Mapoly0015s0005



Description

plant G-box-binding factor

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0005634 Nucleus
GO GO:0006351 Transcription, DNA-dependent
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
KEGGORTH K09060 Plant G-box-binding factor
OrthoMCL OG5_168160
PFAM PF00170 BZIP transcription factor
PFAM PF07777 G-box binding protein MFMR
PANTHER PTHR22952 CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED
PANTHER PTHR22952:SF47 OS01G0808100 PROTEIN

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP4 transcription factor, bZIP Mapoly0015s0005.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0015s0005.1 scaffold_15:78219..81321  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0015s0005.1  

Gene structure:

mRNA scaffold_15:78219..81321  ( + strand )
five_prime_UTR scaffold_15:78219..79200  ( + strand )
CDS scaffold_15:79201..80508  ( + strand )
three_prime_UTR scaffold_15:80509..81321  ( + strand )

Sequences:

Gene

>Mapoly0015s0005.1
CAGACGTCGTTGGCAGCCATATCAGCAGATTCACGCTCACTTAGGTTGGGAAGAGCGTGAGAGAGTTGAATCGATGCTCGTTGGCAGCCATCTCAGCAGATTCATGCTTGTTGGGCTGCAAGGATATTGATCGCTGCTCGTTGGCAGCCATATCAGCAGATTCACGGTCTTTTAGTGCGCACGGAGCGGGCGAGCGATTGTCATCGATGCTCGTTGGCAGCCATATCAGCAAACACACGGTCGTTTAGCGCGCCCGAGCGCGAGTGTGCGGGGGATCGTTGTTTGTTGGCGTCCATATCAGCCGATTTGCGGGCGCCGGGGTCAAAGGTTCGGATCGGCGTTGCTCGGTGTCAGGCCATATCAGCAGATGCATGTCCTCTCAGACAGCAGCGGACGACCCCCTCGCAGCGCAGGCCTCTGCCTCTGATCGACGAGCGCGAGCGCGAGCACTAGCGCGACCGGATCTTGTCTTGCCCGGCGTGCGCCTCTGGTCCGAGTAGGGCGTTTTTATCGTACTATAGTCTTTTTAATCGAATTCCGGTCGGGCCCGAGCGTCGGACGAGCAAGTCAATCGGGCCTTTTGCCGTTCAAACGGGGCCTCGATCGTTTTGTCGCGGGAAAGCGTTGTCTCGTGCGTTTGCGCAGCCGTCAGTCCGTCGAGACTAATTGCGCCAATGACGTGACCCCGGGGGCCGGCCCCTCGAGAGATTAGAGCTGCTGCTGCTGCTACCGCCTCGGAGTCTGTCATGTTGTCAGCTCGATGACGAGCGGCAAAGAACGAGCCTTTTTCCCGTTAGCGCACCAGGCCGGAGCGGAGTCTTTGACAGGTTTTTTCTAGCGTCGGAGCGGGGCAGGCAGGCCGGCGAATTTGCTCCGGGCTCGCGGCTCGGAATCAGTCTGGCAAGAACCGGGGCTTCATGTCTTTGTCGTGAGGAATTACGTGCACGAGTGGCCCAACATTCAAGACGTTGCCGAATTAAAGATGGGGACAGGCGAAACCGGAACGCCCACGAAGGCTGCCAAAGTCTCCACCACGCAAGAGCAGCAAACCACTCCGACGCCCTACGCGGAATGGGGCGCGGCATTCCAGGCGTATTACAATTCCGGAGGTCAACCACCGCCGGGCTATTTTCCTCCCTCGGTCGGCTCGGGGCCGCAACCCCACCCGTACATGTGGGGCGGGCAGCCAATGATGCCGGGGTATGGCACGCCCGCGCCACCCTACGGTGCCATGTATCCGCACGGAGGCATGTACTCGCATCCCTCGATGCCCCCCGGAGCTCACCCCTACTCGCAGTATGGAATGCCCTCGCCCGGCGGGGCAATTGCGAGTGAGGCCACAGCGACCACCCCCGCGGGAGGCGAAGGCGAAGGGACCAAGGTGGCGGACCGGTTGAAGAACAGACTTCCTCTGAAGCGGTCCAAGGGCAGTGATGGTGGCAAAGGCAATTCCGGGTCGGCCGACGGCGTGTTCTCGCAGAGCGGCGAAGGCGAAAGTGGCAGCGAGGGATCGAGCGAAGGGAGCGACGATGACAACTCGCAAAGCATGCTTCGGCAGAGGAGTTTTGAACAGATGACCCTCGAGAGCGCCATCGTGGTGGCGGGCGCCCCCGCGCCTGCTTACAGCAACCAGCAGCCCGGGTTCGTGAATCTTGCCGTGGGCAGTGGAGGAGCTGCCGGGGCGCAATTCGGCATGCCAGGCAAAGGATCCGGAGGCAGTGGAACCAATCTGGCTGGGATGAACAGCGGCAAGAAGGGCAAGCGACCCTCGGCCAGCAGCTCCGGTGGGATGGTGCCAACGACTCCCGGGACGCCTCTGAAGGGCAGCAGCGGCCGGGATGGGGTACCTCCGGAGTTGTGGTTGCAAGATGAGCGTGAGGTCAAACGGCAAAGACGGAAACAATCGAACAGGGAGTCAGCAAGACGGTCTCGCTTGCGTAAGCAGGCGGAGTGCGAGGAACTGGGCACTCGGGTCGACACTTTGACCGTGGAAAACATGGCTCTGAGGACAGAATTAGCACGGGTTTCGGAGGAATGCAAGAAAATGAAAGCCGACAATGCAGCCCTGTTTGCGCAGCTGCGCAAGCAAGCGAACACGAACAATGTGGCCGAGGAAGCTGCCGAAGATGCACAGGCCGTGCAAACCGAAGGTAATGGCAAGGCGCAAGACGGCAGTCCCAGACGGAACCCAAGCAGGAACGAGGAAGAGGCCTCAGGAGATTCTCCCACGAAAGCCCCCGCTTCTGCAGAAGCAGGAACGACGCCGGCAGAAGCTGTAGCTGCCGGATAATCTTTGGTTGCGGACGTCAAGCATGAGGAGCTTATTTGTTTTACACGTAAGTGACGTGTCCGATTTATTCTTGCACTAGATCAGGGTTTCAATGTTCTAAAGAGAGATTGAAATCCGAAGGGGGTGAAGTTAAGATATCGGGGATTCACACTCAGGCGTAACAATTTTGAGGCTGAGTAGAGTCAAACAGGGGCCGAGTAGAGTTTAATCATTAGGAGAGTAGAACTTATGAGCTGGACCAAGTGAAAGGCACTGGCCACATGGACATGATAATTTAGAGTGGCATCCACATGAATTGAAGAGGCGGTCCTGCCATGATTGTCCCATGCTTGAGCACTAATGAAGGAAATACAGGGGGCTCACTTGAGAGCCAATGCTGTGTCTTGATTGTCCTGGATGTATATAACTTAGCTGAATGTGGAAGCGTCTTCTTGGTTTCAAGATTACATGTAGCCCGTGCCGTACAAGCATTTAGAGAGCCCGCGGTGGCGTTGAGAATATGTACGAGGAAAACTCCACTCGCTTCAGACGTAGTGGACGTTTTAAGCAGGTGGTGCTTCAATTTTGTAGACCAGGGACTTGGTTTGTGCGCCGGAGAGACGATAATCTGATAGCATAGGGATGTGGGTCGTCTGCATCTTTTGGCAAAGATTTCAGTATACTGAGCGTTGGTCATGGGACGCACTTCTGCTGTAATTTGTGCATAAACGGCTCGTGTGCACGATGTGTGATCGCACGCGCCAACGGTGTAAATGAAGCTATATGATTCAAAGCAAATTTGGTGTCGCCGATTTTTCGATTAGAGAATTGTTG

