAGTATTTTGGAGATTGTTAACATGAATGTCATCAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGGTATGACTGATGCCAGGATATCTAGGCCTCTTGCTCTGCCCAAGTTGTTCCTAAGGTGATTCATGACATGAACGCGTGTAAACGGTACATTTCTGTCAGGTGGATGATTATTTTAACATGATCTTCAAATGTTGTGTACACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAAGTGAGTATGGATTTCTCAGATTTCCTTCTTTCTCAGAATTGGAGTGAGGTGAATATATTTTGCAACACCATGCAGTTAGTTTCCCATGATTGCGTCTTTTATTTTAATTTTCTCGTTCATCCTGGCAAGAATTTTAATGCCAGGATCTGAATAGAACGTATTTGGGTTCATCAACTTGAGTATGTGTCATACTTATCAAATTTTATGTACATACCGATGCATTGTCTCTGAGGCCATGGCTAGTATACCAATTAGCAGAAATGTTCATCAGGTACAATGTGGAGTGCCTGGTTCATGATTGCATGTTAAATTGTTGTTCTCTCATTCATATTGGTCAGGTTCGTAAGTGCCAATAATTGATTACATTATAATTCGACTTAGCAACCTGAATATGTCCAACATCTTAACTTTTGGATGTTTATACTGAGGCGTTGTGTGGTTGTCATGGCTAGTATGCCCATTATCAGAGGGATTCGAGAGGTACAGTGTAGAGTACCGAGTTCTTGGATGTATGATGAGCTTGTACGTGTTGAGGATTATCTTCGAGCTTCATTGACATTAGAAAGATTTTTGTTATGTGTAAAGGTCTCATGTGTTCTAACTTGCGTGTGGTTGTATTGAGCAGCTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAGACTCATCATAGAACTATAACTTTGAGGGCATCGGTATCGGTATCTCGGGTCAGGGTCGTTCTGCATTACAGTTGAAGAGTAACCTGTATATACTGGACCCAGAGCATGCCAGTTTGTGAGTCATTTCTTGTGTGATTGTTTACAGTAGGAATGTTCTCTGTATAGCTAGATTTGAGCCTTCACTTCGTTGGCCCGAGAAGGCTATATTCATACGAGGTCCATATGCTTACCCACCAACGTACATTACAGTCAATATCAAGGACTTCGAGTCTCACTCTGTTGCGGTACTGTACATAGGCTTGTGAATGGAAGGTTGGATCTTGTTTTTACGATGTCTTCATTGAAGCCACGCCGATTGGACCTTCGTAGCCAACGTAGTCTCGTAGTTGTGAAACATGAACTCTTTGCTGCATCTGTCTTGTTGTTGTAAAGACTCAACAATGCTTCGGATGCTTGTTTGCCTGTTGAGTCACGGAAACTACAAGATGGATCTAGAGATACTTAAGCCACCTCCAACTATCACGCCGTACTCTCTCCCTCGTAACCCGTTAAAAGTTGTACTTATTTTTGCGATATTTCAGGCGAGTTTGCACCCTTGAGTAGAA

mRNA

>Mapoly0013s0153.3
CGCTTTACACCCTGGCCCAGGATGTAGTCGACAATCATTCAGAGCAGGATAGTTTCTCGGAAAAGTGGCTGGAGTAGTACTACATATGAAGCGCTCCTGCCACGCTGGCAGAATCTGGCAGAATCTGGTGCACCGACCTTCAGACATTCCAGTATCTGTGTGTTGACGACAGCGGGTGATGACAACAAGACTGCCCTGTTACCATGTTCGAAACTGATTCGAATCGTGGGAATTCATATTTAACTAGGTCCTCTCTTTTTTACTGGAAAAGAGCTTACGACCAATCGACAGCAGAGTGGGAGCGTGGCAGTGGGAGTGGTGGTGGTGGTCGACCGATTCCTGGAACATCGACGCTGGACCGATGCCTGGAACATCGACGCTGGACGAGACCAATTGAACCGGCCTTGGTGGCGGAATGATCGAGAGATAGGAGTTGACATCTGTGCAATGGGAAAAGCGGTGAGATCAAGTGTGGTGTTCGCTATCAACGGACGACGAGTTGAGCTCACTGACGTCGATCCACGGACGAGTGTACTGAATTACATTCGCGAGGAGACGGAATTTAAGGGCACGAAGCGTGGTTGTGGTGAAGAGAGGAGTTAAGCTCTCTGCAATGGGGAAAGCGGTGAGATCCAGTGTGGTGTTCGCTCTCAATGGACAAAGAGTTGAGCTCAGCGACGTCGATCCGCGAACGAGTGTGTTGAGCTACATTCGCGAAGAGACAGACTTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAACTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAGACTCATCATAGAACTATAACTTTGAGGGCATCGGTATCGGTATCTCGGGTCAGGGTCGTTCTGCATTACAGTTGAAGAGTAACCTGTATATACTGGACCCAGAGCATGCCAGTTTGTGAGTCATTTCTTGTGTGATTGTTTACAGTAGGAATGTTCTCTGTATAGCTAGATTTGAGCCTTCACTTCGTTGGCCCGAGAAGGCTATATTCATACGAGGTCCATATGCTTACCCACCAACGTACATTACAGTCAATATCAAGGACTTCGAGTCTCACTCTGTTGCGGTACTGTACATAGGCTTGTGAATGGAAGGTTGGATCTTGTTTTTACGATGTCTTCATTGAAGCCACGCCGATTGGACCTTCGTAGCCAACGTAGTCTCGTAGTTGTGAAACATGAACTCTTTGCTGCATCTGTCTTGTTGTTGTAAAGACTCAACAATGCTTCGGATGCTTGTTTGCCTGTTGAGTCACGGAAACTACAAGATGGATCTAGAGATACTTAAGCCACCTCCAACTATCACGCCGTACTCTCTCCCTCGTAACCCGTTAAAAGTTGTACTTATTTTTGCGATATTTCAGGCGAGTTTGCACCCTTGAGTAGAA

