Mapoly0013s0167



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_149804
PFAM PF00010 Helix-loop-helix DNA-binding domain

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH51 transcription factor, bHLH Mapoly0013s0167.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0013s0167.1 scaffold_13:1886573..1888751  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0013s0167.2 scaffold_13:1886573..1888751  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0013s0167.3 scaffold_13:1886573..1888751  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0013s0167.1  

Gene structure:

mRNA scaffold_13:1886573..1888751  ( - strand )
three_prime_UTR scaffold_13:1886573..1886966  ( - strand )
CDS scaffold_13:1886967..1887044  ( - strand )
CDS scaffold_13:1887196..1887552  ( - strand )
CDS scaffold_13:1887801..1887881  ( - strand )
five_prime_UTR scaffold_13:1887882..1887897  ( - strand )
five_prime_UTR scaffold_13:1888099..1888751  ( - strand )

Sequences:

Gene

>Mapoly0013s0167.1
CGGCAACGAACTTGCGCTCGCCCGCTCTTTCGCTCGCTCGCTCGCTCCGTCCGTCAAGCCGCGGGGGCTGGACAGCCATCGGAGGGTCTGTGTCCGTCTGCTTCCGCGATCCCTCGGGCTCGCCTTCTAGACGGTCTCTGGGCTGGATTCCATCTGGACCTCCATCGCCCGAGGTCCTCTCGCCGGCTCCGACTCGAGGCTTATATCGTAGCCTAGGTCTGAGCCATCGTCCGCAGACCAATGCGCTGCTTCGCTCGTTGCTTCAGCGGAAAAGCGCTCGTCGCTCTTGCATTCTCGAATTCTTGAATCCCTCGGACGCCCCGACGCTGCCGAGCTTGCTCGCTGCAGGAGTGCCGGAGGTGCGTCTGACTGCGGGTTCTTGGTCCTCTTTGGTAATGAGCTTTTCTTCAGGCCGTCGAGCTCGATTGTGAATTGTTGCACGCATTTTCGACGTCGAGGAATTGGAAATAATACTGTCACCTCCAGAGCGACATATTTCTCTCCGCTGCAGAAATGTGTAATTCCCATTCCCGTATATAGAGCGATTGCTTTGGACTCACCCGTCTGCGAAATCTGCACTGTTTACTCCGACGTTGACGGTCGGACATTTTAAATCATCAACAGCGACGAGTGGGCGCAAGGGACTGAATCAGGTGAGTTCAGTTGCAGTGCACGTACTTGCAGAATGAGCCCGCCTCTTGCGTTTGTTTGGCTTGGACCCGCATGTCGCCGTATCCTTTCAGAGCTGAATTTGGTTCAATTCAACTAACTACCACAGATGTCTAATGCCTGCTTGACAAAGTGAAGTCCTTTACTGGAACTAAGCGACGCATACAAATTACCAATGGATGCAGCCTCAGATTCTCAAATATGTATGCAGAACGTAGACGAAGAAATAGGCAGAACGAAAGCTTTGAGCGGATTAGAGGAATTGTTCCATCTGCATTGAAGGTAATAGAGATTAGTCTAACAGAAATCGTTCAGCTAACATGCAGCATATGAAGCTCCACATATGAAATATTCTCGCATGAATCAATGGCAGCTGTTGAGATTACTTATCATTTGTTGCCATCTGACTGCTCGCGGATGAAGTTCTTCTTGTGTTTGTTATTGTCTTGAAAATTCATGTTTCTTATTTTCCGAGGGAGTACAGAAAGGGTACGAATCTGACTCCTGTTTAATTCGTGTGGTCGGGACAGATGGACAAAATAACTCTTCTCGGAGAAACAGTTGAGTACATAAAGAGCCTCAAACAACGCTTGAAGCAGCTTGAGGAGATCAATATGGCACTGAGCTCAAGTGGTCAGGACGCAGGGTCTTTTAAGTGTGAGGATATCAAGGTCATACCCTCTAGAACTCATTCTCCCACTCAGGATATGACTCAGGCCACACCTGAGGACGAAGATACCTTGAAAATTGAAGTGGTTCGGAACGACTGCAGTCAGGAAGACACAGCCATCGACATATTTACCTGTCTCAGGGATTTAGAGTTAACTGTGACACACGCTTCAGTGTCGACAAATGTTTATAGGATCCATGCAACAATCAAAGTGAAGGTAAGAATTTTTTTTACAATCTCAGGAACTCAATACATGCTAAGTGGGACTATTTGAATTGAGCTATGCATACAGTAAACCTGCCAAGTGAACTGCAGTGGTTTATCTATTTTTTAAATCACACGACTTAATCCGACTGAAATTCTGCCAGATGCCAAAACAGAGCTCCAACGATCAATTTGCAGTGTGTTCGGAAATAGAGGAAGCCCTTCGAAGATGCCTTCGATAATGGACTGAAAAGTTCTCGGTGGATAATCTTGGCTACAGCTGAAGACTTGGTAGCCTTCCAACTGGTCATCCATCGAACAAAAGAGTCATGTATATAACAAATTCATACACTCAGTGTGAAATGACTTGTCCAGATATTCGTCTCCCACTCCATTCAGAAAAGAAGGAGAATGTAAACCACAATGGTTACTGATTTTTTGCCACCAAAGTCCGTGCAGAAGATTGCTGATGATACGGCAGGCCTCGCGATGACAGATAGATTTTAGACGCAAGTCTTTTGGGAACAATTGACCTGTACTTTTTCTAGGAATATTGTACTGCGATTCTAAGAACTTTTTTGCAGCTGTAACATTTTTAGAATCTGAGAATAAAACACGAAGATTCGTATCAAGCCG

