Mapoly0014s0195



Description

pre-mRNA-splicing factor CDC5/CEF1

Reference DB

Database ID Description
KEGGORTH K12860 Pre-mRNA-splicing factor CDC5/CEF1
OrthoMCL OG5_128000
PFAM PF11831 Pre-mRNA splicing factor component
PFAM PF13921 Myb-like DNA-binding domain
PANTHER PTHR10641 MYB-LIKE DNA-BINDING PROTEIN MYB
PANTHER PTHR10641:SF17 CELL DIVISION CYCLE 5-LIKE PROTEIN

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpCDC5 transcription factor, MYB Mapoly0014s0195.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0014s0195.1 scaffold_14:1881315..1888048  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0014s0195.1  

Gene structure:

mRNA scaffold_14:1881315..1888048  ( - strand )
three_prime_UTR scaffold_14:1881315..1881556  ( - strand )
CDS scaffold_14:1881557..1881895  ( - strand )
CDS scaffold_14:1882214..1882564  ( - strand )
CDS scaffold_14:1883364..1883645  ( - strand )
CDS scaffold_14:1884091..1885539  ( - strand )
CDS scaffold_14:1885729..1885995  ( - strand )
CDS scaffold_14:1887419..1887595  ( - strand )
five_prime_UTR scaffold_14:1887596..1888048  ( - strand )

Sequences:

Gene

>Mapoly0014s0195.1
GCATGGGAGGGAAGTGAGGAGGAGGACTCGAGGAAGTGGGGACTGGGTGGGGAATGCGGGCGACGACCAGAGAATGCGGTGCAGCTGCGCGACGAAGAGGAGGAGTGGGGGGCGGGCAGGAGTGACATGTAGTGGATGAGAGGAGGTGCGGATTATGGTGGCAGGTTCTGGAGGAGGATGCTGAAGGAGGAGCGGAGGCAGCGAGCGTCGTGGAACTTCGCGAGCAGGGTTGGATTTTTGAATTCTTTGCGTGGGTCGTAGAGGAGTTTGAAGGAGGAAGGAAGGGAGGCAGGGAGGGAGTAGGAGCAGGGGCCGAGGCCGAGGCGGAGCGAGTCTGAGTTTTGTAGTTTAGAGAGAAGACTCGTTGGGTTGGACAGGATTTGTTCGCGAGGTCGTCTTCGTGTTGTCGTTCCCACTTGTGACCTCCGGTCGTGGTAGGCAAAGCCAGCCATCATGAGGATCATGATAAAGGGAGGTGTTTGGAAAAACACCGAGGATGAGATTCTCAAAGCAGCGGTGATGAAATATGGCAAAAATCAGTGGGCACGTATTTCTTCGCTCCTGGTTCGGAAGTCAGCCAAGCAATGCAAGGCCCGCTGGTACGAGTGGTTGGATCCATCTATCAAGAAGGTACGAAATATCGGTTTCAGTTTATTTTGTGCTTAGAGCGGAACAAATTTGAATCTATGTGTCCGTTGATTCATGTGCTTCAATCTTCGTTGGCTGACTTTAAGGCGCGAGTCTTTTTTTCTAAATTTTCTCGTGTTCCACATTTCTCAACCGCCGATTTCTTTTAAATCCTGTCTTCTGCCTTTCAAGCGCGGAATTTGTGCTGTTATCGAGCTCAGAGGTCTTACAGCCACTTCGTAATACAGATCTTTCCTTCCTGAGTTGTTTTCATTTGGCCGAGTATTTGCGCTGTCATCATTCTATTTCTTATGTACTCTGGCATCTTTCTGTGTATCCGAGGAACACTCAGAACTTTGTGGGGAAAGTCGGTTACTGGTTTCAGAGAAAGCTCTTATAGCGAGAACCTTGCCTGCCAAGCCTTGCAACTGTCTGACTACTGTCAGAGGGGACCTGATTCTCCTCGCGCACTGTCTCCCAGTAAACTGTATTGAAGGCATTGAATCTAGAACCCTAGCAACATCACTGAAATCAATTCCAGCTTTTTTGAAAGCGACTAATTGCTCGTGTGGAGTTCAATCCTCAAAGCTGTCCTCAAGAGTCTACTTCTCATCTTGGATGGTTATCGAACCGGTGAAACTCATGTAGATGGATCTGACGTCAAGTTTCTTGGAGTTTTTCCTACATTGGGGAGCATTGTCTTTCCTTTCCGCATGATAGCCTAAATTTTCTTACTTTTTTAGCTAGATCCCACCACATAAAATTTTCACTTTGAAGATGTCACCTACTGGCCTCGCCTGTAAGTGCATGTGAACTATTCGGAGGCACTCGGGTCCTACACCTGGACTTTAAGCAATGGAGCGTCAAAATAAAGGCTTAAATCTCGATTTCGTTCTCTTTAATCCTCTTATCGTGTTTAACTTGACCTATGTTAAAGGTTGTGACCTCCTGTGACCTTTAATATGCATTTGAGCTGTACAGTCTCTGTTCATTACTCTTTCTAACATATACGATTTCCTCGTCAAATTTATTAGGTTGAGTATTTCGGACTTTTACAAGTATGCATTTGTATCGCCCCCAAGGATGCTGAGTGCCAAAGCTCTGTTGTTCAAATTACCCGGCCTCATGATTCCTGTCTACAGGAAAAGCAATACTCACAGCTATGCCTATTTCCTATCTTACTTTTCAGCTGTCTATAAGACGGTCTTTACAACTTCCTTTCTTACTGGAAGATTCTCCGTTAAATTGTTTGCTTGTTCGATTTCTAGATAATGAGTATCTCACTGGATACAAAAGTGGCCGCTCTCTCCTCCTCTTCACGGGCACCTTGCGCTATGCACAGACAGATCTTTAAATTTACATTTGTATTAATATTTACATGAATCGACTGGTTCAAATTTGTGATAGTTTTGAGATGTTCATGCAGACCGAGTGGACTAGAGAGGAGGATGAGAAGCTCTTGCATTTGGCGAAGCTGATGCCTACTCAGTGGAGGACAATTGCACCCATTGTTGGACGCACACCTGCTCAATGTTTGGAGCGTTATGAAAAGCTACTGGATGCTGCATGTGCGAAGGATGAAAATTATGAACCTGCGGATGATCCTCGAAAGCTTCGACCAGGAGAGATCGACCCTAATCCAGAGTCCAAGCCAGCTAGACCTGATCCAGTGGATATGGACGAGGATGAGAAGGTATGAATTATTCTTGGCTTTGATGGGCGTGTGCCCATCATAACGAGTATTGTGAACTCCATGGTCGCTTGTGACTAATGTGGAAAAACCATAGCGCAGTTCGTTCCAAAAATATGGGCGTCCAGAACCACTTGATCTGTGCACACTTGGGTATATACAATGGTTTGATCGAATGGTTTGTAATATCAGGAAATGCTTTCAGAAGCTAGAGCCAGGCTTGCCAATACGAGGGGGAAGAAAGCGAAGAGGAAAGCCCGAGAGAAGCAGCTTGAAGAGGCACGAAGGTTGGCTTCTTTACAGAAAAGAAGGGAGTTGAAGGCTGCAGGAATAGACGTGAGGCACAGGAGGAGAAAGCAAAAAGGTATCGATTACAATGCGGAAATTCCTTTTGAGAAAAAGCCACCACCGGGATTCTTTGAAGTCTCTCAAGAGGAGCGGATAGTGGAGGAACCTCAATTTCCAACTACAATTGAGGAAGTAGAAGGCAAGCGCCGAGCTGACATAGAGGCTCAATTGCGGAAACAGGATGTTGCCCGAAATAAGATTGCCCAGAGACGGGATACACCAGCATCGGTTATGCAAGTGAACAAGTTGAATGATCCAGAAGCTGTTCGCAAGCGATCGAAACTGATGCTTCCTGCCCCTCAGATCTCTGACCGGGAGCTAGAAGAGATTGCCAAAATGGGGTATGCAAGTGATTTGCTTACAGGAGAGGATGATTTCAGAGAAGGAACTAGTGCCACGAGAGCTCTTCTTGCGAACTATAATCAAACACCAGCTCATCCGGGAATGACTCCGTTGAGAACACCCCAACGAACCCCGGGAGGCAAAGGAGATGCCATTATGATGGAAGCAGAAAATTTGGCTCGTCTTAGGGAGACACAGACACCGCTGTTCGGAGGTGAAAATCCTGAGTTGCATCCCTCAGATTTCTCCGGTGTCAACCCAAAGAAGAAGGACATTCAAACGCCCAATCCAATCGCAACACCCATGCGTACTCCTTCTGGCGGAATGGGTGCCACTCCTGGTATGACTCCGATGAAGGACTCTGCCATGTATGGCATGACACCCAAAGGTACGCCTATTCGAGATGAACTTCACATCAACGAAGGTATGGAAACACCCTTCGACAACGCGAAGGCTGAGAAAATGAGGCAAGCTGAGTTGAGGCGAAATTTGAGAGCTGGGCTCGGAGACCTTCCAGCTCCAAAGAATGAGTATCAGATAGTTGTGCCAGACCTTCCCCCAGAAGAGGCCGAACCCGTTCGAGACATGGAGGAGGATATGTCAGATCTCTTGGCCAGACAACGTGCTGATGAAGCAGCGAAGCAAGCAGCACTTTTAAGGAAGAGGTCAAAAGCCCTGCAAAGAGATCTGCCTCGGCCGCCCCTTGGTGGCGTAGAGCTCTTGAGGAGCTCTTTACAGAGCACCGAGAACGCTGTGACTTATTTAGACGAAGCTGATGAGCTGATAAGACGAGAAATGGTGGAGCTGCTCGAGCACGATGCGGTAAAATACGCGGTCAAAGACGAATCTTCCAGCAAGGATAAGAAGAAGGGGACAAAGACGGGCGTTAACGGCAGAGCCCAAGCTCCCGTACCTTGGATTGAGGATTTTGAAGAGGACCATCTTTTGGAGGTACTCCATGAATCTATGTAGAAAAATATTTGCCGCAGATGGATTTAAATACACATTTTCTCCATTTTCTGTTTCATATTTCTTTTGCCCGAGGTACCTTTGTTCTTTGCTGTCAAGTTGATGAGAATAACTTGTAGTATCACACTATTAAATTGAATATAGCTTTCATTGGTTTCCAATTCTGAAGTCTTCTTTAATACAGTTACATGCTTCATATGAAGTTCTATCCGCAAGAAGAATCGTCATGTAGATTCTGAAATTATTTGCTTTAACCAAGAGCAACTCACAACAGACACTCAACGTACGTCCTACGTACAATGTGGTTGTTAACATCAGTTAAGATTTTCCCTGTTCTGGGTCTCTATGACGTTTATCATCTTAGACTAGATGATTTTGTAACTTACCATTTTTCAACTGAAACGTGAACTTCCTTATATTCTCGCAGGCTGCAAAACTGATAGAGGAAGAAATAGATATTTTGAGGATGGCCATGGGTCACGAGGATGCTACTCTAGATGACTATGCAGATGCACGCGATGCCTGTGTCGAAGATATGGTCTATCTTCCAACTCGTAATAGTTACGGTCTGGCCAGTGTAGCCAGTAGTGGCGACCGTCTGGCCTCAATGCAATATGAATTAGATAACATCAGAAAACTTATGGAAGGAGAGACGAAGAGGGCAGTGCGCCTGGAACAAAAGCTGAAGGTGCTTACCCAAGGATATCAGGTATGTTCGAATGTTCTGGCTGCTCAATTCTAGAACTTGCTTTGTGCGCAGTCATCTTTCAAGGAGCTGAGTATCATAACCTTGTGTGTTGAAAACCTTTCAGATTAGTATTCTGCACTTCTAAGCCCTTCTGTTTACTGTAGCAATCATGGATAGTGCACTGTCCGAAACTTGACGGTACATTTATTGTTAGACTGATGGTTGCATTGGTAAGAATGATGCACGAAAGCGGCTAGGAAGGTGGAACCTCAAAATTTTTTAGATCAAGTTATTAGAAATTTTCATTAAATTTCAATTTCAATCTTTACTGACTATTTTCAATGAATTAGAAAAGAAGTCATAGGATGCAAAAAAAGTATGCTTGAGGTAGTTATGTAGCAGTTGGATGTTTTGGGCTGTAGAAACTCGTTACCATCATCAGGACCGTACATATTTACAGACGTTTCATCTTGGTCTATGCAACGATATGACGTCTCCAATATAGTTTAAGTTATTTATCATAACTACTGAAATTCAAAATCTGAACACTTCATAATATAAAAGCCAGTCAAGGGGATGGTTTATTGGTTATCATTTATTTACCTATGCATATCGCGCTCTTGGAGTCAATTAGTACACCTCAAAATGCACATCCTCTTAGAAATGGCAGTCTCGATTCCATAATGGAGATTATTCTCTGACGATAATTTGACTCCAATCTGTTTCATCTTCTTTACTATTTGGTTTGTTTGTAGTCTTCTGCCCCTAGAGTTTGCTGTCTTGAGTTTGATACCTTTTATGAATGTGTATCTCTTTGTAGACACGAGCTGAAAGCCTCGGAAGGCTTATCGAGGCATCATTCAAGACGGCAGATACTTTGGGAACTGAATTGAAGTGTTTTAGAGCATTACATCGGCAGGAGCAGTTGGCCGCACCTCGACGTATTGAAGCCTTGCAAGACTTAGTAACACAACAAGTAGAGCGCGAACGGGTGCTTCAATTACAGTACGAGAATTTGCTAGTTGAGCAAGACAACTTGACTCGGCTAATTGATGACCATGATGTGGCAACTGCCAAAGCTTTGGAAGCTAAGTTAGCTACGGAAGACGCTGCCACAGAGGAAAGAGATGCCGACTCTGAAATACAAATTGTGGAAGACTTGCAGCAGAAGGTGATTGCAAATATGAAGTGACCTGAGTGGTCATTCTTATAAAACTTTGTACCGAAGTTGAGGAGTTGATAAGGTTTTACTGAAAATCATGGAGAATGATGGAGATTGAATTAATTTGTTTTACTGTTTCTATAGAGCTAGAGGACATGATGATATAATCTTCAGCAGTGACTAGGTTTTTAGTATCAGCTTGCATCTATAGATGTGCTTTTTGCGCTTGAGCTCTTTTTTATATGCTGGAACTTGTGATTTGGTTAGAGCTCGAGTCTGCACCTATGTATCTGACAGAATTTATGTTTTGTGTGTTCCTTATTGTAGGCACCAGCGAAAGAAGACGCCATTCAAGAGAGAAGGGATTCCTCTTTTGATGAAGCAGAAGATATGCAGGGCATTGAAAAGGAATCAGTGGAAAGAAGCCCATTAAATGCTGAGAAGGCAATGGAAGAAGTATCCGTAGAAAGGGTAGTATTACCTGGAACTGCGGTAGAGATGCTCATAGAGGCAGGAGTGGATGCTGTGGCATCTGTTGACGAGGTGTCCGCCATGAAAGAAGGTCTGGTAGAGGTCGAAGAGGCAAATGTAGTTAGACATAACGCGGAGGGATTCAATGAGGTAGAAACCGGAACAAATTCTGCTGGAACTGTACAAATCTCGTAGTGTGCCATTTTGCTCTTCCGTACAGAAGGTGCTATTATTAGTGTAGGAAGGTTGGAAATGATCCAGGCAGATAATTTCGGTCTCTCGAAGTTTGTCGAAGGGCAAGGGTACGCTTGATGCACACGCCGCGTGGCCTCGATGTAGGGTGATGCTTTACAAAATGTGAAATGTATGTTGTTGTGAACTTGATTAAATTCTTAAAGCATGACTAGTCGAAGAAGTCCTCGAAGAAGTCGATTGAG