CDS

>Mapoly0013s0153.3
ATGGGGAAAGCGGTGAGATCCAGTGTGGTGTTCGCTCTCAATGGACAAAGAGTTGAGCTCAGCGACGTCGATCCGCGAACGAGTGTGTTGAGCTACATTCGCGAAGAGACAGACTTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAACTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAG

Protein

>Mapoly0013s0153.3
MGKAVRSSVVFALNGQRVELSDVDPRTSVLSYIREETDFKGTKRGCGEGGCGSCVVLLSKYDSKSNKIEEYTINSCLAPICSVDGCAITTTEGLKNGKEPHAVHTRLAEFHASQCGFCTPGMAVSIYSCLKNSSKKSSMGAESTKPTVAEAQKAIAGNLCRCTGYRPILDVCKSFAADVDIEDLGVNTFWESSELAKESSLNLYQSEKDPEFPTFLKIQAGDYLEVKSVRAEEVTAWRSASTLSELFTMYEEETKGKNRDVNFVAGNTSSGVYKDFKPSVYIDINKIPELHSVVETDCTLEVGSAVSLSKLITIMDARGGPVYSELAKHLRKVANEHVRNRASVGGNLILAQKRGFASDVATILLGAGSQVTIATSRDSCIKDMEEFLAGVSPDTTILQCIRIPSWAQYSKDGKEKLFFKTYRSSPRKNGNAVSSVNAAFLGIFQTPEVDNGYTVGKVQQLRLAFGHLGAPHAMRAKRTEKYLLQKTVNPDVLKNAVKILREDILSSAKDDDLYTATYKASVAVSYLFQFFEPLLPSSNLTSSQVGTPCMNGGDTLSNGSKVHSRDVTGTKSKSEVHNKGDTCTNGNSEVHNKGDTDSNGNSEVHDKGDTGTNGAAMNGTNSDESAVRSFGRTSGNGIGIGEGFWGAQSFPHYDEFSPLSKPAAKDAAVLQASGEAVYTGDIPSPPGTLHAALVYSKKALAKVKALEASDALTSPGATSFFCAKDCIAENVSVVNNIAGLEFREPLFAEETVHFVGECLGVLVADTHEHAVLAAEKVKVDYDNSTLGPPILSVEDAAGMNSFKISPLAVMGTASVGDELIKGEYRMENIELFAGSQYYFYMETHTALAVPDEDDCITVYSSNHSPEVLHDTLSAALGIPMHNIRVITRRLGGSFGGKNTRSLIVATACALAAFKLKKPVRMTLDRNTDMVLSGGRHESKATYSVEFNKDGKITSLETNVLMNGGYPDDYRDLLGLLLTKAMKCYNWTSWRHVSKVCRTNLPARSMMRAPGEIQGNFFAESIVEHVATYLGLDRDKVREINMHTHESAKLFYGPSTTGKAELFTLPKIVQRTKDLSNFESRKLNVHSFNKRSMWVKRGISLTHVIYPNMQSAKVARVSLFKDGSVAVASGGTEMGQGLFTKVKQATAYGLSLLWGENATGKVDLSKIRIVENDSISLANAGTTNAGTTSEGTCEAVVNACKMLVKNLTPIYLKLKANGGESPRWEDVVKLAKGSRVVLTAEARNGEIGPATEYMACGACASEVEVDLLTGSVKVLQADLVYDCGKSLNPAVDIGQIEGSFVQGIGYYLTEQIKWDENGVLLTNGTWTYKPPTIDNIPQKFNVELLNSAVDSSRILSSKTAGEAPLVLSTSVHLAVREAIKSARADLQHLPPVPGHCGPENMKGSTDPLLIRNSVTSMENVKRLCGLYNVEQYLEKLSIESS

Mapoly0013s0153.4  

Gene structure:

mRNA scaffold_13:1687888..1698896  ( - strand )
three_prime_UTR scaffold_13:1687888..1688492  ( - strand )
CDS scaffold_13:1688493..1688743  ( - strand )
CDS scaffold_13:1689369..1689558  ( - strand )
CDS scaffold_13:1689702..1689800  ( - strand )
CDS scaffold_13:1690964..1691059  ( - strand )
CDS scaffold_13:1691284..1692261  ( - strand )
CDS scaffold_13:1692437..1692655  ( - strand )
CDS scaffold_13:1692887..1693090  ( - strand )
CDS scaffold_13:1693345..1693610  ( - strand )
CDS scaffold_13:1694169..1696043  ( - strand )
CDS scaffold_13:1698192..1698336  ( - strand )
five_prime_UTR scaffold_13:1698337..1698357  ( - strand )
five_prime_UTR scaffold_13:1698471..1698896  ( - strand )

