Mapoly0015s0164



Description

B3 DNA binding domain

Reference DB

Database ID Description
GO GO:0003677 DNA binding
OrthoMCL OG5_144888
PFAM PF02362 B3 DNA binding domain
PANTHER PTHR31391 FAMILY NOT NAMED
PANTHER PTHR31391:SF4

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpB3-2 transcription factor, B3 Mapoly0015s0164.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0015s0164.1 scaffold_15:1728613..1735018  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0015s0164.1  

Gene structure:

mRNA scaffold_15:1728613..1735018  ( + strand )
five_prime_UTR scaffold_15:1728613..1729269  ( + strand )
five_prime_UTR scaffold_15:1729646..1729795  ( + strand )
five_prime_UTR scaffold_15:1729906..1730032  ( + strand )
five_prime_UTR scaffold_15:1730334..1730349  ( + strand )
CDS scaffold_15:1730350..1730451  ( + strand )
CDS scaffold_15:1732022..1732096  ( + strand )
CDS scaffold_15:1732190..1732270  ( + strand )
CDS scaffold_15:1732731..1732768  ( + strand )
CDS scaffold_15:1732955..1733102  ( + strand )
CDS scaffold_15:1733314..1733517  ( + strand )
CDS scaffold_15:1733668..1734576  ( + strand )
three_prime_UTR scaffold_15:1734577..1735018  ( + strand )

Sequences:

