Mapoly0014s0193



Description

TELOMERIC REPEAT BINDING PROTEIN

Reference DB

Database ID Description
GO GO:0003682 Chromatin binding
PFAM PF00249 Myb-like DNA-binding domain
PANTHER PTHR21717 TELOMERIC REPEAT BINDING PROTEIN
PANTHER PTHR21717:SF16

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB6 transcription factor, MYB Mapoly0014s0193.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0014s0193.1 scaffold_14:1853340..1860383  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0014s0193.1  

Gene structure:

mRNA scaffold_14:1853340..1860383  ( + strand )
five_prime_UTR scaffold_14:1853340..1853494  ( + strand )
CDS scaffold_14:1853495..1853547  ( + strand )
CDS scaffold_14:1854861..1855053  ( + strand )
CDS scaffold_14:1855585..1855671  ( + strand )
CDS scaffold_14:1856019..1856123  ( + strand )
CDS scaffold_14:1857356..1857682  ( + strand )
CDS scaffold_14:1858930..1860144  ( + strand )
three_prime_UTR scaffold_14:1860145..1860383  ( + strand )

Sequences:

Gene

>Mapoly0014s0193.1
GGAAGCGTCGACTTCGACCTGGTGCCGACGAGACAGAGCTGCAGCTGATGGGATTTGATTCGAAGTGAAGTGACATTGAGGGCGACGAGATCGACCGCCAGGCAGCGCATCGGATCCATTCCTTCGGCAGCTCAGAGTGGACAGCCAGTGATTTAATGGGAAAGAAAGGGACTCTATGCGAGTCGGAAATCGGGCAGATACTACGAAGGTTGGCATTTCCCCTCCACTCTTGTCTTTGATCGTGATTGGTGAAATTGGAGATTGAGAAAATCTGGAGCGTTTGTTCACGTGTTTCATGCGTCATTTGCAGCTGGCCAGCTGCAAATGACGCACGTCTTTCTCGGGTTTTTCCAGATTGCACTTCAATTCTCTTATTTTCTCACGAATTTTGACTCTGCCACAAGGTGTGCTGATTCTGATATTAATCCATGATCGTCGTTTGGTTGCATCCGGGTAGCTGGCATACCGTCGAGAGTTCTGTAAACCGCACCACGCGGCACTCATTCATACTTGCCACTTGTACCAGGGTTCGATCAAAATCCCTTAAGACTCCTTTTCTTGCTACACCTTACGAGTAGAGGCAAAACTCGAAGAAAAAATTTGCGACTGTTTTCCGAATTTGTATCATGGACGATTCTTTTGTTAATCGCTCTGCCGGGCAAAATCCCGTCGTGCATCGACAAATATTGGCTCTCTTGCAAATAATGTACCGGCTGAATGCTGTCCCTTTTAAGAGTAAACCGACCTTTCAAGCGAGATTAATCAACATCGTTCGTATGCGTAGAATTTATACCTACCGAAGTCTGCATTCATGGTAAGAGGAACCTTACATTTTTTGGGATAGCCTTGTGGCAGTGAAGAGCCTCAAACGTATTTCAAGGCAGACCTCTTACCAGCGCATTTCTGGTAGTAATGAGGGCAACCAAATAAATCTGTAATGCTCAAACTTCGTGGACTGCGGACTGGTGGCTCCGTACTCTTTTTCACATTAGTAACAACTTGGTACTCTGGAGCTTCTACTTGCCTTACAGAAGCTACTGGTTTTCTTTCTTCCTTTCTCTTTTCTCCAATGCTCGATGGACCTTTGTGTTGCAGCCACGAATAATTCCTGCTCGCCGACTTCATTTCCGTTGAGCATATATTCCTGGCGCTGCAGACATTTCTGTATGCTCAGATGTAGTACTGTGATTCACGTCACTATCTGCTCTATAACTCCCCTCGTAAGATTAATATTGAGTCCATGATACCATGGTATACTGGTTGTGTTACTTCAGTCTATTTTGAGGTAGCCAGATGATTAGTACGCATAATTTGCGTACATACTTAGCCGTGATTGCCGCCTGGATTATATCTCGTTCATGTTATTACCGAAGCAAGCACATGTTGTGAAATTTTCGTTTGCTGTGTTTTGTGCTGTATAATTTAGACTTTACACTACTTTTCAGCACCCCTATCGGTTATTTTTCCTTCGTTCTTCTACACGTGTTTTCGAGTTCCTTACTCGTGCATTCTTCATTGCAGATATAGTGCTGTGACAGTCATGGGACTTATTCGCGAGATTGCGAGGTGTGAAAGTTCGAAGCTCGACTTCAATGCTCTTGTGAAGAAGTCTAGTACCGGTATAAGTTGTGCTCGCGAATATCAAGCTTTGTGGAGGCACATCGCGTACCGTGCAGAATTGGACGATGCCTATGAAGAAGATGCCGAACTCCTGGTTTGTCTTCATTTTCTTGGATAACATTTTCGCTTGTAATCGGTTCGAGTTCATATGGAAAAGCTTGATTGCGAGGGACGGCTCAGGTGTGTTTTACGTCAGTCCCAGACGCTCGGTTTTGGCACATGTACTTGGATAGCTAATTCTTGATGTTAGCCGGAGGAGTGAAGTAAGTGAAGTCAGGTGTATCCTCTGCCGGGACATGTAGTTGCCATTTTGAAAGTACCCACCAGCAACGGTCTCGGGGTTTTACAGTTTCCATGTTATGGCAGGCAGATAGACTGAGAAAATTTGAAAGGAACACGGTCTTCACATGTGCTTCCTGCGTAACGCATAATCAGTCTAGTGGTCGTTTCACATTAAAATGGAGATCCAAGTCAGAGTGTTGTTCTAGAGCTACTTAGTGCACACTGTTATCAAAGTTTTTGACCATATTTAGCTCTCTTATAGGTCCTCACTCAGCTTTTGTTTGAGTAGACAGTCAAAGTTTGGTTGTCTCCTGATTAATTTCTGTTTTGAATACATTTTCAGGAGGATGACAGTGATCTCGAGTTTGAGCTCGAACCTGCGCCAAGTGTCAGTCCAGAGGTTGCTGCTGAAGCTGCGAACTGGGTGAAGGTATTCTCTTGTCGGCCTTAAATGTACAGAGCACACTCTAAGTCACTTGTCTTTAAGGAGATTGTGTTGTGCGTGGTGATACAAGGTTTCCAATCTTGTAATTGTTATATCGCTTAAGCTCTTTTTTGCGATTGTGGTCGAGTGCAGATGCGTATTGTGCTTTTAAGTTTGTGGTAATCATTTTGATCAATTCCAAGATTTTATCAATTCCTGTGTGCAGCTAGCGATTTAGTAAACTTCTCTCTGTATTCTATTGCTACATCTGGGTGTGAGATTCTTAGAGCAATTGATGGCCGACATTCGTCACACAGTAGTAGAAGCACTGATAATGTATTGTCGATATTCAGGCAGACATGCAACGCTTTGGAATCGTTGCACCTAAGAGGAAGGGGGACCTTCTTACAAAATTAAAAAGTAGAGACGCAGATTCCGCATCAACGGTTGGAAATCAGGTAGGCAACAGCCTGTATTCCTCTACTCTTGTACGGTGTAACTATGTATAGGCGTAGGGTCAGAACATCAATCTCTGTGCATGCTTCGTGTACATTTTTTTTTATGAACGTGTTCTCGGCCTACTTTTTTCTTCTGTTTCTTCACTTTACATGCGTTCTCTTTTCTATCTTACTCATTTGCTCTCCATTAATTGTACGCATTGTTCTCATGACATAATTCTCGTTCATTTCTCCTTTCTTGCTGCTTAGTTTCGCTGCATGGTGCTCAGCGTGTCTGTCATCATTGTTCTTTCGTACGTTTCACCTCGCGTTTTTGCTCAAATTGTTCAAATCTTCCGAGATGGCCTCATCGCAATCTTCTGTCCTCTTCTGGGATCGATACTTTTCCTTGTATGGTAAACAGTTATCACTAGGTGGGGTCATGGTGCCTCGACTTAGATGATCTCTTTCTAATAAATAGCCATGCAGACGACAATATATTCTTTGCTCAATAATGACTAATTTGATATGTATCATTTCCAGGTTGGAATGAATCAAAATATTCTAAGCCTTGCACTGGCAAATCATATACACATCGTGTGTCCTAGTGAGTCAGGAATAGTTGTTGCCCATATACTCTCTTATTCTTCCTATCCTGGATAAGGGTAAACCCTACAGCTCACTCGATTTCTATTCACAATACCACCTCATTGTAGGCCGGTCATAGCCAGTACTTTTCGCATCTAGCTAATTTAGTCTGTCTCTGAGTAATACATCTTTTAATGCTTTATAGTACACCTGGACAAGTTGTAGAAGTTGGCCGAGCTAGTTGTCTGTCATCGTCACTATGCATCGCGAGAACTGCGGTATGCTTGCACAGAGTTGTTTAGTTTATCAAGGTTTATATCTATGCTCTCCTGGTCAAAGACAACATACCGTGCTTTTCACGTAGTAGAATTTTCAAGTAGGTATAATCAGCTAGCACCAAACCTTCGATGTTGAGAAGCAGCGAACGAGATACACGGCTATTGGTCTTATCGATCTCAGGTAACCTTGCCTTGAAGAAAAGCGATAATTGCATCCAGGAAATCGCAGGAAGTTCTGGAGCCCCTCTACTTAACCTGAGCCACGAGATATGTAAAAGGATTTAGTTTTTAGGAGTATAACGCCTCCATTCTGGTAATGTGAGGCTTATCTGGACTGGGGCTGTGGCAGGCGTTGACTGCAGGCCTTTTTGAACTTTGGTTGGACAGGCTCCTGCATCCTCAGGTCTATCTGCAAGTGCTACGGATATAAGTGCCAAGGGAGCTCCAGCAGCTGCAAGTGCACCGGCTTGGGATGCTGGCACCACCAGCCCGACTGGAACTACGAATCAAATTTCAAGCGCTACTCCCGAATCTCCCTCGGCTGCAAGCACACGGATCGCTCTAGGACAATCGGAACGTAAGAAGAGAAAGCTTTGGACCCAAGAGGAAGATCAGGAGCTAATTGCAGCGGTGGAGAAATGTGGTGAAGGCAACTGGACAAATATCCTGAAAGGAGCTTTCACACATGATCGCACTGCAGCCCAACTGTCACAGGTAGACCACCTGCACGCTCCGCGGACATTAACTATGCTCGTGATATTTTATCCTCTTGTTGTTCGTCACCCCCTTCTGTTCTCATGTTTTCTCGATACTATCGGGTAGAGCCTAGGCTACTAACCTCAAAATATTGTTAGCTCATCGTCATAGTCAAGTGCTTTGGTTACCTCTTGTTGCTTCGCCGTTCCATCAATTCATTATAGTTACCCGAGCTGGAATATATGCTGGTTGTGGCATCGGTTGTCTAATCAATAATTGCTGACTTGCTTGAGTTACGATCTCTGTACAGATGCGTTGATGCGCTTTCAGAAAATTTACCACCCTTGTGTACACTGCTCTTTGATTTCATGTCATGTCCACTTCTCCACCTCTTATTTTATTCATATTATCAGTTCTACTCTTTTTCGGCGCTTCTTACGTCTACCCATGTACACAACTAGTTCTACTATGCATTTACTCCTTTAAAACTACCGTCTACGAACATGAACATGGATATCGCCCCCGTTTCGGGTTGATCACTCCATAATGCAACATACATTACACTCTATGACTTGACTCCAGAGAAGATCTGTAGAGTTCAAACGTCTTTCTTTGGTTTTCAGCATACGGATGGATACAGTTTCTCTAACCTCAATGTACTACGTACATTTTACTGAATGCGTGGTTTCTGCAGGTTCGTCCCTTAAGTGATTTTAATCCTCATTATATTTCATGCTCATTCTGGTAGTCTTAGGAAATTGTTACTGGGTTTGTATCCAACCTTGACTGAATAATATTTTGATTTTTTGTGTACTGCAAATGCGAAGACCTACTTGTGGAATGTTCCTGAAGCAGTACCGTGCACGTTAGACGCCTCATGCTATGCTTGGTTACTCAAGGACTTTGGTTGATTAGTGGTGTTGTGACACGTTATTAATAACGTGTCAATTGTGTGTATATGTCACAAGCTTGTCTTTGTTAGTCAAGTTTCTGTTTTTGCTCTTCACTCTTGGAAATCATACTCGACTGCAATAAGATTCTCGGACGTGCTATGATTTCTATCTTTCTCTAGGTCTCAACTGCTACCGAGTATGCAAGGATCATTCGTTCTCGTCAACACATGTACGAAGGTGAAGGGTCTAGAGGAAGGCTGTCATGTAGGCATTATGCACTCATGCACTCATGCGTCTGTTTCCTGAATAGGTGCCGTTTGGTGGAAACATATTCTTCGCTAGATTGTGATGGATCTTGGGGATTGTGTGCAGAGATGGGCATTGATAAGGAAGCGGCGAGAAGTACAAGCAGCTGCTGCACAGAAAGCTATACCTGGTAGCTCCAGCGGGGGTGCGGCTGACGCTCAACAAGGGGCAAATCAACTGGCAACCTCCACAAGTGGAGCGAAGGTTTCACAGAACGGAGGTACATTTGTTGTCAGCAGTGCCACTCAGTTGGCTTCTCCAGTAACTCCTGGAGCCGCGTTTTCCCCCCTGACACCACCAGTGGCGATCACTGGCCCTACTCCGGGGCCCTCTACTTCAGCTCAACCACAAATTCAAGGACTTCATGTCAGTGGATCTAGTAGTAATTCTCCAGGAAGCATTGTGGTCACCAGTGCACCAAATGGCACACTGGCACCATCCGGTGGTAGCTTAGATGGTGTCTCATATAAGACGGCACCCCAAGTGGCACGTCCTTCTGGTGCACCCACTGTCCGGACTGGCGCAGTCGTCACACAACGGCAGGGCCAGGCAGTGGGTGCTGCACGGAGCACAGCAGGGTCTTCAACAGCTTCCGCAGCTTTGAGTACAGAACAAATTCGGGGTGGAGTTGCCAAAACTGTGGGGAGTGGTGTTGGTGCAGGTCGCCTCATAGCGCCTGGTGCTGTGGTAATGAGTGCCGCTGCAGCGCAGGCGGCTTCCGTGGGGGGAAGTGAGATGTGGCAGGCTAGCAGTCTCCCACCAGCAGCTACTCAAAGCTCAGTGCCAGCGAAGTATGGATCTCGAGGGAATGCGGGGCCCTCAAGTGGCCGGGTCAACATGTTAATGAAGCAGCAGATTACCGGGCCAGATCCAGGGGTTCAAGCCGCAGCTGTGGCAGCAGGTGCAAGGATTGCCCCTGCGTCAGCTGCTGCATCACTTTTGAAGGCTGCTCAGTCAGGCAATGTTGTGCACATTGGGCCCGGGGGGGTTCCCATCACGAAGACAGGGCTTCAAAATCAAGCAGGAATCGGGCATGGTTCGAACGTTGGTTCGCGCGGATCATCTGGTGGTGCTATCGTGCACTACATCCGCACTGGTGCTGGAGCTCCACCTCCAAGCCTTCCAGGAATGATGAGACCAAGTCAGCAACAGAAGAGTCAGCCCGGCAAATCGCCGGGTGTTAACCAAATCAGCAACAGTGCTGCATCGAAACAGCAGTCCAGTCCAGCTCCGTCAAGCGCAACATCGCAGGCTGTTACTCCTCCCTCTCAATCAAAGTAATGCTCCAGGACAGTCTACGTTCTCAAGACACGAAATTTACTTCTTCCTACTCAGTAGATTACAGAACTCATTACACATAATTGTAGATCGATTCCAACATCAATTATTGCTTTGAGCTTGGACGCCGGTTGAACGACTAAAGCCCTCGTATCATACCGTAGGTGTCTGAGAATTTTTTTTTAAATGCATGAGGAAGTGATTAGTAAGCAAACATTGACACAGCTCTTATGTATTGAACC