mRNA

>Mapoly0014s0195.1
GCATGGGAGGGAAGTGAGGAGGAGGACTCGAGGAAGTGGGGACTGGGTGGGGAATGCGGGCGACGACCAGAGAATGCGGTGCAGCTGCGCGACGAAGAGGAGGAGTGGGGGGCGGGCAGGAGTGACATGTAGTGGATGAGAGGAGGTGCGGATTATGGTGGCAGGTTCTGGAGGAGGATGCTGAAGGAGGAGCGGAGGCAGCGAGCGTCGTGGAACTTCGCGAGCAGGGTTGGATTTTTGAATTCTTTGCGTGGGTCGTAGAGGAGTTTGAAGGAGGAAGGAAGGGAGGCAGGGAGGGAGTAGGAGCAGGGGCCGAGGCCGAGGCGGAGCGAGTCTGAGTTTTGTAGTTTAGAGAGAAGACTCGTTGGGTTGGACAGGATTTGTTCGCGAGGTCGTCTTCGTGTTGTCGTTCCCACTTGTGACCTCCGGTCGTGGTAGGCAAAGCCAGCCATCATGAGGATCATGATAAAGGGAGGTGTTTGGAAAAACACCGAGGATGAGATTCTCAAAGCAGCGGTGATGAAATATGGCAAAAATCAGTGGGCACGTATTTCTTCGCTCCTGGTTCGGAAGTCAGCCAAGCAATGCAAGGCCCGCTGGTACGAGTGGTTGGATCCATCTATCAAGAAGACCGAGTGGACTAGAGAGGAGGATGAGAAGCTCTTGCATTTGGCGAAGCTGATGCCTACTCAGTGGAGGACAATTGCACCCATTGTTGGACGCACACCTGCTCAATGTTTGGAGCGTTATGAAAAGCTACTGGATGCTGCATGTGCGAAGGATGAAAATTATGAACCTGCGGATGATCCTCGAAAGCTTCGACCAGGAGAGATCGACCCTAATCCAGAGTCCAAGCCAGCTAGACCTGATCCAGTGGATATGGACGAGGATGAGAAGGAAATGCTTTCAGAAGCTAGAGCCAGGCTTGCCAATACGAGGGGGAAGAAAGCGAAGAGGAAAGCCCGAGAGAAGCAGCTTGAAGAGGCACGAAGGTTGGCTTCTTTACAGAAAAGAAGGGAGTTGAAGGCTGCAGGAATAGACGTGAGGCACAGGAGGAGAAAGCAAAAAGGTATCGATTACAATGCGGAAATTCCTTTTGAGAAAAAGCCACCACCGGGATTCTTTGAAGTCTCTCAAGAGGAGCGGATAGTGGAGGAACCTCAATTTCCAACTACAATTGAGGAAGTAGAAGGCAAGCGCCGAGCTGACATAGAGGCTCAATTGCGGAAACAGGATGTTGCCCGAAATAAGATTGCCCAGAGACGGGATACACCAGCATCGGTTATGCAAGTGAACAAGTTGAATGATCCAGAAGCTGTTCGCAAGCGATCGAAACTGATGCTTCCTGCCCCTCAGATCTCTGACCGGGAGCTAGAAGAGATTGCCAAAATGGGGTATGCAAGTGATTTGCTTACAGGAGAGGATGATTTCAGAGAAGGAACTAGTGCCACGAGAGCTCTTCTTGCGAACTATAATCAAACACCAGCTCATCCGGGAATGACTCCGTTGAGAACACCCCAACGAACCCCGGGAGGCAAAGGAGATGCCATTATGATGGAAGCAGAAAATTTGGCTCGTCTTAGGGAGACACAGACACCGCTGTTCGGAGGTGAAAATCCTGAGTTGCATCCCTCAGATTTCTCCGGTGTCAACCCAAAGAAGAAGGACATTCAAACGCCCAATCCAATCGCAACACCCATGCGTACTCCTTCTGGCGGAATGGGTGCCACTCCTGGTATGACTCCGATGAAGGACTCTGCCATGTATGGCATGACACCCAAAGGTACGCCTATTCGAGATGAACTTCACATCAACGAAGGTATGGAAACACCCTTCGACAACGCGAAGGCTGAGAAAATGAGGCAAGCTGAGTTGAGGCGAAATTTGAGAGCTGGGCTCGGAGACCTTCCAGCTCCAAAGAATGAGTATCAGATAGTTGTGCCAGACCTTCCCCCAGAAGAGGCCGAACCCGTTCGAGACATGGAGGAGGATATGTCAGATCTCTTGGCCAGACAACGTGCTGATGAAGCAGCGAAGCAAGCAGCACTTTTAAGGAAGAGGTCAAAAGCCCTGCAAAGAGATCTGCCTCGGCCGCCCCTTGGTGGCGTAGAGCTCTTGAGGAGCTCTTTACAGAGCACCGAGAACGCTGTGACTTATTTAGACGAAGCTGATGAGCTGATAAGACGAGAAATGGTGGAGCTGCTCGAGCACGATGCGGTAAAATACGCGGTCAAAGACGAATCTTCCAGCAAGGATAAGAAGAAGGGGACAAAGACGGGCGTTAACGGCAGAGCCCAAGCTCCCGTACCTTGGATTGAGGATTTTGAAGAGGACCATCTTTTGGAGGCTGCAAAACTGATAGAGGAAGAAATAGATATTTTGAGGATGGCCATGGGTCACGAGGATGCTACTCTAGATGACTATGCAGATGCACGCGATGCCTGTGTCGAAGATATGGTCTATCTTCCAACTCGTAATAGTTACGGTCTGGCCAGTGTAGCCAGTAGTGGCGACCGTCTGGCCTCAATGCAATATGAATTAGATAACATCAGAAAACTTATGGAAGGAGAGACGAAGAGGGCAGTGCGCCTGGAACAAAAGCTGAAGGTGCTTACCCAAGGATATCAGACACGAGCTGAAAGCCTCGGAAGGCTTATCGAGGCATCATTCAAGACGGCAGATACTTTGGGAACTGAATTGAAGTGTTTTAGAGCATTACATCGGCAGGAGCAGTTGGCCGCACCTCGACGTATTGAAGCCTTGCAAGACTTAGTAACACAACAAGTAGAGCGCGAACGGGTGCTTCAATTACAGTACGAGAATTTGCTAGTTGAGCAAGACAACTTGACTCGGCTAATTGATGACCATGATGTGGCAACTGCCAAAGCTTTGGAAGCTAAGTTAGCTACGGAAGACGCTGCCACAGAGGAAAGAGATGCCGACTCTGAAATACAAATTGTGGAAGACTTGCAGCAGAAGGCACCAGCGAAAGAAGACGCCATTCAAGAGAGAAGGGATTCCTCTTTTGATGAAGCAGAAGATATGCAGGGCATTGAAAAGGAATCAGTGGAAAGAAGCCCATTAAATGCTGAGAAGGCAATGGAAGAAGTATCCGTAGAAAGGGTAGTATTACCTGGAACTGCGGTAGAGATGCTCATAGAGGCAGGAGTGGATGCTGTGGCATCTGTTGACGAGGTGTCCGCCATGAAAGAAGGTCTGGTAGAGGTCGAAGAGGCAAATGTAGTTAGACATAACGCGGAGGGATTCAATGAGGTAGAAACCGGAACAAATTCTGCTGGAACTGTACAAATCTCGTAGTGTGCCATTTTGCTCTTCCGTACAGAAGGTGCTATTATTAGTGTAGGAAGGTTGGAAATGATCCAGGCAGATAATTTCGGTCTCTCGAAGTTTGTCGAAGGGCAAGGGTACGCTTGATGCACACGCCGCGTGGCCTCGATGTAGGGTGATGCTTTACAAAATGTGAAATGTATGTTGTTGTGAACTTGATTAAATTCTTAAAGCATGACTAGTCGAAGAAGTCCTCGAAGAAGTCGATTGAG