mRNA

>Mapoly0013s0167.1
CGGCAACGAACTTGCGCTCGCCCGCTCTTTCGCTCGCTCGCTCGCTCCGTCCGTCAAGCCGCGGGGGCTGGACAGCCATCGGAGGGTCTGTGTCCGTCTGCTTCCGCGATCCCTCGGGCTCGCCTTCTAGACGGTCTCTGGGCTGGATTCCATCTGGACCTCCATCGCCCGAGGTCCTCTCGCCGGCTCCGACTCGAGGCTTATATCGTAGCCTAGGTCTGAGCCATCGTCCGCAGACCAATGCGCTGCTTCGCTCGTTGCTTCAGCGGAAAAGCGCTCGTCGCTCTTGCATTCTCGAATTCTTGAATCCCTCGGACGCCCCGACGCTGCCGAGCTTGCTCGCTGCAGGAGTGCCGGAGGTGCGTCTGACTGCGGGTTCTTGGTCCTCTTTGGTAATGAGCTTTTCTTCAGGCCGTCGAGCTCGATTGTGAATTGTTGCACGCATTTTCGACGTCGAGGAATTGGAAATAATACTGTCACCTCCAGAGCGACATATTTCTCTCCGCTGCAGAAATGTGTAATTCCCATTCCCGTATATAGAGCGATTGCTTTGGACTCACCCGTCTGCGAAATCTGCACTGTTTACTCCGACGTTGACGGTCGGACATTTTAAATCATCAACAGCGACGAGTGGGCGCAAGGGACTGAATCAGCCTCAGATTCTCAAATATGTATGCAGAACGTAGACGAAGAAATAGGCAGAACGAAAGCTTTGAGCGGATTAGAGGAATTGTTCCATCTGCATTGAAGATGGACAAAATAACTCTTCTCGGAGAAACAGTTGAGTACATAAAGAGCCTCAAACAACGCTTGAAGCAGCTTGAGGAGATCAATATGGCACTGAGCTCAAGTGGTCAGGACGCAGGGTCTTTTAAGTGTGAGGATATCAAGGTCATACCCTCTAGAACTCATTCTCCCACTCAGGATATGACTCAGGCCACACCTGAGGACGAAGATACCTTGAAAATTGAAGTGGTTCGGAACGACTGCAGTCAGGAAGACACAGCCATCGACATATTTACCTGTCTCAGGGATTTAGAGTTAACTGTGACACACGCTTCAGTGTCGACAAATGTTTATAGGATCCATGCAACAATCAAAGTGAAGATGCCAAAACAGAGCTCCAACGATCAATTTGCAGTGTGTTCGGAAATAGAGGAAGCCCTTCGAAGATGCCTTCGATAATGGACTGAAAAGTTCTCGGTGGATAATCTTGGCTACAGCTGAAGACTTGGTAGCCTTCCAACTGGTCATCCATCGAACAAAAGAGTCATGTATATAACAAATTCATACACTCAGTGTGAAATGACTTGTCCAGATATTCGTCTCCCACTCCATTCAGAAAAGAAGGAGAATGTAAACCACAATGGTTACTGATTTTTTGCCACCAAAGTCCGTGCAGAAGATTGCTGATGATACGGCAGGCCTCGCGATGACAGATAGATTTTAGACGCAAGTCTTTTGGGAACAATTGACCTGTACTTTTTCTAGGAATATTGTACTGCGATTCTAAGAACTTTTTTGCAGCTGTAACATTTTTAGAATCTGAGAATAAAACACGAAGATTCGTATCAAGCCG