mRNA

>Mapoly0014s0193.1
GGAAGCGTCGACTTCGACCTGGTGCCGACGAGACAGAGCTGCAGCTGATGGGATTTGATTCGAAGTGAAGTGACATTGAGGGCGACGAGATCGACCGCCAGGCAGCGCATCGGATCCATTCCTTCGGCAGCTCAGAGTGGACAGCCAGTGATTTAATGGGAAAGAAAGGGACTCTATGCGAGTCGGAAATCGGGCAGATACTACGAAGATATAGTGCTGTGACAGTCATGGGACTTATTCGCGAGATTGCGAGGTGTGAAAGTTCGAAGCTCGACTTCAATGCTCTTGTGAAGAAGTCTAGTACCGGTATAAGTTGTGCTCGCGAATATCAAGCTTTGTGGAGGCACATCGCGTACCGTGCAGAATTGGACGATGCCTATGAAGAAGATGCCGAACTCCTGGAGGATGACAGTGATCTCGAGTTTGAGCTCGAACCTGCGCCAAGTGTCAGTCCAGAGGTTGCTGCTGAAGCTGCGAACTGGGTGAAGGCAGACATGCAACGCTTTGGAATCGTTGCACCTAAGAGGAAGGGGGACCTTCTTACAAAATTAAAAAGTAGAGACGCAGATTCCGCATCAACGGTTGGAAATCAGGCTCCTGCATCCTCAGGTCTATCTGCAAGTGCTACGGATATAAGTGCCAAGGGAGCTCCAGCAGCTGCAAGTGCACCGGCTTGGGATGCTGGCACCACCAGCCCGACTGGAACTACGAATCAAATTTCAAGCGCTACTCCCGAATCTCCCTCGGCTGCAAGCACACGGATCGCTCTAGGACAATCGGAACGTAAGAAGAGAAAGCTTTGGACCCAAGAGGAAGATCAGGAGCTAATTGCAGCGGTGGAGAAATGTGGTGAAGGCAACTGGACAAATATCCTGAAAGGAGCTTTCACACATGATCGCACTGCAGCCCAACTGTCACAGAGATGGGCATTGATAAGGAAGCGGCGAGAAGTACAAGCAGCTGCTGCACAGAAAGCTATACCTGGTAGCTCCAGCGGGGGTGCGGCTGACGCTCAACAAGGGGCAAATCAACTGGCAACCTCCACAAGTGGAGCGAAGGTTTCACAGAACGGAGGTACATTTGTTGTCAGCAGTGCCACTCAGTTGGCTTCTCCAGTAACTCCTGGAGCCGCGTTTTCCCCCCTGACACCACCAGTGGCGATCACTGGCCCTACTCCGGGGCCCTCTACTTCAGCTCAACCACAAATTCAAGGACTTCATGTCAGTGGATCTAGTAGTAATTCTCCAGGAAGCATTGTGGTCACCAGTGCACCAAATGGCACACTGGCACCATCCGGTGGTAGCTTAGATGGTGTCTCATATAAGACGGCACCCCAAGTGGCACGTCCTTCTGGTGCACCCACTGTCCGGACTGGCGCAGTCGTCACACAACGGCAGGGCCAGGCAGTGGGTGCTGCACGGAGCACAGCAGGGTCTTCAACAGCTTCCGCAGCTTTGAGTACAGAACAAATTCGGGGTGGAGTTGCCAAAACTGTGGGGAGTGGTGTTGGTGCAGGTCGCCTCATAGCGCCTGGTGCTGTGGTAATGAGTGCCGCTGCAGCGCAGGCGGCTTCCGTGGGGGGAAGTGAGATGTGGCAGGCTAGCAGTCTCCCACCAGCAGCTACTCAAAGCTCAGTGCCAGCGAAGTATGGATCTCGAGGGAATGCGGGGCCCTCAAGTGGCCGGGTCAACATGTTAATGAAGCAGCAGATTACCGGGCCAGATCCAGGGGTTCAAGCCGCAGCTGTGGCAGCAGGTGCAAGGATTGCCCCTGCGTCAGCTGCTGCATCACTTTTGAAGGCTGCTCAGTCAGGCAATGTTGTGCACATTGGGCCCGGGGGGGTTCCCATCACGAAGACAGGGCTTCAAAATCAAGCAGGAATCGGGCATGGTTCGAACGTTGGTTCGCGCGGATCATCTGGTGGTGCTATCGTGCACTACATCCGCACTGGTGCTGGAGCTCCACCTCCAAGCCTTCCAGGAATGATGAGACCAAGTCAGCAACAGAAGAGTCAGCCCGGCAAATCGCCGGGTGTTAACCAAATCAGCAACAGTGCTGCATCGAAACAGCAGTCCAGTCCAGCTCCGTCAAGCGCAACATCGCAGGCTGTTACTCCTCCCTCTCAATCAAAGTAATGCTCCAGGACAGTCTACGTTCTCAAGACACGAAATTTACTTCTTCCTACTCAGTAGATTACAGAACTCATTACACATAATTGTAGATCGATTCCAACATCAATTATTGCTTTGAGCTTGGACGCCGGTTGAACGACTAAAGCCCTCGTATCATACCGTAGGTGTCTGAGAATTTTTTTTTAAATGCATGAGGAAGTGATTAGTAAGCAAACATTGACACAGCTCTTATGTATTGAACC