Sequences:

Gene

>Mapoly0013s0153.4
CGCTTTACACCCTGGCCCAGGATGTAGTCGACAATCATTCAGAGCAGGATAGTTTCTCGGAAAAGTGGCTGGAGTAGTACTACATATGAAGCGCTCCTGCCACGCTGGCAGAATCTGGCAGAATCTGGTGCACCGACCTTCAGACATTCCAGTATCTGTGTGTTGACGACAGCGGGTGATGACAACAAGACTGCCCTGTTACCATGTTCGAAACTGATTCGAATCGTGGGAATTCATATTTAACTAGGTCCTCTCTTTTTTACTGGAAAAGAGCTTACGACCAATCGACAGCAGAGTGGGAGCGTGGCAGTGGGAGTGGTGGTGGTGGTCGACCGATTCCTGGAACATCGACGCTGGACCGATGCCTGGAACATCGACGCTGGACGAGACCAATTGAACCGGCCTTGGTGGCGGAATGATCGAGAGGTGTTCCAAACTACAGTGAATTACGAAGCTGAGAATGCTCTCTGATGATTGACATTGGGCATCAAGTACGAAGAGGATAATACATTGACCGTGCATATTCCTGTTGGATGCAGATAGGAGTTGACATCTGTGCAATGGGAAAAGCGGTGAGATCAAGTGTGGTGTTCGCTATCAACGGACGACGAGTTGAGCTCACTGACGTCGATCCACGGACGAGTGTACTGAATTACATTCGCGAGGAGACGGAATTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTACTGTCATGTTCTCAACGAAGACTCTGTAACTAATTTCTCCGTTGCTTCTTCTAAGCAGCGGGCCTTTAGCGTGCGCATCATATTTTGGCTAAAAGGCCTTTACATTCTACAGCTTGAAAACAACTTTCAGGTTCTCTTGTGCTGCTTGAAATTTCTACCGCTCTTACCAGGTTTGGAGCTAAGTCCTGTCTTCTGATCGCGCAACTTGTTGTTTACATCTCTTGCTTCCTGTTTGTAGGCAGTAATTGGTTCTGTAATGGTTTGCTTTAATTCACTTTGGGTCTTCTATGGCTCTGAGCAGACGTCTGAGACGTCTTGTCGCATCTCTGGACTTTTCATGGTTATGTAGCTGCTTGCTTGATTGATGGGGAAGTCAACGTAAAAATGGATTGTGCATTCGCCCCCTTGGATGTAGAGAGGAGTTAAGCTCTCTGCAATGGGGAAAGCGGTGAGATCCAGTGTGGTGTTCGCTCTCAATGGACAAAGAGTTGAGCTCAGCGACGTCGATCCGCGAACGAGTGTGTTGAGCTACATTCGCGAAGAGACAGACTTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTACTGTCTTCTTCTCTTGGAAGACTTTGGGATTAGTGTCCTCTTTCTGAGCTTCTTTTGAGCTGTGGCAGTTCAGCGTGCATCATATGTTGCTTGACTGGCCTGTAGATTCTATAAGTTGGAACTCACTGTCACTTATTATTGTTCTATTGTTCTTACCAGGATCGAGCTGTCATCCCATCTTAGCGTGCAGTCTATTGTCTACATACCTTGCTTCCTGTATGCAGTAATTGCTTGTATATTGGCTTTAAGTTTACTCCGGGCATATAAGCACGAAGGCGTCGCAGAGCTTGTTTGTGAAAACTTCTTGTTGCATCTCTCGACTTTCCATGTTTCGGTAGCTGCTTGATTGATTGATGGGAAGCCAACGTAGAAAATGGAAAACATGTGTTTGAAGAAGACTGACATTTGTTAATTCCAGTAATTGCTTGCATGTTCAGATGGTTTTGTAATAATTTGCCGACATCCAAACTAACACAGCCTCTTTGGCGATGCTGTCCAGTAGTTTGAAGAAGTTTTCTCCTTTGTTCTAGGTGTCTTCTCTGGCTGCTCCTAAATCCTTTGTTTCTGAGCTAGAACTTCCTGACTCTGGTCTCGCAGCACCGCGATTCCTATCTGCATGCAATTTAGTGCTTAACTGTGTGAAGCGAAACTGGTCATGAGTTAGAAGAGACGATTGCTCGCTCTGTATGTTTTCAGGCATATTGACAAGTCACAATCACCTGATTCTTATCCCTTCAACAACGTATGCAACCCGTCACTTTCTGAATCCAAGCTTTCTGTGCGAAATGTTCAAATGCTTGTATCAATTTCTGGGAATCTCGTGCTCTGAAGAAGTCACAAACGTTTGAACCCAGAATCGAGTGCCCGGAGGGTTGTAGAATTAACGGAGGGTAGTATTACGTCATCAATACGTTGCCAATTGTTTGTAGATTTACTCGCCATAAATCTGAATTCGAATGAACGGTCTAATTTACTAAGTTGAGGCTAAGACATGAGCGTGCACTTTCATGTATGTGTAACGGCGAGCTTGCCACTACTGGTTAGCAAGCTCTCTGCTGGCTCATTCGAACGAAGCGTGTGTTCAAACTTTAACGAAGCGTGTGTTCAAATTTTAACGAGGCTTCGTCACGTCCCGCTTTCTTTCTCTTCCCCACGTCAATAATTTCAAATTCACGAGCTGCATGTGTTACACAATTTGGTTGGCTGGATCGGAGGTGTCTGTTTAAATATACGCGTTTGTGGTGCTTGCGTTAGGATTTAACCAAGTGATTACATCTGAACTCTAACGAGTATGATAATTTGCCACGGTGGAGAGCTCCTACACAAGTGGAGGAGGCATTTCGAACTTTTGCAATATCTAATCCATGTTACAGAATTTTAGTCTAGCAAATGGCTTTTACGCTATTAATTTTGAGTTCGAGTTAACGTGGATCTTTGAGGATTAGGATGACCACCGGAAGTAATCAAATCAGTTCAACTCCTTTTGCCCAAAGAAGTGCAAACTGGATATTTCCGTTGCCATTGGTTACTATTTTTTCAAATTAATTTTGTGGATGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGCAAGTTTCTCATGGGAATACTCTTATTTTTCTTAACGCTGGAAGCTGTAAGATCATTTTGTGAGCTTGCAAGAACGTGAACTATCACACCAATAGGACATAGGCCGTCCCATCTGTGGGTCTAATCGTCTCTTGTGTGAATGTTGAGTCACATTGCTTGAGCATATACTTGTCATACATTGCTATGAAGTACGTGGGGAGCTACCTAAACAATGCTTTTTGATTATAGGCTCGACAACCATTGCGCATTTGAAACTTTCGCTCACATGTTGGTAGTATAATCTCTTCTAGTTTCTTCATCATCCTAGACTATTAATTTATGCGCAGAAACAGGTCGATAAGAGGAGAACGCATCATTGCAAACATAGAAGTCTTGTTCCACCATTTAGTTTGCATGATCAGTAGACTATTTAAACAAATGTCCTTTGGAACCCACTATAGTAGGAGTGAAAATTCCCGATTAGCATCTATCGAAGCGGGGAGTAAGGGAGGGTTTAGGGTTTAGTTCGTGTGAAGAGAGGTTTGATTGTAACCCAACTCTCGGATCTTTTACCTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTTTGCCTCCTTAACTTCCAAAACCTCCACTGCTGTTTTTGGCTCTTAAGTCAAAGTTATTTGGATGTAGCACTTTGAGTGATAGGGGCGAATTTTAGTGTTGAAGTTTCACTCATTATTTTCGGGCATTTATACCTTGTTTTTTCTCTTTACTGAACTGCATTTCGATTTATTTTAGTTCCTTCCGTCATAGAAACTTCCCTCGTTTTGCCGAAAGAACTAATGTCTCCCTTTTTGTATAACTTATGTGACAGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGGTGTGAATGTGATCCTATACTTGTGAATTATACTTTTTGATCTTATGCATCTTGCCCTCGAGTTTTGCTTTTAACCCCGAAGTGGTGACTCTTCAATGTCTAAACTAGATGTATTGCAGTCCAATGATGATTTCTCAGCTTCCATAGCTTTCGAAGTGTTGATTGTCATAAACTACCGTCTGACACCTCATTTATTGTACATTCCACCTCACGAAGTCCTTTCGTCTGTAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTGAGTGTTCTCTTAAGTGATACTTTGATTTCTGGTGATTGTTTTTTGGTATGGCCCTTTTAAATAATCTTGTGTGTCAAGTCTGAGTTGATTTTTTTCACTTGAACATACCTATTAGAAGGAACCCACTTCTCAGTAGTTTGCCGTTATCTGAATATCGGAATTTTTTCTTCAGGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGTACAATCTCGTTCTTTGTTCCTGTATTGACGGACTTTGTACTAACATCTACTAAGAAGTTAACAGACCATGTTCAGATCCTGCTCATCACGAGCAGTTCTCAGGTCCATATCAATAGGGATGTACCATCAAAGATAGATCATGTAAATAATAAGTAGAGAAGAGAAATGTTAGGGTTGGAATTTGAAGTTTTTAACTCTTTCCTCTCATGTCAAATTCTCCAGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTAACTACTATACATATAAACTCTTCCTGTAGCTTCATATTTTCCCACCCAAAACATGCGAATTGTCTCTTCAACTTTCTCGTCGAAGGTCTTATGTTTGCATCCTTAAATGAAACGTAGATGCTCAACTTGTTTGCTTTATACCCAACAGACTCTTCACATAGATGCCTGTCTCAAAGTAGATTCTAGGATGGTGGCGTAAAACAATAAACCTTGCAAGCTTAGTCATCCAGAAGAAGTTGCGTTGTTTTTACGGATGGAGATACATGCATGCATAGGTTATTAGTATTCCAGTACGCAATAAGATTATGTCATCCATTGATATTCTTCTCATTCACATGTTACCATCGAGGGGTTTCGCACTTATATTTGCATGTTTAGATTAACATGTAGCCAAATAAGGTCTTGTTTTGACCTTAACATATATATTATAGACGTTTAAGTTGTTTTACATTACCTGCAAAATACTTATCTTTTCTTCCATCTGGGAAATTTTTTCCATTAAAAGAAATCAAGATATGTCGATATTTACAAGCCCTACTTCTTCCTCATGGTTATATTTGACATCGTCTTTGACTTGCTTTACATCCAACATACTCAATGAGATTTTAGAGTAGTGGAGGATACCTCTTGCACACGATATGGTATCAGTACATAACTTTTACACAGTACATTCCTCATGCTGCTTCTTACGATTAGTATTACATTTTTAAATTCGGAAAGAAACCTATCCTGAGAACATTACATCACAGTATAGATGGTAATATCAGAAGACTGAGTCTTTTCTTACATTTGTCAAAACAGAACGTTTTCAGTATCCGGCACCGAGGTGATAGCCAGTGGTGTTAATTTAATGAGAATAGGAACAGTACAAATTCGTGCTCACAATTTGCAGAGTAGTTTCAACAATCGCTAATTTCACGGTTATTGGTTAGGCATGTGACTGCAGCCACCGTGCAAAGAACAATTCTGAAGAAATTTTCCTTACATCTGAACTCTATATCTTTGTTCTTGTCTCATCTGTCCCTGAAGTAGAGTACTGCAACCGGACTCGGGTTTACCAAGCATATTGAAGGTGGATTGTGTCGGCCTGTGTTTCTTTTGGTTTACAAAGTGTATATATATTTCAGTATTTTGGAGATTGTTAACATGAATGTCATCAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGGTATGACTGATGCCAGGATATCTAGGCCTCTTGCTCTGCCCAAGTTGTTCCTAAGGTGATTCATGACATGAACGCGTGTAAACGGTACATTTCTGTCAGGTGGATGATTATTTTAACATGATCTTCAAATGTTGTGTACACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAAGTGAGTATGGATTTCTCAGATTTCCTTCTTTCTCAGAATTGGAGTGAGGTGAATATATTTTGCAACACCATGCAGTTAGTTTCCCATGATTGCGTCTTTTATTTTAATTTTCTCGTTCATCCTGGCAAGAATTTTAATGCCAGGATCTGAATAGAACGTATTTGGGTTCATCAACTTGAGTATGTGTCATACTTATCAAATTTTATGTACATACCGATGCATTGTCTCTGAGGCCATGGCTAGTATACCAATTAGCAGAAATGTTCATCAGGTACAATGTGGAGTGCCTGGTTCATGATTGCATGTTAAATTGTTGTTCTCTCATTCATATTGGTCAGGTTCGTAAGTGCCAATAATTGATTACATTATAATTCGACTTAGCAACCTGAATATGTCCAACATCTTAACTTTTGGATGTTTATACTGAGGCGTTGTGTGGTTGTCATGGCTAGTATGCCCATTATCAGAGGGATTCGAGAGGTACAGTGTAGAGTACCGAGTTCTTGGATGTATGATGAGCTTGTACGTGTTGAGGATTATCTTCGAGCTTCATTGACATTAGAAAGATTTTTGTTATGTGTAAAGGTCTCATGTGTTCTAACTTGCGTGTGGTTGTATTGAGCAGCTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAGACTCATCATAGAACTATAACTTTGAGGGCATCGGTATCGGTATCTCGGGTCAGGGTCGTTCTGCATTACAGTTGAAGAGTAACCTGTATATACTGGACCCAGAGCATGCCAGTTTGTGAGTCATTTCTTGTGTGATTGTTTACAGTAGGAATGTTCTCTGTATAGCTAGATTTGAGCCTTCACTTCGTTGGCCCGAGAAGGCTATATTCATACGAGGTCCATATGCTTACCCACCAACGTACATTACAGTCAATATCAAGGACTTCGAGTCTCACTCTGTTGCGGTACTGTACATAGGCTTGTGAATGGAAGGTTGGATCTTGTTTTTACGATGTCTTCATTGAAGCCACGCCGATTGGACCTTCGTAGCCAACGTAGTCTCGTAGTTGTGAAACATGAACTCTTTGCTGCATCTGTCTTGTTGTTGTAAAGACTCAACAATGCTTCGGATGCTTGTTTGCCTGTTGAGTCACGGAAACTACAAGATGGATCTAGAGATACTTAAGCCACCTCCAACTATCACGCCGTACTCTCTCCCTCGTAACCCGTTAAAAGTTGTACTTATTTTTGCGATATTTCAGGCGAGTTTGCACCCTTGAGTAGAA