CDS

>Mapoly0013s0167.1
ATGTATGCAGAACGTAGACGAAGAAATAGGCAGAACGAAAGCTTTGAGCGGATTAGAGGAATTGTTCCATCTGCATTGAAGATGGACAAAATAACTCTTCTCGGAGAAACAGTTGAGTACATAAAGAGCCTCAAACAACGCTTGAAGCAGCTTGAGGAGATCAATATGGCACTGAGCTCAAGTGGTCAGGACGCAGGGTCTTTTAAGTGTGAGGATATCAAGGTCATACCCTCTAGAACTCATTCTCCCACTCAGGATATGACTCAGGCCACACCTGAGGACGAAGATACCTTGAAAATTGAAGTGGTTCGGAACGACTGCAGTCAGGAAGACACAGCCATCGACATATTTACCTGTCTCAGGGATTTAGAGTTAACTGTGACACACGCTTCAGTGTCGACAAATGTTTATAGGATCCATGCAACAATCAAAGTGAAGATGCCAAAACAGAGCTCCAACGATCAATTTGCAGTGTGTTCGGAAATAGAGGAAGCCCTTCGAAGATGCCTTCGATAA

Protein

>Mapoly0013s0167.1
MYAERRRRNRQNESFERIRGIVPSALKMDKITLLGETVEYIKSLKQRLKQLEEINMALSSSGQDAGSFKCEDIKVIPSRTHSPTQDMTQATPEDEDTLKIEVVRNDCSQEDTAIDIFTCLRDLELTVTHASVSTNVYRIHATIKVKMPKQSSNDQFAVCSEIEEALRRCLR

Mapoly0013s0167.2  

Gene structure:

mRNA scaffold_13:1886573..1888751  ( - strand )
three_prime_UTR scaffold_13:1886573..1886966  ( - strand )
CDS scaffold_13:1886967..1887044  ( - strand )
CDS scaffold_13:1887196..1887552  ( - strand )
five_prime_UTR scaffold_13:1887801..1887871  ( - strand )
five_prime_UTR scaffold_13:1888099..1888751  ( - strand )

Sequences:

Gene

>Mapoly0013s0167.2
CGGCAACGAACTTGCGCTCGCCCGCTCTTTCGCTCGCTCGCTCGCTCCGTCCGTCAAGCCGCGGGGGCTGGACAGCCATCGGAGGGTCTGTGTCCGTCTGCTTCCGCGATCCCTCGGGCTCGCCTTCTAGACGGTCTCTGGGCTGGATTCCATCTGGACCTCCATCGCCCGAGGTCCTCTCGCCGGCTCCGACTCGAGGCTTATATCGTAGCCTAGGTCTGAGCCATCGTCCGCAGACCAATGCGCTGCTTCGCTCGTTGCTTCAGCGGAAAAGCGCTCGTCGCTCTTGCATTCTCGAATTCTTGAATCCCTCGGACGCCCCGACGCTGCCGAGCTTGCTCGCTGCAGGAGTGCCGGAGGTGCGTCTGACTGCGGGTTCTTGGTCCTCTTTGGTAATGAGCTTTTCTTCAGGCCGTCGAGCTCGATTGTGAATTGTTGCACGCATTTTCGACGTCGAGGAATTGGAAATAATACTGTCACCTCCAGAGCGACATATTTCTCTCCGCTGCAGAAATGTGTAATTCCCATTCCCGTATATAGAGCGATTGCTTTGGACTCACCCGTCTGCGAAATCTGCACTGTTTACTCCGACGTTGACGGTCGGACATTTTAAATCATCAACAGCGACGAGTGGGCGCAAGGGACTGAATCAGGTGAGTTCAGTTGCAGTGCACGTACTTGCAGAATGAGCCCGCCTCTTGCGTTTGTTTGGCTTGGACCCGCATGTCGCCGTATCCTTTCAGAGCTGAATTTGGTTCAATTCAACTAACTACCACAGATGTCTAATGCCTGCTTGACAAAGTGAAGTCCTTTACTGGAACTAAGCGACGCATACAAATTACCAATGGATGCAGCCTCAGATTCTCAAATATGTATGCAGAACGTAGACGAAGAAATAGGCAGAACGAAAGCTTTGAGCGGATTAGAGGAATTGTTCCATCTGCATTGAAGGTAATAGAGATTAGTCTAACAGAAATCGTTCAGCTAACATGCAGCATATGAAGCTCCACATATGAAATATTCTCGCATGAATCAATGGCAGCTGTTGAGATTACTTATCATTTGTTGCCATCTGACTGCTCGCGGATGAAGTTCTTCTTGTGTTTGTTATTGTCTTGAAAATTCATGTTTCTTATTTTCCGAGGGAGTACAGAAAGGGTACGAATCTGACTCCTGTTTAATTCGTGTGGTCGGGACAGATGGACAAAATAACTCTTCTCGGAGAAACAGTTGAGTACATAAAGAGCCTCAAACAACGCTTGAAGCAGCTTGAGGAGATCAATATGGCACTGAGCTCAAGTGGTCAGGACGCAGGGTCTTTTAAGTGTGAGGATATCAAGGTCATACCCTCTAGAACTCATTCTCCCACTCAGGATATGACTCAGGCCACACCTGAGGACGAAGATACCTTGAAAATTGAAGTGGTTCGGAACGACTGCAGTCAGGAAGACACAGCCATCGACATATTTACCTGTCTCAGGGATTTAGAGTTAACTGTGACACACGCTTCAGTGTCGACAAATGTTTATAGGATCCATGCAACAATCAAAGTGAAGGTAAGAATTTTTTTTACAATCTCAGGAACTCAATACATGCTAAGTGGGACTATTTGAATTGAGCTATGCATACAGTAAACCTGCCAAGTGAACTGCAGTGGTTTATCTATTTTTTAAATCACACGACTTAATCCGACTGAAATTCTGCCAGATGCCAAAACAGAGCTCCAACGATCAATTTGCAGTGTGTTCGGAAATAGAGGAAGCCCTTCGAAGATGCCTTCGATAATGGACTGAAAAGTTCTCGGTGGATAATCTTGGCTACAGCTGAAGACTTGGTAGCCTTCCAACTGGTCATCCATCGAACAAAAGAGTCATGTATATAACAAATTCATACACTCAGTGTGAAATGACTTGTCCAGATATTCGTCTCCCACTCCATTCAGAAAAGAAGGAGAATGTAAACCACAATGGTTACTGATTTTTTGCCACCAAAGTCCGTGCAGAAGATTGCTGATGATACGGCAGGCCTCGCGATGACAGATAGATTTTAGACGCAAGTCTTTTGGGAACAATTGACCTGTACTTTTTCTAGGAATATTGTACTGCGATTCTAAGAACTTTTTTGCAGCTGTAACATTTTTAGAATCTGAGAATAAAACACGAAGATTCGTATCAAGCCG