CDS

>Mapoly0014s0193.1
ATGGGAAAGAAAGGGACTCTATGCGAGTCGGAAATCGGGCAGATACTACGAAGATATAGTGCTGTGACAGTCATGGGACTTATTCGCGAGATTGCGAGGTGTGAAAGTTCGAAGCTCGACTTCAATGCTCTTGTGAAGAAGTCTAGTACCGGTATAAGTTGTGCTCGCGAATATCAAGCTTTGTGGAGGCACATCGCGTACCGTGCAGAATTGGACGATGCCTATGAAGAAGATGCCGAACTCCTGGAGGATGACAGTGATCTCGAGTTTGAGCTCGAACCTGCGCCAAGTGTCAGTCCAGAGGTTGCTGCTGAAGCTGCGAACTGGGTGAAGGCAGACATGCAACGCTTTGGAATCGTTGCACCTAAGAGGAAGGGGGACCTTCTTACAAAATTAAAAAGTAGAGACGCAGATTCCGCATCAACGGTTGGAAATCAGGCTCCTGCATCCTCAGGTCTATCTGCAAGTGCTACGGATATAAGTGCCAAGGGAGCTCCAGCAGCTGCAAGTGCACCGGCTTGGGATGCTGGCACCACCAGCCCGACTGGAACTACGAATCAAATTTCAAGCGCTACTCCCGAATCTCCCTCGGCTGCAAGCACACGGATCGCTCTAGGACAATCGGAACGTAAGAAGAGAAAGCTTTGGACCCAAGAGGAAGATCAGGAGCTAATTGCAGCGGTGGAGAAATGTGGTGAAGGCAACTGGACAAATATCCTGAAAGGAGCTTTCACACATGATCGCACTGCAGCCCAACTGTCACAGAGATGGGCATTGATAAGGAAGCGGCGAGAAGTACAAGCAGCTGCTGCACAGAAAGCTATACCTGGTAGCTCCAGCGGGGGTGCGGCTGACGCTCAACAAGGGGCAAATCAACTGGCAACCTCCACAAGTGGAGCGAAGGTTTCACAGAACGGAGGTACATTTGTTGTCAGCAGTGCCACTCAGTTGGCTTCTCCAGTAACTCCTGGAGCCGCGTTTTCCCCCCTGACACCACCAGTGGCGATCACTGGCCCTACTCCGGGGCCCTCTACTTCAGCTCAACCACAAATTCAAGGACTTCATGTCAGTGGATCTAGTAGTAATTCTCCAGGAAGCATTGTGGTCACCAGTGCACCAAATGGCACACTGGCACCATCCGGTGGTAGCTTAGATGGTGTCTCATATAAGACGGCACCCCAAGTGGCACGTCCTTCTGGTGCACCCACTGTCCGGACTGGCGCAGTCGTCACACAACGGCAGGGCCAGGCAGTGGGTGCTGCACGGAGCACAGCAGGGTCTTCAACAGCTTCCGCAGCTTTGAGTACAGAACAAATTCGGGGTGGAGTTGCCAAAACTGTGGGGAGTGGTGTTGGTGCAGGTCGCCTCATAGCGCCTGGTGCTGTGGTAATGAGTGCCGCTGCAGCGCAGGCGGCTTCCGTGGGGGGAAGTGAGATGTGGCAGGCTAGCAGTCTCCCACCAGCAGCTACTCAAAGCTCAGTGCCAGCGAAGTATGGATCTCGAGGGAATGCGGGGCCCTCAAGTGGCCGGGTCAACATGTTAATGAAGCAGCAGATTACCGGGCCAGATCCAGGGGTTCAAGCCGCAGCTGTGGCAGCAGGTGCAAGGATTGCCCCTGCGTCAGCTGCTGCATCACTTTTGAAGGCTGCTCAGTCAGGCAATGTTGTGCACATTGGGCCCGGGGGGGTTCCCATCACGAAGACAGGGCTTCAAAATCAAGCAGGAATCGGGCATGGTTCGAACGTTGGTTCGCGCGGATCATCTGGTGGTGCTATCGTGCACTACATCCGCACTGGTGCTGGAGCTCCACCTCCAAGCCTTCCAGGAATGATGAGACCAAGTCAGCAACAGAAGAGTCAGCCCGGCAAATCGCCGGGTGTTAACCAAATCAGCAACAGTGCTGCATCGAAACAGCAGTCCAGTCCAGCTCCGTCAAGCGCAACATCGCAGGCTGTTACTCCTCCCTCTCAATCAAAGTAA

Protein

>Mapoly0014s0193.1
MGKKGTLCESEIGQILRRYSAVTVMGLIREIARCESSKLDFNALVKKSSTGISCAREYQALWRHIAYRAELDDAYEEDAELLEDDSDLEFELEPAPSVSPEVAAEAANWVKADMQRFGIVAPKRKGDLLTKLKSRDADSASTVGNQAPASSGLSASATDISAKGAPAAASAPAWDAGTTSPTGTTNQISSATPESPSAASTRIALGQSERKKRKLWTQEEDQELIAAVEKCGEGNWTNILKGAFTHDRTAAQLSQRWALIRKRREVQAAAAQKAIPGSSSGGAADAQQGANQLATSTSGAKVSQNGGTFVVSSATQLASPVTPGAAFSPLTPPVAITGPTPGPSTSAQPQIQGLHVSGSSSNSPGSIVVTSAPNGTLAPSGGSLDGVSYKTAPQVARPSGAPTVRTGAVVTQRQGQAVGAARSTAGSSTASAALSTEQIRGGVAKTVGSGVGAGRLIAPGAVVMSAAAAQAASVGGSEMWQASSLPPAATQSSVPAKYGSRGNAGPSSGRVNMLMKQQITGPDPGVQAAAVAAGARIAPASAAASLLKAAQSGNVVHIGPGGVPITKTGLQNQAGIGHGSNVGSRGSSGGAIVHYIRTGAGAPPPSLPGMMRPSQQQKSQPGKSPGVNQISNSAASKQQSSPAPSSATSQAVTPPSQSK

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>