mRNA

>Mapoly0013s0153.4
CGCTTTACACCCTGGCCCAGGATGTAGTCGACAATCATTCAGAGCAGGATAGTTTCTCGGAAAAGTGGCTGGAGTAGTACTACATATGAAGCGCTCCTGCCACGCTGGCAGAATCTGGCAGAATCTGGTGCACCGACCTTCAGACATTCCAGTATCTGTGTGTTGACGACAGCGGGTGATGACAACAAGACTGCCCTGTTACCATGTTCGAAACTGATTCGAATCGTGGGAATTCATATTTAACTAGGTCCTCTCTTTTTTACTGGAAAAGAGCTTACGACCAATCGACAGCAGAGTGGGAGCGTGGCAGTGGGAGTGGTGGTGGTGGTCGACCGATTCCTGGAACATCGACGCTGGACCGATGCCTGGAACATCGACGCTGGACGAGACCAATTGAACCGGCCTTGGTGGCGGAATGATCGAGAGATAGGAGTTGACATCTGTGCAATGGGAAAAGCGGTGAGATCAAGTGTGGTGTTCGCTATCAACGGACGACGAGTTGAGCTCACTGACGTCGATCCACGGACGAGTGTACTGAATTACATTCGCGAGGAGACGGAATTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAACTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAGACTCATCATAGAACTATAACTTTGAGGGCATCGGTATCGGTATCTCGGGTCAGGGTCGTTCTGCATTACAGTTGAAGAGTAACCTGTATATACTGGACCCAGAGCATGCCAGTTTGTGAGTCATTTCTTGTGTGATTGTTTACAGTAGGAATGTTCTCTGTATAGCTAGATTTGAGCCTTCACTTCGTTGGCCCGAGAAGGCTATATTCATACGAGGTCCATATGCTTACCCACCAACGTACATTACAGTCAATATCAAGGACTTCGAGTCTCACTCTGTTGCGGTACTGTACATAGGCTTGTGAATGGAAGGTTGGATCTTGTTTTTACGATGTCTTCATTGAAGCCACGCCGATTGGACCTTCGTAGCCAACGTAGTCTCGTAGTTGTGAAACATGAACTCTTTGCTGCATCTGTCTTGTTGTTGTAAAGACTCAACAATGCTTCGGATGCTTGTTTGCCTGTTGAGTCACGGAAACTACAAGATGGATCTAGAGATACTTAAGCCACCTCCAACTATCACGCCGTACTCTCTCCCTCGTAACCCGTTAAAAGTTGTACTTATTTTTGCGATATTTCAGGCGAGTTTGCACCCTTGAGTAGAA