mRNA

>Mapoly0013s0167.2
CGGCAACGAACTTGCGCTCGCCCGCTCTTTCGCTCGCTCGCTCGCTCCGTCCGTCAAGCCGCGGGGGCTGGACAGCCATCGGAGGGTCTGTGTCCGTCTGCTTCCGCGATCCCTCGGGCTCGCCTTCTAGACGGTCTCTGGGCTGGATTCCATCTGGACCTCCATCGCCCGAGGTCCTCTCGCCGGCTCCGACTCGAGGCTTATATCGTAGCCTAGGTCTGAGCCATCGTCCGCAGACCAATGCGCTGCTTCGCTCGTTGCTTCAGCGGAAAAGCGCTCGTCGCTCTTGCATTCTCGAATTCTTGAATCCCTCGGACGCCCCGACGCTGCCGAGCTTGCTCGCTGCAGGAGTGCCGGAGGTGCGTCTGACTGCGGGTTCTTGGTCCTCTTTGGTAATGAGCTTTTCTTCAGGCCGTCGAGCTCGATTGTGAATTGTTGCACGCATTTTCGACGTCGAGGAATTGGAAATAATACTGTCACCTCCAGAGCGACATATTTCTCTCCGCTGCAGAAATGTGTAATTCCCATTCCCGTATATAGAGCGATTGCTTTGGACTCACCCGTCTGCGAAATCTGCACTGTTTACTCCGACGTTGACGGTCGGACATTTTAAATCATCAACAGCGACGAGTGGGCGCAAGGGACTGAATCAGAACGTAGACGAAGAAATAGGCAGAACGAAAGCTTTGAGCGGATTAGAGGAATTGTTCCATCTGCATTGAAGATGGACAAAATAACTCTTCTCGGAGAAACAGTTGAGTACATAAAGAGCCTCAAACAACGCTTGAAGCAGCTTGAGGAGATCAATATGGCACTGAGCTCAAGTGGTCAGGACGCAGGGTCTTTTAAGTGTGAGGATATCAAGGTCATACCCTCTAGAACTCATTCTCCCACTCAGGATATGACTCAGGCCACACCTGAGGACGAAGATACCTTGAAAATTGAAGTGGTTCGGAACGACTGCAGTCAGGAAGACACAGCCATCGACATATTTACCTGTCTCAGGGATTTAGAGTTAACTGTGACACACGCTTCAGTGTCGACAAATGTTTATAGGATCCATGCAACAATCAAAGTGAAGATGCCAAAACAGAGCTCCAACGATCAATTTGCAGTGTGTTCGGAAATAGAGGAAGCCCTTCGAAGATGCCTTCGATAATGGACTGAAAAGTTCTCGGTGGATAATCTTGGCTACAGCTGAAGACTTGGTAGCCTTCCAACTGGTCATCCATCGAACAAAAGAGTCATGTATATAACAAATTCATACACTCAGTGTGAAATGACTTGTCCAGATATTCGTCTCCCACTCCATTCAGAAAAGAAGGAGAATGTAAACCACAATGGTTACTGATTTTTTGCCACCAAAGTCCGTGCAGAAGATTGCTGATGATACGGCAGGCCTCGCGATGACAGATAGATTTTAGACGCAAGTCTTTTGGGAACAATTGACCTGTACTTTTTCTAGGAATATTGTACTGCGATTCTAAGAACTTTTTTGCAGCTGTAACATTTTTAGAATCTGAGAATAAAACACGAAGATTCGTATCAAGCCG