CDS

>Mapoly0014s0195.1
ATGAGGATCATGATAAAGGGAGGTGTTTGGAAAAACACCGAGGATGAGATTCTCAAAGCAGCGGTGATGAAATATGGCAAAAATCAGTGGGCACGTATTTCTTCGCTCCTGGTTCGGAAGTCAGCCAAGCAATGCAAGGCCCGCTGGTACGAGTGGTTGGATCCATCTATCAAGAAGACCGAGTGGACTAGAGAGGAGGATGAGAAGCTCTTGCATTTGGCGAAGCTGATGCCTACTCAGTGGAGGACAATTGCACCCATTGTTGGACGCACACCTGCTCAATGTTTGGAGCGTTATGAAAAGCTACTGGATGCTGCATGTGCGAAGGATGAAAATTATGAACCTGCGGATGATCCTCGAAAGCTTCGACCAGGAGAGATCGACCCTAATCCAGAGTCCAAGCCAGCTAGACCTGATCCAGTGGATATGGACGAGGATGAGAAGGAAATGCTTTCAGAAGCTAGAGCCAGGCTTGCCAATACGAGGGGGAAGAAAGCGAAGAGGAAAGCCCGAGAGAAGCAGCTTGAAGAGGCACGAAGGTTGGCTTCTTTACAGAAAAGAAGGGAGTTGAAGGCTGCAGGAATAGACGTGAGGCACAGGAGGAGAAAGCAAAAAGGTATCGATTACAATGCGGAAATTCCTTTTGAGAAAAAGCCACCACCGGGATTCTTTGAAGTCTCTCAAGAGGAGCGGATAGTGGAGGAACCTCAATTTCCAACTACAATTGAGGAAGTAGAAGGCAAGCGCCGAGCTGACATAGAGGCTCAATTGCGGAAACAGGATGTTGCCCGAAATAAGATTGCCCAGAGACGGGATACACCAGCATCGGTTATGCAAGTGAACAAGTTGAATGATCCAGAAGCTGTTCGCAAGCGATCGAAACTGATGCTTCCTGCCCCTCAGATCTCTGACCGGGAGCTAGAAGAGATTGCCAAAATGGGGTATGCAAGTGATTTGCTTACAGGAGAGGATGATTTCAGAGAAGGAACTAGTGCCACGAGAGCTCTTCTTGCGAACTATAATCAAACACCAGCTCATCCGGGAATGACTCCGTTGAGAACACCCCAACGAACCCCGGGAGGCAAAGGAGATGCCATTATGATGGAAGCAGAAAATTTGGCTCGTCTTAGGGAGACACAGACACCGCTGTTCGGAGGTGAAAATCCTGAGTTGCATCCCTCAGATTTCTCCGGTGTCAACCCAAAGAAGAAGGACATTCAAACGCCCAATCCAATCGCAACACCCATGCGTACTCCTTCTGGCGGAATGGGTGCCACTCCTGGTATGACTCCGATGAAGGACTCTGCCATGTATGGCATGACACCCAAAGGTACGCCTATTCGAGATGAACTTCACATCAACGAAGGTATGGAAACACCCTTCGACAACGCGAAGGCTGAGAAAATGAGGCAAGCTGAGTTGAGGCGAAATTTGAGAGCTGGGCTCGGAGACCTTCCAGCTCCAAAGAATGAGTATCAGATAGTTGTGCCAGACCTTCCCCCAGAAGAGGCCGAACCCGTTCGAGACATGGAGGAGGATATGTCAGATCTCTTGGCCAGACAACGTGCTGATGAAGCAGCGAAGCAAGCAGCACTTTTAAGGAAGAGGTCAAAAGCCCTGCAAAGAGATCTGCCTCGGCCGCCCCTTGGTGGCGTAGAGCTCTTGAGGAGCTCTTTACAGAGCACCGAGAACGCTGTGACTTATTTAGACGAAGCTGATGAGCTGATAAGACGAGAAATGGTGGAGCTGCTCGAGCACGATGCGGTAAAATACGCGGTCAAAGACGAATCTTCCAGCAAGGATAAGAAGAAGGGGACAAAGACGGGCGTTAACGGCAGAGCCCAAGCTCCCGTACCTTGGATTGAGGATTTTGAAGAGGACCATCTTTTGGAGGCTGCAAAACTGATAGAGGAAGAAATAGATATTTTGAGGATGGCCATGGGTCACGAGGATGCTACTCTAGATGACTATGCAGATGCACGCGATGCCTGTGTCGAAGATATGGTCTATCTTCCAACTCGTAATAGTTACGGTCTGGCCAGTGTAGCCAGTAGTGGCGACCGTCTGGCCTCAATGCAATATGAATTAGATAACATCAGAAAACTTATGGAAGGAGAGACGAAGAGGGCAGTGCGCCTGGAACAAAAGCTGAAGGTGCTTACCCAAGGATATCAGACACGAGCTGAAAGCCTCGGAAGGCTTATCGAGGCATCATTCAAGACGGCAGATACTTTGGGAACTGAATTGAAGTGTTTTAGAGCATTACATCGGCAGGAGCAGTTGGCCGCACCTCGACGTATTGAAGCCTTGCAAGACTTAGTAACACAACAAGTAGAGCGCGAACGGGTGCTTCAATTACAGTACGAGAATTTGCTAGTTGAGCAAGACAACTTGACTCGGCTAATTGATGACCATGATGTGGCAACTGCCAAAGCTTTGGAAGCTAAGTTAGCTACGGAAGACGCTGCCACAGAGGAAAGAGATGCCGACTCTGAAATACAAATTGTGGAAGACTTGCAGCAGAAGGCACCAGCGAAAGAAGACGCCATTCAAGAGAGAAGGGATTCCTCTTTTGATGAAGCAGAAGATATGCAGGGCATTGAAAAGGAATCAGTGGAAAGAAGCCCATTAAATGCTGAGAAGGCAATGGAAGAAGTATCCGTAGAAAGGGTAGTATTACCTGGAACTGCGGTAGAGATGCTCATAGAGGCAGGAGTGGATGCTGTGGCATCTGTTGACGAGGTGTCCGCCATGAAAGAAGGTCTGGTAGAGGTCGAAGAGGCAAATGTAGTTAGACATAACGCGGAGGGATTCAATGAGGTAGAAACCGGAACAAATTCTGCTGGAACTGTACAAATCTCGTAG