Gene

>Mapoly0015s0164.1
AATTATGGCCACTGTCAGGGCACTGTAGTGTAGATACTGAATCCGAGGAGAGGATTTGTCGGTTCCCGCGCTCGATTGACTGCGAAGTTGCTCTACGCCGCACTGCAGTCCGCAGCAAGAGAGGAGCGCGCGAGAGCGGGAGGCAGGCATTCAAATGAAGTTCGACGCTGCGGCTCTGTGGTCGACAGTTCGACCACTTCCTCGTCTGTCATTATGTCCGTGCTGCAACTCTAGGCTGGGAAGGTTGCATTCTGGGAGATGCTACTCTAGGTCCGAGAGTCCAGAAGGGTGCTCGTGGACAAATTGTTCACCTGAATATTGCAAGATTCGGTCTGGCGGTGCTTGTGAGTTAATTCCCGCACCTAAGAAATGGATTTGGTTGCGCTCCCTGTCTTTCAATGATTTCCACACATGTATCACATACCTGATCGTTGCGAGAGGGCGAAGGCGCTAGTGGCCGATTTTTGGTCTTGGAGTACAGAGCACTCTGGAATTGAATCTCAGAGTTTATCTTCGGCTTCCGCCTCCCGCTTGTAAGAGCAAAGAATGCCTGGTTGTCGAGACAGATGGGAGCTGCTTTGATGTCGTGAATGATACATGAGAAATAGAGAGCATGTTTCATCTCACCGGGCCTGTCATCTTAGACACCTGCTCAAGGTGGGCATGCCTCTCCTTCTGTTTCAGATTGTGGATTTCTTCGAGATTGAAGGTCGCGATGAATTTCTCACCGTTGTTTAGAGCAAAATTCTGTTTCCATGGTAGTACGCAGCGTTCTAACATTGCTTCTGATAACGTACAGAAAACTGAGAACGTTTTGTAACTTTCGATTGTAAGAGTTTTGAGAATAGTTTGTTGAGAGTCTGTGGAACGTATCATTTGACTGTGGAGGTGATACAGATTAGCAGCTAGCATTCTGTCGCATTTGAAGAGAGCAGGCCTGTTAATTACTGGTCTAAGTCAAACTGCTGAAAGTCGAAATTGTGACCAATTTCCAAAGAAGCAGTTTTTTACTGATTCCAATCTTTGTACAAAGGCCAATTCGCTGTAATGCAGTGTCTTCAATCTCTCAAGTATAGCCTGAAACAAATTTTTTTCAGACCGAACTACCGGCTGAAGATAAACAAGGGAGTCTTGCACTCCAGGCTGGCCGCTCATAGATGAAAGGCTGTGTAATCTTCCACTGGTAAGTCTTGAACAAGATTGAGGGTACTTATTACTCATCATTTCATTCTGTATCGTAAAAGAGGTTGTGACAAAGATAGTGTTGACTTAACCAGTTTAGCTTGGTGGCAGATGGTGCAGGTGTTGTTTTACGTCGGAACGCATGGTTCAGAGGTAGCTCAAAATTGCAGAGGCCATTCTGAAGAACCGGGATTGGACGTATCATTACTATTGATATGAACTTCACCTTCCTCTGAAAGTGAGCAATCAGCTTCTGTCCACCAGGTTGCACATCTTAAACGGCCATGGATTAATACATTAATGGAAACGGTGTCAAGCTGTACCTGGAATCCAAGCTCATGACTTATTGTTTGCCACTATGGCAAATATAAAATTTTGATGCATACTGTATACAATCTAATTCTGTAGATCTTTAGAGGTGCATAATCATTACCTATTTTCGCAGTAATTATGACAATATATTCACGGTTCCTTGTCATGAGACTTGTGCTCTCAATCAAGTTACGTACGTCTAACTTGAAGGTCGTTGTTTCTTTCAGATTGAACATTCTCAGCATGGCTACTGATTTCCGGCGGGATCTTGAGCCTGCTAGTGGCAAGCTAACTTACGAAGAGGCACGTCTGAAGAGGATCGAAGATAACAAGAAGCGAATGGAGGTGAGTCGTCAGTTCTGACACGGCTAAAGACTCTGTCCCATTTTTGTTGTGTCGCAGGACGATAAAATTTCTGTTAGCTTTAAGGAGAGCGAGGTTGACCCGTCGTCTTCTACCGTAAGGAATTTCATGCAAAGATCGATCAAGCAAGTAGATATGTACCACTCGAGCTGTAAAATTGAATAGTTTTTTGTGACAGTAGTCTCCTTTGATACCAGTAGACCATCGTTTCTTGAAAGCATTGCATCTCCGGGACTTCTTTAAACATTTCGCAGTAGCTGGAATCAGCAGTAGATGTTAGCAAACTCCTTGAATCGACAGGTGTGCAGCTCCGAATTACATATGACGTCTGGGCACTCTCTTCTGCTTTCGAAAACACTGCAGATTAACATACCATCGAGCAATCATGACGTGACTATCCTTCGAAGTAATAACCTTGAAGTTGGACACTTCAGAAGCTTTCTGTTGACTCTTCGGCCACGAGACATGAACAAAAACTCTTGATGTGCAGGTGCAGCTCTGCATTCTAACTCAAAAAATCCGCAGCAATTTATCAGAGCTTAGAGTAGCGGCTTCGCAATTACTCTTTGTGGGCCTCTAGGTGACATAAAGCACTTGGGAGAACACACGGTAATCCCGCGGCAGTCTGAAAACTGTTTACGGTGAACCCATAACCTTAAACAGGAAAGGGAGAACCTATGAAAACACTTCAAAAAATTGAGTGTGGTAGAGATTTTCATTTCGTTGATCTCCCTTTACATGCTCTCAATGTACAGAGCGCAGTTGATAAATTTTCTTCGGACGTCTACTTACAATAGACCTCAAAAGTCAGGTTGAGTAAGCCACTTTTTGTTTAAAAGAATAGATTGACATAAGTATAATGTGCTTCGGGTTTTCTTAAAGTTCAGGACGAAAAATGCGACAGCATTTTTGAAAAGAAATGAAATAGGTGGTAGGATTTTCTGTCCTGACTCAACCCTGTATATTGCCATGATGACGAGCGATGATCACTTTCACTCTGTCGAATTTGGAAATCGGAAGTTATATTATGTAGATAGATGAACACAGAATTGAACGTCGGTCATGGGATAGAGCCATATGTTGCGAATGCACTCCTTCACTGCATACAGTAGAGTTCCCAAGTGATCAAGTCTCGCACGACTGGTTTTCATCGCAAAGTAAACGGTCAGCACTCAAAGCAGTGGGTGTGAGTCGCACATACAGTTCATCCTTACAAACCCGGTGTCACAGAATTGCCAGCAGTAGACCATACGCGTGGTAAGCAAGCAGAGAGTATGGAATATCGAACAGTCCGTACTGGTGTAGTAGTTGCAGGATGAGCTCAGTCTTGCATGGATCAGCTTCTAGCATCTGTAACAGCTGGTAGCGTGTTGCCGGGATAATTTCTTTTCGTCCCGTAGCCATTGGCATAGTCGAATTCGGGAATTAGGGTCTTAGTAGAAATTAAGCGCACTTTGTATTAGTCCTTCCATTTTTTGCAAATTTTTTGGTGTCTCTTTCGGCTGTATTTCGATTTAATAGGCCAGTGATGTGTTCTTTTCCGTTGATGCAGGAACTTGGTTTGAAAGATCAATTGAGTTTGTTTACCAAGAGCCCTTCCAAAACCAACACTCCTAGGAAAGCCATTGTGAGTTTTCCTCATCTCAAACATGATATTGTAACATCTCCGATTTTTTCCCTCACTTATTCAATGATTATGATATTTCCCGCGTATCTACAGAAGAAGAATCTGCAGGAATGTGCGGTCGAAATACGACGTTCACCTAGAGTGACCAGGAAGCCTTCTGTTAACTACTACGAGGTACGCATCCCTTGCAGGACAATGCAACTTTGTAGTTGATTCATTTTATTTTCATTGCCAATTCATAATCAAATTTTCGATTGATCGATTATCAAGCAAGTAGCAAGGTTCCAATACTTCTCTGTCGAAATATCCTGAAATCTTACTCGGGTAAAATGTGAGTGACATTTGAGTGCCTGTGAAGTAGTTGGCTTGGCCAAAGCTTTTCTTGTCTTTAGTTTTCATGATCTTCTAGCGAGGGGAACTAATTACATTTACTCCTTCATGACCGATGACTTGGCAAGTTTTCGACTGAGCAGGTTTCGATAGTTTTTTTAAGGTGTTTGAAAGAACGTGTAAGTGCCCAGGGGGATTATGCAATATTGAACCAGTGCCCTGGAGAAAACACTTTCACAAGGTTTGATGGCTAAATGAAGAGTCACATCAGTAAATTGTCTGTTTGTCTGCGTTTTTCTTTCAGAAAAATCGGGCAGAAGTGGAAGGAACGGGCTGCCCGAGGTAATGTTATTAGAGTTTTTACCAATATAGCTGGGTGCAAGGATGACATAACTCTTACAAATTGATGCAGTCATTACAGATATGAGATCTTTTTTCAGAGGTGGTTACAATTTGCAATTGCATCTGCAAATGGTCCTCTCCCTTAAAATTTGACGATATTTCTAACCTAGCCCTCACGTTCCACAGAAAGAGAATAGGACGAGTACTGAAACGAGGATTTATCTCACCTGCCGCCAGAAGCGAGGCATCTGTGAGGGCTAGCGAGATCAAAACTGGTCATCCATCATTTGTGAAGGCCATGCTAAGATCGCACACTTCCGGGGGATTTTGGCTGGTAGGTTGTTTGCTTCAGGAAAGCAAGGTTTTTGTACTCAGTATCTTACTTTCATAAGTCCTCACAGCAAAGCTGAATACTCTGAAAATTAATTCCCGCTTAGCGTTTGAGTTGTAACCATTTCTTCGGGAATATGCTGGCGGCATCATATTCGTTATCGAAGCTCTGACGATTCAAAGCTGTCGGCCTGACACTGTGGGACACATCGCAGGGCTTGCCAAGTGATTTCTGCATCACGCACTTCAGAAAAGATGAGTTGGTCATCTTGGAAGACGAAGATGGACTTGAATGGGAAACAATTTATTTGCATCATAAGAAAGGCCTTAGTGGAGGATGGAGGGGCTTTTCCATTGACCACGATCTCGAGGATGGGGATGCGGTGGTTTTTGAACTGGTCAAGCCTACTCGATTCAAGGTCGTCACGAGTTTTCTTCCCACTCACATTTTGGCATTCAAGTCACAATAGGAAACGTCTTCTGGACTGAGGGTTATCTCATATCTATGTTCAAGGATGTAACAAGCGATTTTCACAAAACTGCTCACCCAATTTGAACTGGATGGACAGGTACATATTACAAGAGCAGTCGGAAGCAAGAGTCTTGAGTGCACTCCGAATGTTGCCTTACGAAGTAAATCATACAGATATGCTCTTAAGGAGAACAAGGAAAATGAGCATGTAAACTCAGCTTTGCATAAGGTTCTTAAAAGGGAACAGCAGGAAACGGAAGACGCGGAAAACCGTGTCTCAAAAAGGCGTGCAAAGCTCGGGGCAAAAAGTCTCAAGCGTAAGTTGGATTTGTCGGAGGACAGCGCATGCAAATACTCCGTTGGAGACGAGCCATTGCATAAGAAAGTTATCATAGAAGTTTCAGACTCAGACAACGAATCTCCTGGGGACGCAGGACTAAAAGAGAGGCAAAAAAGTTCGGGCCGACGCATCCTCCGTCATCGACCTCCGGCTACGAAAAGCGTAGAGAAGCCGGTTGTCCCTCCCCTCAATGTGAAGATTTCAAAGGGCGAGACTCAGCGAAATAACAAGAATGGAGAGGAGAAGAACGTCCACGAACCGCAGAGGAGGAAGGTGACTGAAGCTATACAAACTCCGGTTGTCGACAAGAAGAAGGGTGTTGTCTTGACGAAGAAGGTTACTGAAGCTATACGAACTCCGGTTGTTGACAAGAAGAAGGGTGTTGTTTTGACGAAGAAGGTGACTGAAGCTATACAACCTCCGTTTGTCGACAAGAAGAAGGGTGTTGTTTTGACGAAGAAAGTGCGTTTTGCTGCGGTGCCCAAGACATCCGCTTGCGCAACCACGAAATCTTCTTTGAAGCTGCCTCCTGGAGCCAAAATAAAGGCATGGGGCGTTTGTAGCATAGCGAGGAACTGTAATATGTCCAGAAAGCTTCCGGGTACAGGTACCCGGAAATACAGCTTCTTCAGCCCTGGGAAAAGACCTGTGGCAAAAGCTCGCTAGCGACGTGTTGGTGGGACTTAATTAAGTCCCACCAAGATGTTGCCGAAAGCACGGTGACTGTCTACTGGTCTGGGTACCGACCAGTAGACAGTCTTGTGTAGATGCTGAATAGAGTCGAGTGAAAGAATGCAGGAAGCCACTTTACACGTGAAGGCCGAAAACTTGCAAAACCTTTCACTCTTGATCGTCTTAAGGAGAAAGAAACAGACGTAGTTAGTGGGGTCACATTTTGTAGCAAAATTGCCTCAGTACCATGGGAGTAGTTTAGTTATAGGAAGAGGAAACATATCAGCATTCGCCCATGTGAAACCCCTAATATTCCGTAGCTTAGACAGTAGAACAATAGAATCACAGTCGGACGAGCATCAATGTAATGTAGGAAGTCAGTTACAACCTTGAAAGTAATTTAAAGATTGCACTTGTTTGCCGAAAAAACATCCAC