CDS

>Mapoly0013s0167.2
ATGGACAAAATAACTCTTCTCGGAGAAACAGTTGAGTACATAAAGAGCCTCAAACAACGCTTGAAGCAGCTTGAGGAGATCAATATGGCACTGAGCTCAAGTGGTCAGGACGCAGGGTCTTTTAAGTGTGAGGATATCAAGGTCATACCCTCTAGAACTCATTCTCCCACTCAGGATATGACTCAGGCCACACCTGAGGACGAAGATACCTTGAAAATTGAAGTGGTTCGGAACGACTGCAGTCAGGAAGACACAGCCATCGACATATTTACCTGTCTCAGGGATTTAGAGTTAACTGTGACACACGCTTCAGTGTCGACAAATGTTTATAGGATCCATGCAACAATCAAAGTGAAGATGCCAAAACAGAGCTCCAACGATCAATTTGCAGTGTGTTCGGAAATAGAGGAAGCCCTTCGAAGATGCCTTCGATAA

Protein

>Mapoly0013s0167.2
MDKITLLGETVEYIKSLKQRLKQLEEINMALSSSGQDAGSFKCEDIKVIPSRTHSPTQDMTQATPEDEDTLKIEVVRNDCSQEDTAIDIFTCLRDLELTVTHASVSTNVYRIHATIKVKMPKQSSNDQFAVCSEIEEALRRCLR

Mapoly0013s0167.3  

Gene structure:

mRNA scaffold_13:1886573..1888751  ( - strand )
three_prime_UTR scaffold_13:1886573..1886966  ( - strand )
CDS scaffold_13:1886967..1887044  ( - strand )
CDS scaffold_13:1887196..1887552  ( - strand )
five_prime_UTR scaffold_13:1888099..1888751  ( - strand )

Sequences:

Gene

>Mapoly0013s0167.3
CGGCAACGAACTTGCGCTCGCCCGCTCTTTCGCTCGCTCGCTCGCTCCGTCCGTCAAGCCGCGGGGGCTGGACAGCCATCGGAGGGTCTGTGTCCGTCTGCTTCCGCGATCCCTCGGGCTCGCCTTCTAGACGGTCTCTGGGCTGGATTCCATCTGGACCTCCATCGCCCGAGGTCCTCTCGCCGGCTCCGACTCGAGGCTTATATCGTAGCCTAGGTCTGAGCCATCGTCCGCAGACCAATGCGCTGCTTCGCTCGTTGCTTCAGCGGAAAAGCGCTCGTCGCTCTTGCATTCTCGAATTCTTGAATCCCTCGGACGCCCCGACGCTGCCGAGCTTGCTCGCTGCAGGAGTGCCGGAGGTGCGTCTGACTGCGGGTTCTTGGTCCTCTTTGGTAATGAGCTTTTCTTCAGGCCGTCGAGCTCGATTGTGAATTGTTGCACGCATTTTCGACGTCGAGGAATTGGAAATAATACTGTCACCTCCAGAGCGACATATTTCTCTCCGCTGCAGAAATGTGTAATTCCCATTCCCGTATATAGAGCGATTGCTTTGGACTCACCCGTCTGCGAAATCTGCACTGTTTACTCCGACGTTGACGGTCGGACATTTTAAATCATCAACAGCGACGAGTGGGCGCAAGGGACTGAATCAGGTGAGTTCAGTTGCAGTGCACGTACTTGCAGAATGAGCCCGCCTCTTGCGTTTGTTTGGCTTGGACCCGCATGTCGCCGTATCCTTTCAGAGCTGAATTTGGTTCAATTCAACTAACTACCACAGATGTCTAATGCCTGCTTGACAAAGTGAAGTCCTTTACTGGAACTAAGCGACGCATACAAATTACCAATGGATGCAGCCTCAGATTCTCAAATATGTATGCAGAACGTAGACGAAGAAATAGGCAGAACGAAAGCTTTGAGCGGATTAGAGGAATTGTTCCATCTGCATTGAAGGTAATAGAGATTAGTCTAACAGAAATCGTTCAGCTAACATGCAGCATATGAAGCTCCACATATGAAATATTCTCGCATGAATCAATGGCAGCTGTTGAGATTACTTATCATTTGTTGCCATCTGACTGCTCGCGGATGAAGTTCTTCTTGTGTTTGTTATTGTCTTGAAAATTCATGTTTCTTATTTTCCGAGGGAGTACAGAAAGGGTACGAATCTGACTCCTGTTTAATTCGTGTGGTCGGGACAGATGGACAAAATAACTCTTCTCGGAGAAACAGTTGAGTACATAAAGAGCCTCAAACAACGCTTGAAGCAGCTTGAGGAGATCAATATGGCACTGAGCTCAAGTGGTCAGGACGCAGGGTCTTTTAAGTGTGAGGATATCAAGGTCATACCCTCTAGAACTCATTCTCCCACTCAGGATATGACTCAGGCCACACCTGAGGACGAAGATACCTTGAAAATTGAAGTGGTTCGGAACGACTGCAGTCAGGAAGACACAGCCATCGACATATTTACCTGTCTCAGGGATTTAGAGTTAACTGTGACACACGCTTCAGTGTCGACAAATGTTTATAGGATCCATGCAACAATCAAAGTGAAGGTAAGAATTTTTTTTACAATCTCAGGAACTCAATACATGCTAAGTGGGACTATTTGAATTGAGCTATGCATACAGTAAACCTGCCAAGTGAACTGCAGTGGTTTATCTATTTTTTAAATCACACGACTTAATCCGACTGAAATTCTGCCAGATGCCAAAACAGAGCTCCAACGATCAATTTGCAGTGTGTTCGGAAATAGAGGAAGCCCTTCGAAGATGCCTTCGATAATGGACTGAAAAGTTCTCGGTGGATAATCTTGGCTACAGCTGAAGACTTGGTAGCCTTCCAACTGGTCATCCATCGAACAAAAGAGTCATGTATATAACAAATTCATACACTCAGTGTGAAATGACTTGTCCAGATATTCGTCTCCCACTCCATTCAGAAAAGAAGGAGAATGTAAACCACAATGGTTACTGATTTTTTGCCACCAAAGTCCGTGCAGAAGATTGCTGATGATACGGCAGGCCTCGCGATGACAGATAGATTTTAGACGCAAGTCTTTTGGGAACAATTGACCTGTACTTTTTCTAGGAATATTGTACTGCGATTCTAAGAACTTTTTTGCAGCTGTAACATTTTTAGAATCTGAGAATAAAACACGAAGATTCGTATCAAGCCG