CDS

>Mapoly0013s0153.4
ATGGGAAAAGCGGTGAGATCAAGTGTGGTGTTCGCTATCAACGGACGACGAGTTGAGCTCACTGACGTCGATCCACGGACGAGTGTACTGAATTACATTCGCGAGGAGACGGAATTTAAGGGCACGAAGCGTGGTTGTGGTGAAGGTGGGTGTGGATCCTGCGTAGTGTTGCTGTCGAAGTATGACTCCAAGTCTAACAAGATCGAGGAGTACACTATCAATTCTTGCCTGGCTCCCATCTGCTCAGTTGATGGGTGTGCAATTACAACCACCGAAGGTCTTAAGAATGGAAAGGAGCCGCACGCTGTGCATACTCGACTGGCCGAGTTCCATGCCAGTCAATGTGGTTTTTGCACCCCCGGGATGGCTGTTTCCATATACTCCTGCTTGAAGAATTCTTCTAAAAAGTCATCGATGGGAGCAGAGTCAACGAAGCCTACGGTTGCCGAGGCCCAAAAGGCCATAGCTGGGAATCTATGTAGGTGCACAGGATACAGGCCAATCTTGGACGTATGCAAGAGTTTTGCTGCAGATGTGGATATTGAAGACTTGGGCGTCAATACTTTCTGGGAATCCTCTGAACTTGCCAAAGAGAGCTCTTTAAATTTGTATCAATCAGAAAAAGATCCGGAATTTCCTACCTTCCTTAAAATTCAAGCAGGAGACTATTTGGAGGTTAAAAGCGTCAGAGCCGAGGAAGTGACGGCATGGAGATCTGCCAGTACTTTATCTGAGCTGTTCACTATGTACGAGGAGGAGACAAAGGGAAAGAATCGTGATGTTAACTTTGTTGCGGGAAACACCAGCTCTGGTGTGTACAAAGACTTCAAACCCTCTGTGTACATAGACATCAACAAAATTCCAGAGCTTCATTCTGTTGTAGAAACCGATTGCACACTTGAGGTGGGGTCCGCTGTATCCCTTTCTAAGCTCATCACAATTATGGACGCTAGGGGTGGACCTGTTTACTCAGAGCTTGCGAAGCACCTCAGGAAGGTTGCGAATGAACACGTGAGGAACAGGGCAAGTGTGGGAGGAAACCTCATATTGGCTCAAAAGCGTGGGTTTGCATCAGATGTTGCTACCATTCTGCTTGGCGCTGGATCTCAGGTCACCATTGCCACTTCAAGAGATAGTTGCATAAAAGATATGGAAGAATTCCTAGCTGGAGTATCCCCTGATACGACTATTCTACAATGTATTCGCATTCCATCTTGGGCACAGTACTCCAAAGACGGCAAAGAGAAATTGTTCTTTAAGACATACAGATCGTCCCCTCGTAAAAATGGCAATGCTGTCTCATCCGTCAATGCGGCCTTCCTGGGCATCTTCCAAACGCCAGAAGTGGACAATGGTTACACTGTTGGCAAAGTGCAGCAATTGAGGTTGGCTTTTGGACACCTGGGAGCGCCTCATGCAATGCGAGCCAAGAGAACTGAGAAGTATTTGCTTCAAAAGACCGTCAATCCTGATGTACTGAAAAATGCTGTCAAGATCTTGAGAGAAGACATACTTTCTTCCGCCAAAGATGATGATCTTTATACGGCTACTTACAAAGCCAGTGTCGCTGTAAGTTACCTATTCCAGTTCTTTGAACCCTTACTTCCCAGCTCAAATTTGACCTCCTCACAGGTTGGGACCCCTTGTATGAACGGAGGTGATACTCTGAGCAATGGAAGTAAGGTTCACAGTAGAGATGTTACAGGCACTAAAAGCAAGAGCGAGGTTCACAACAAAGGTGATACATGCACAAATGGCAACAGTGAGGTTCACAACAAAGGTGATACAGACTCAAATGGCAACAGTGAGGTTCACGACAAAGGCGATACAGGCACAAATGGTGCGGCGATGAATGGCACAAACAGTGACGAGAGTGCAGTCAGGAGTTTTGGAAGAACGAGCGGAAATGGGATAGGAATCGGAGAAGGCTTTTGGGGCGCTCAGTCTTTTCCTCATTACGACGAGTTTTCCCCTCTTTCCAAACCCGCTGCCAAAGATGCAGCTGTTCTTCAGGCTTCAGGAGAGGCCGTGTACACCGGCGACATACCCTCACCACCAGGAACTTTACATGCTGCATTGGTGTACAGCAAGAAGGCACTAGCGAAAGTTAAAGCTCTGGAAGCTTCGGATGCTTTGACCTCTCCTGGTGCAACATCATTTTTTTGCGCAAAAGATTGCATAGCTGAGAACGTCTCAGTCGTCAACAACATTGCTGGATTGGAGTTTAGAGAGCCGCTTTTTGCCGAAGAAACAGTGCACTTCGTCGGAGAATGTCTCGGTGTTTTGGTCGCTGATACACACGAGCATGCTGTGCTAGCAGCAGAAAAGGTTAAGGTGGACTATGACAACAGTACGTTAGGACCACCGATTTTAAGTGTTGAGGATGCAGCTGGGATGAACTCATTCAAAATTTCACCACTGGCAGTGATGGGCACTGCTTCCGTGGGAGACGAGTTGATCAAAGGCGAATACAGGATGGAGAATATTGAGTTATTTGCAGGAAGTCAATACTATTTTTACATGGAGACACATACAGCTCTTGCTGTACCAGATGAGGATGATTGTATTACTGTATACAGCTCGAATCACAGCCCTGAGGTGCTGCACGACACTCTCTCGGCAGCTTTGGGAATTCCGATGCACAACATTCGAGTGATTACTCGAAGACTTGGAGGTTCATTTGGTGGAAAGAATACTCGGAGTTTGATTGTTGCAACTGCTTGTGCGTTGGCAGCTTTCAAACTGAAGAAGCCAGTGCGCATGACTTTGGATCGAAATACCGACATGGTGCTGAGTGGAGGCAGGCACGAATCCAAGGCCACTTATTCCGTCGAGTTCAACAAAGACGGCAAAATTACGTCCTTGGAAACAAATGTGCTGATGAACGGAGGTTATCCTGATGATTACAGGGATTTGTTGGGTTTGTTGCTGACTAAAGCTATGAAATGCTACAACTGGACCTCGTGGAGGCACGTGAGCAAAGTTTGTCGGACAAATCTACCGGCCAGAAGCATGATGCGTGCCCCTGGTGAGATCCAGGGGAATTTCTTTGCAGAGTCAATAGTGGAACATGTGGCTACATATTTGGGACTAGATCGTGACAAGGTCAGGGAGATCAACATGCACACACATGAAAGTGCCAAATTATTTTATGGTCCATCAACAACAGGCAAAGCGGAACTCTTTACGCTTCCAAAGATTGTACAAAGAACAAAAGATTTATCAAACTTCGAGTCGAGGAAACTCAATGTACATTCCTTCAATAAAAGAAGCATGTGGGTGAAAAGAGGCATTTCACTCACGCACGTAATTTATCCAAATATGCAGTCAGCCAAGGTGGCAAGGGTTAGTCTCTTTAAAGATGGGTCTGTGGCAGTCGCATCAGGAGGAACAGAGATGGGACAGGGTCTATTTACTAAAGTAAAGCAGGCTACTGCGTATGGTCTGTCTCTGCTCTGGGGCGAGAATGCTACTGGGAAAGTGGATCTGTCTAAAATCAGAATAGTGGAAAACGACAGCATAAGCTTGGCAAATGCAGGAACTACAAATGCCGGTACCACGTCAGAAGGTACTTGTGAGGCTGTTGTGAATGCATGTAAAATGCTGGTGAAGAACCTGACCCCCATTTATCTGAAGCTCAAAGCGAATGGAGGAGAATCACCACGCTGGGAAGACGTCGTTAAATTGGCCAAAGGGAGTAGAGTTGTATTGACAGCCGAAGCACGTAATGGGGAAATTGGTCCAGCAACCGAATATATGGCATGTGGTGCTTGTGCCTCAGAGGTGGAGGTTGATCTTTTGACGGGGAGCGTAAAGGTTTTACAGGCTGACCTAGTCTATGACTGTGGGAAAAGCCTCAATCCTGCTGTTGACATTGGACAGATAGAAGGGTCTTTCGTTCAAGGCATTGGTTATTATCTGACTGAACAGATAAAATGGGATGAGAATGGCGTGCTGCTAACGAATGGAACTTGGACATACAAACCACCAACCATTGACAACATTCCCCAAAAATTCAACGTCGAACTTTTGAATTCTGCAGTTGATTCTTCACGCATTCTTTCGTCTAAAACTGCCGGAGAGGCTCCTCTGGTTCTGTCAACCTCTGTACATTTGGCTGTAAGAGAAGCGATCAAATCAGCAAGGGCAGATCTACAACACCTTCCACCAGTTCCAGGGCATTGTGGTCCAGAAAACATGAAGGGTAGTACTGATCCTCTACTAATTAGGAACTCAGTGACCTCTATGGAAAACGTGAAAAGGCTCTGCGGTTTGTACAACGTGGAGCAGTACTTGGAAAAGTTGAGCATAGAATCGTCATAG