mRNA

>Mapoly0015s0005.1
CAGACGTCGTTGGCAGCCATATCAGCAGATTCACGCTCACTTAGGTTGGGAAGAGCGTGAGAGAGTTGAATCGATGCTCGTTGGCAGCCATCTCAGCAGATTCATGCTTGTTGGGCTGCAAGGATATTGATCGCTGCTCGTTGGCAGCCATATCAGCAGATTCACGGTCTTTTAGTGCGCACGGAGCGGGCGAGCGATTGTCATCGATGCTCGTTGGCAGCCATATCAGCAAACACACGGTCGTTTAGCGCGCCCGAGCGCGAGTGTGCGGGGGATCGTTGTTTGTTGGCGTCCATATCAGCCGATTTGCGGGCGCCGGGGTCAAAGGTTCGGATCGGCGTTGCTCGGTGTCAGGCCATATCAGCAGATGCATGTCCTCTCAGACAGCAGCGGACGACCCCCTCGCAGCGCAGGCCTCTGCCTCTGATCGACGAGCGCGAGCGCGAGCACTAGCGCGACCGGATCTTGTCTTGCCCGGCGTGCGCCTCTGGTCCGAGTAGGGCGTTTTTATCGTACTATAGTCTTTTTAATCGAATTCCGGTCGGGCCCGAGCGTCGGACGAGCAAGTCAATCGGGCCTTTTGCCGTTCAAACGGGGCCTCGATCGTTTTGTCGCGGGAAAGCGTTGTCTCGTGCGTTTGCGCAGCCGTCAGTCCGTCGAGACTAATTGCGCCAATGACGTGACCCCGGGGGCCGGCCCCTCGAGAGATTAGAGCTGCTGCTGCTGCTACCGCCTCGGAGTCTGTCATGTTGTCAGCTCGATGACGAGCGGCAAAGAACGAGCCTTTTTCCCGTTAGCGCACCAGGCCGGAGCGGAGTCTTTGACAGGTTTTTTCTAGCGTCGGAGCGGGGCAGGCAGGCCGGCGAATTTGCTCCGGGCTCGCGGCTCGGAATCAGTCTGGCAAGAACCGGGGCTTCATGTCTTTGTCGTGAGGAATTACGTGCACGAGTGGCCCAACATTCAAGACGTTGCCGAATTAAAGATGGGGACAGGCGAAACCGGAACGCCCACGAAGGCTGCCAAAGTCTCCACCACGCAAGAGCAGCAAACCACTCCGACGCCCTACGCGGAATGGGGCGCGGCATTCCAGGCGTATTACAATTCCGGAGGTCAACCACCGCCGGGCTATTTTCCTCCCTCGGTCGGCTCGGGGCCGCAACCCCACCCGTACATGTGGGGCGGGCAGCCAATGATGCCGGGGTATGGCACGCCCGCGCCACCCTACGGTGCCATGTATCCGCACGGAGGCATGTACTCGCATCCCTCGATGCCCCCCGGAGCTCACCCCTACTCGCAGTATGGAATGCCCTCGCCCGGCGGGGCAATTGCGAGTGAGGCCACAGCGACCACCCCCGCGGGAGGCGAAGGCGAAGGGACCAAGGTGGCGGACCGGTTGAAGAACAGACTTCCTCTGAAGCGGTCCAAGGGCAGTGATGGTGGCAAAGGCAATTCCGGGTCGGCCGACGGCGTGTTCTCGCAGAGCGGCGAAGGCGAAAGTGGCAGCGAGGGATCGAGCGAAGGGAGCGACGATGACAACTCGCAAAGCATGCTTCGGCAGAGGAGTTTTGAACAGATGACCCTCGAGAGCGCCATCGTGGTGGCGGGCGCCCCCGCGCCTGCTTACAGCAACCAGCAGCCCGGGTTCGTGAATCTTGCCGTGGGCAGTGGAGGAGCTGCCGGGGCGCAATTCGGCATGCCAGGCAAAGGATCCGGAGGCAGTGGAACCAATCTGGCTGGGATGAACAGCGGCAAGAAGGGCAAGCGACCCTCGGCCAGCAGCTCCGGTGGGATGGTGCCAACGACTCCCGGGACGCCTCTGAAGGGCAGCAGCGGCCGGGATGGGGTACCTCCGGAGTTGTGGTTGCAAGATGAGCGTGAGGTCAAACGGCAAAGACGGAAACAATCGAACAGGGAGTCAGCAAGACGGTCTCGCTTGCGTAAGCAGGCGGAGTGCGAGGAACTGGGCACTCGGGTCGACACTTTGACCGTGGAAAACATGGCTCTGAGGACAGAATTAGCACGGGTTTCGGAGGAATGCAAGAAAATGAAAGCCGACAATGCAGCCCTGTTTGCGCAGCTGCGCAAGCAAGCGAACACGAACAATGTGGCCGAGGAAGCTGCCGAAGATGCACAGGCCGTGCAAACCGAAGGTAATGGCAAGGCGCAAGACGGCAGTCCCAGACGGAACCCAAGCAGGAACGAGGAAGAGGCCTCAGGAGATTCTCCCACGAAAGCCCCCGCTTCTGCAGAAGCAGGAACGACGCCGGCAGAAGCTGTAGCTGCCGGATAATCTTTGGTTGCGGACGTCAAGCATGAGGAGCTTATTTGTTTTACACGTAAGTGACGTGTCCGATTTATTCTTGCACTAGATCAGGGTTTCAATGTTCTAAAGAGAGATTGAAATCCGAAGGGGGTGAAGTTAAGATATCGGGGATTCACACTCAGGCGTAACAATTTTGAGGCTGAGTAGAGTCAAACAGGGGCCGAGTAGAGTTTAATCATTAGGAGAGTAGAACTTATGAGCTGGACCAAGTGAAAGGCACTGGCCACATGGACATGATAATTTAGAGTGGCATCCACATGAATTGAAGAGGCGGTCCTGCCATGATTGTCCCATGCTTGAGCACTAATGAAGGAAATACAGGGGGCTCACTTGAGAGCCAATGCTGTGTCTTGATTGTCCTGGATGTATATAACTTAGCTGAATGTGGAAGCGTCTTCTTGGTTTCAAGATTACATGTAGCCCGTGCCGTACAAGCATTTAGAGAGCCCGCGGTGGCGTTGAGAATATGTACGAGGAAAACTCCACTCGCTTCAGACGTAGTGGACGTTTTAAGCAGGTGGTGCTTCAATTTTGTAGACCAGGGACTTGGTTTGTGCGCCGGAGAGACGATAATCTGATAGCATAGGGATGTGGGTCGTCTGCATCTTTTGGCAAAGATTTCAGTATACTGAGCGTTGGTCATGGGACGCACTTCTGCTGTAATTTGTGCATAAACGGCTCGTGTGCACGATGTGTGATCGCACGCGCCAACGGTGTAAATGAAGCTATATGATTCAAAGCAAATTTGGTGTCGCCGATTTTTCGATTAGAGAATTGTTG