Protein

>Mapoly0014s0195.1
MRIMIKGGVWKNTEDEILKAAVMKYGKNQWARISSLLVRKSAKQCKARWYEWLDPSIKKTEWTREEDEKLLHLAKLMPTQWRTIAPIVGRTPAQCLERYEKLLDAACAKDENYEPADDPRKLRPGEIDPNPESKPARPDPVDMDEDEKEMLSEARARLANTRGKKAKRKAREKQLEEARRLASLQKRRELKAAGIDVRHRRRKQKGIDYNAEIPFEKKPPPGFFEVSQEERIVEEPQFPTTIEEVEGKRRADIEAQLRKQDVARNKIAQRRDTPASVMQVNKLNDPEAVRKRSKLMLPAPQISDRELEEIAKMGYASDLLTGEDDFREGTSATRALLANYNQTPAHPGMTPLRTPQRTPGGKGDAIMMEAENLARLRETQTPLFGGENPELHPSDFSGVNPKKKDIQTPNPIATPMRTPSGGMGATPGMTPMKDSAMYGMTPKGTPIRDELHINEGMETPFDNAKAEKMRQAELRRNLRAGLGDLPAPKNEYQIVVPDLPPEEAEPVRDMEEDMSDLLARQRADEAAKQAALLRKRSKALQRDLPRPPLGGVELLRSSLQSTENAVTYLDEADELIRREMVELLEHDAVKYAVKDESSSKDKKKGTKTGVNGRAQAPVPWIEDFEEDHLLEAAKLIEEEIDILRMAMGHEDATLDDYADARDACVEDMVYLPTRNSYGLASVASSGDRLASMQYELDNIRKLMEGETKRAVRLEQKLKVLTQGYQTRAESLGRLIEASFKTADTLGTELKCFRALHRQEQLAAPRRIEALQDLVTQQVERERVLQLQYENLLVEQDNLTRLIDDHDVATAKALEAKLATEDAATEERDADSEIQIVEDLQQKAPAKEDAIQERRDSSFDEAEDMQGIEKESVERSPLNAEKAMEEVSVERVVLPGTAVEMLIEAGVDAVASVDEVSAMKEGLVEVEEANVVRHNAEGFNEVETGTNSAGTVQIS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>