Protein

>Mapoly0013s0153.4
MGKAVRSSVVFAINGRRVELTDVDPRTSVLNYIREETEFKGTKRGCGEGGCGSCVVLLSKYDSKSNKIEEYTINSCLAPICSVDGCAITTTEGLKNGKEPHAVHTRLAEFHASQCGFCTPGMAVSIYSCLKNSSKKSSMGAESTKPTVAEAQKAIAGNLCRCTGYRPILDVCKSFAADVDIEDLGVNTFWESSELAKESSLNLYQSEKDPEFPTFLKIQAGDYLEVKSVRAEEVTAWRSASTLSELFTMYEEETKGKNRDVNFVAGNTSSGVYKDFKPSVYIDINKIPELHSVVETDCTLEVGSAVSLSKLITIMDARGGPVYSELAKHLRKVANEHVRNRASVGGNLILAQKRGFASDVATILLGAGSQVTIATSRDSCIKDMEEFLAGVSPDTTILQCIRIPSWAQYSKDGKEKLFFKTYRSSPRKNGNAVSSVNAAFLGIFQTPEVDNGYTVGKVQQLRLAFGHLGAPHAMRAKRTEKYLLQKTVNPDVLKNAVKILREDILSSAKDDDLYTATYKASVAVSYLFQFFEPLLPSSNLTSSQVGTPCMNGGDTLSNGSKVHSRDVTGTKSKSEVHNKGDTCTNGNSEVHNKGDTDSNGNSEVHDKGDTGTNGAAMNGTNSDESAVRSFGRTSGNGIGIGEGFWGAQSFPHYDEFSPLSKPAAKDAAVLQASGEAVYTGDIPSPPGTLHAALVYSKKALAKVKALEASDALTSPGATSFFCAKDCIAENVSVVNNIAGLEFREPLFAEETVHFVGECLGVLVADTHEHAVLAAEKVKVDYDNSTLGPPILSVEDAAGMNSFKISPLAVMGTASVGDELIKGEYRMENIELFAGSQYYFYMETHTALAVPDEDDCITVYSSNHSPEVLHDTLSAALGIPMHNIRVITRRLGGSFGGKNTRSLIVATACALAAFKLKKPVRMTLDRNTDMVLSGGRHESKATYSVEFNKDGKITSLETNVLMNGGYPDDYRDLLGLLLTKAMKCYNWTSWRHVSKVCRTNLPARSMMRAPGEIQGNFFAESIVEHVATYLGLDRDKVREINMHTHESAKLFYGPSTTGKAELFTLPKIVQRTKDLSNFESRKLNVHSFNKRSMWVKRGISLTHVIYPNMQSAKVARVSLFKDGSVAVASGGTEMGQGLFTKVKQATAYGLSLLWGENATGKVDLSKIRIVENDSISLANAGTTNAGTTSEGTCEAVVNACKMLVKNLTPIYLKLKANGGESPRWEDVVKLAKGSRVVLTAEARNGEIGPATEYMACGACASEVEVDLLTGSVKVLQADLVYDCGKSLNPAVDIGQIEGSFVQGIGYYLTEQIKWDENGVLLTNGTWTYKPPTIDNIPQKFNVELLNSAVDSSRILSSKTAGEAPLVLSTSVHLAVREAIKSARADLQHLPPVPGHCGPENMKGSTDPLLIRNSVTSMENVKRLCGLYNVEQYLEKLSIESS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>