mRNA

>Mapoly0013s0167.3
CGGCAACGAACTTGCGCTCGCCCGCTCTTTCGCTCGCTCGCTCGCTCCGTCCGTCAAGCCGCGGGGGCTGGACAGCCATCGGAGGGTCTGTGTCCGTCTGCTTCCGCGATCCCTCGGGCTCGCCTTCTAGACGGTCTCTGGGCTGGATTCCATCTGGACCTCCATCGCCCGAGGTCCTCTCGCCGGCTCCGACTCGAGGCTTATATCGTAGCCTAGGTCTGAGCCATCGTCCGCAGACCAATGCGCTGCTTCGCTCGTTGCTTCAGCGGAAAAGCGCTCGTCGCTCTTGCATTCTCGAATTCTTGAATCCCTCGGACGCCCCGACGCTGCCGAGCTTGCTCGCTGCAGGAGTGCCGGAGGTGCGTCTGACTGCGGGTTCTTGGTCCTCTTTGGTAATGAGCTTTTCTTCAGGCCGTCGAGCTCGATTGTGAATTGTTGCACGCATTTTCGACGTCGAGGAATTGGAAATAATACTGTCACCTCCAGAGCGACATATTTCTCTCCGCTGCAGAAATGTGTAATTCCCATTCCCGTATATAGAGCGATTGCTTTGGACTCACCCGTCTGCGAAATCTGCACTGTTTACTCCGACGTTGACGGTCGGACATTTTAAATCATCAACAGCGACGAGTGGGCGCAAGGGACTGAATCAGATGGACAAAATAACTCTTCTCGGAGAAACAGTTGAGTACATAAAGAGCCTCAAACAACGCTTGAAGCAGCTTGAGGAGATCAATATGGCACTGAGCTCAAGTGGTCAGGACGCAGGGTCTTTTAAGTGTGAGGATATCAAGGTCATACCCTCTAGAACTCATTCTCCCACTCAGGATATGACTCAGGCCACACCTGAGGACGAAGATACCTTGAAAATTGAAGTGGTTCGGAACGACTGCAGTCAGGAAGACACAGCCATCGACATATTTACCTGTCTCAGGGATTTAGAGTTAACTGTGACACACGCTTCAGTGTCGACAAATGTTTATAGGATCCATGCAACAATCAAAGTGAAGATGCCAAAACAGAGCTCCAACGATCAATTTGCAGTGTGTTCGGAAATAGAGGAAGCCCTTCGAAGATGCCTTCGATAATGGACTGAAAAGTTCTCGGTGGATAATCTTGGCTACAGCTGAAGACTTGGTAGCCTTCCAACTGGTCATCCATCGAACAAAAGAGTCATGTATATAACAAATTCATACACTCAGTGTGAAATGACTTGTCCAGATATTCGTCTCCCACTCCATTCAGAAAAGAAGGAGAATGTAAACCACAATGGTTACTGATTTTTTGCCACCAAAGTCCGTGCAGAAGATTGCTGATGATACGGCAGGCCTCGCGATGACAGATAGATTTTAGACGCAAGTCTTTTGGGAACAATTGACCTGTACTTTTTCTAGGAATATTGTACTGCGATTCTAAGAACTTTTTTGCAGCTGTAACATTTTTAGAATCTGAGAATAAAACACGAAGATTCGTATCAAGCCG

CDS

>Mapoly0013s0167.3
ATGGACAAAATAACTCTTCTCGGAGAAACAGTTGAGTACATAAAGAGCCTCAAACAACGCTTGAAGCAGCTTGAGGAGATCAATATGGCACTGAGCTCAAGTGGTCAGGACGCAGGGTCTTTTAAGTGTGAGGATATCAAGGTCATACCCTCTAGAACTCATTCTCCCACTCAGGATATGACTCAGGCCACACCTGAGGACGAAGATACCTTGAAAATTGAAGTGGTTCGGAACGACTGCAGTCAGGAAGACACAGCCATCGACATATTTACCTGTCTCAGGGATTTAGAGTTAACTGTGACACACGCTTCAGTGTCGACAAATGTTTATAGGATCCATGCAACAATCAAAGTGAAGATGCCAAAACAGAGCTCCAACGATCAATTTGCAGTGTGTTCGGAAATAGAGGAAGCCCTTCGAAGATGCCTTCGATAA

Protein

>Mapoly0013s0167.3
MDKITLLGETVEYIKSLKQRLKQLEEINMALSSSGQDAGSFKCEDIKVIPSRTHSPTQDMTQATPEDEDTLKIEVVRNDCSQEDTAIDIFTCLRDLELTVTHASVSTNVYRIHATIKVKMPKQSSNDQFAVCSEIEEALRRCLR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>