CDS

>Mapoly0015s0005.1
ATGGGGACAGGCGAAACCGGAACGCCCACGAAGGCTGCCAAAGTCTCCACCACGCAAGAGCAGCAAACCACTCCGACGCCCTACGCGGAATGGGGCGCGGCATTCCAGGCGTATTACAATTCCGGAGGTCAACCACCGCCGGGCTATTTTCCTCCCTCGGTCGGCTCGGGGCCGCAACCCCACCCGTACATGTGGGGCGGGCAGCCAATGATGCCGGGGTATGGCACGCCCGCGCCACCCTACGGTGCCATGTATCCGCACGGAGGCATGTACTCGCATCCCTCGATGCCCCCCGGAGCTCACCCCTACTCGCAGTATGGAATGCCCTCGCCCGGCGGGGCAATTGCGAGTGAGGCCACAGCGACCACCCCCGCGGGAGGCGAAGGCGAAGGGACCAAGGTGGCGGACCGGTTGAAGAACAGACTTCCTCTGAAGCGGTCCAAGGGCAGTGATGGTGGCAAAGGCAATTCCGGGTCGGCCGACGGCGTGTTCTCGCAGAGCGGCGAAGGCGAAAGTGGCAGCGAGGGATCGAGCGAAGGGAGCGACGATGACAACTCGCAAAGCATGCTTCGGCAGAGGAGTTTTGAACAGATGACCCTCGAGAGCGCCATCGTGGTGGCGGGCGCCCCCGCGCCTGCTTACAGCAACCAGCAGCCCGGGTTCGTGAATCTTGCCGTGGGCAGTGGAGGAGCTGCCGGGGCGCAATTCGGCATGCCAGGCAAAGGATCCGGAGGCAGTGGAACCAATCTGGCTGGGATGAACAGCGGCAAGAAGGGCAAGCGACCCTCGGCCAGCAGCTCCGGTGGGATGGTGCCAACGACTCCCGGGACGCCTCTGAAGGGCAGCAGCGGCCGGGATGGGGTACCTCCGGAGTTGTGGTTGCAAGATGAGCGTGAGGTCAAACGGCAAAGACGGAAACAATCGAACAGGGAGTCAGCAAGACGGTCTCGCTTGCGTAAGCAGGCGGAGTGCGAGGAACTGGGCACTCGGGTCGACACTTTGACCGTGGAAAACATGGCTCTGAGGACAGAATTAGCACGGGTTTCGGAGGAATGCAAGAAAATGAAAGCCGACAATGCAGCCCTGTTTGCGCAGCTGCGCAAGCAAGCGAACACGAACAATGTGGCCGAGGAAGCTGCCGAAGATGCACAGGCCGTGCAAACCGAAGGTAATGGCAAGGCGCAAGACGGCAGTCCCAGACGGAACCCAAGCAGGAACGAGGAAGAGGCCTCAGGAGATTCTCCCACGAAAGCCCCCGCTTCTGCAGAAGCAGGAACGACGCCGGCAGAAGCTGTAGCTGCCGGATAA

Protein

>Mapoly0015s0005.1
MGTGETGTPTKAAKVSTTQEQQTTPTPYAEWGAAFQAYYNSGGQPPPGYFPPSVGSGPQPHPYMWGGQPMMPGYGTPAPPYGAMYPHGGMYSHPSMPPGAHPYSQYGMPSPGGAIASEATATTPAGGEGEGTKVADRLKNRLPLKRSKGSDGGKGNSGSADGVFSQSGEGESGSEGSSEGSDDDNSQSMLRQRSFEQMTLESAIVVAGAPAPAYSNQQPGFVNLAVGSGGAAGAQFGMPGKGSGGSGTNLAGMNSGKKGKRPSASSSGGMVPTTPGTPLKGSSGRDGVPPELWLQDEREVKRQRRKQSNRESARRSRLRKQAECEELGTRVDTLTVENMALRTELARVSEECKKMKADNAALFAQLRKQANTNNVAEEAAEDAQAVQTEGNGKAQDGSPRRNPSRNEEEASGDSPTKAPASAEAGTTPAEAVAAG

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>