mRNA

>Mapoly0015s0164.1
AATTATGGCCACTGTCAGGGCACTGTAGTGTAGATACTGAATCCGAGGAGAGGATTTGTCGGTTCCCGCGCTCGATTGACTGCGAAGTTGCTCTACGCCGCACTGCAGTCCGCAGCAAGAGAGGAGCGCGCGAGAGCGGGAGGCAGGCATTCAAATGAAGTTCGACGCTGCGGCTCTGTGGTCGACAGTTCGACCACTTCCTCGTCTGTCATTATGTCCGTGCTGCAACTCTAGGCTGGGAAGGTTGCATTCTGGGAGATGCTACTCTAGGTCCGAGAGTCCAGAAGGGTGCTCGTGGACAAATTGTTCACCTGAATATTGCAAGATTCGGTCTGGCGGTGCTTGTGAGTTAATTCCCGCACCTAAGAAATGGATTTGGTTGCGCTCCCTGTCTTTCAATGATTTCCACACATGTATCACATACCTGATCGTTGCGAGAGGGCGAAGGCGCTAGTGGCCGATTTTTGGTCTTGGAGTACAGAGCACTCTGGAATTGAATCTCAGAGTTTATCTTCGGCTTCCGCCTCCCGCTTGTAAGAGCAAAGAATGCCTGGTTGTCGAGACAGATGGGAGCTGCTTTGATGTCGTGAATGATACATGAGAAATAGAGAGCATGTTTCATCTCACCGGGCCTGTCATCTTAGACACCTGCTCAAGGCCAATTCGCTGTAATGCAGTGTCTTCAATCTCTCAAGTATAGCCTGAAACAAATTTTTTTCAGACCGAACTACCGGCTGAAGATAAACAAGGGAGTCTTGCACTCCAGGCTGGCCGCTCATAGATGAAAGGCTGTGTAATCTTCCACTGATGGTGCAGGTGTTGTTTTACGTCGGAACGCATGGTTCAGAGGTAGCTCAAAATTGCAGAGGCCATTCTGAAGAACCGGGATTGGACGTATCATTACTATTGATATGAACTTCACCTTCCTCTGAAAATTGAACATTCTCAGCATGGCTACTGATTTCCGGCGGGATCTTGAGCCTGCTAGTGGCAAGCTAACTTACGAAGAGGCACGTCTGAAGAGGATCGAAGATAACAAGAAGCGAATGGAGGAACTTGGTTTGAAAGATCAATTGAGTTTGTTTACCAAGAGCCCTTCCAAAACCAACACTCCTAGGAAAGCCATTAAGAAGAATCTGCAGGAATGTGCGGTCGAAATACGACGTTCACCTAGAGTGACCAGGAAGCCTTCTGTTAACTACTACGAGAAAAATCGGGCAGAAGTGGAAGGAACGGGCTGCCCGAGAAAGAGAATAGGACGAGTACTGAAACGAGGATTTATCTCACCTGCCGCCAGAAGCGAGGCATCTGTGAGGGCTAGCGAGATCAAAACTGGTCATCCATCATTTGTGAAGGCCATGCTAAGATCGCACACTTCCGGGGGATTTTGGCTGGGCTTGCCAAGTGATTTCTGCATCACGCACTTCAGAAAAGATGAGTTGGTCATCTTGGAAGACGAAGATGGACTTGAATGGGAAACAATTTATTTGCATCATAAGAAAGGCCTTAGTGGAGGATGGAGGGGCTTTTCCATTGACCACGATCTCGAGGATGGGGATGCGGTGGTTTTTGAACTGGTCAAGCCTACTCGATTCAAGGTACATATTACAAGAGCAGTCGGAAGCAAGAGTCTTGAGTGCACTCCGAATGTTGCCTTACGAAGTAAATCATACAGATATGCTCTTAAGGAGAACAAGGAAAATGAGCATGTAAACTCAGCTTTGCATAAGGTTCTTAAAAGGGAACAGCAGGAAACGGAAGACGCGGAAAACCGTGTCTCAAAAAGGCGTGCAAAGCTCGGGGCAAAAAGTCTCAAGCGTAAGTTGGATTTGTCGGAGGACAGCGCATGCAAATACTCCGTTGGAGACGAGCCATTGCATAAGAAAGTTATCATAGAAGTTTCAGACTCAGACAACGAATCTCCTGGGGACGCAGGACTAAAAGAGAGGCAAAAAAGTTCGGGCCGACGCATCCTCCGTCATCGACCTCCGGCTACGAAAAGCGTAGAGAAGCCGGTTGTCCCTCCCCTCAATGTGAAGATTTCAAAGGGCGAGACTCAGCGAAATAACAAGAATGGAGAGGAGAAGAACGTCCACGAACCGCAGAGGAGGAAGGTGACTGAAGCTATACAAACTCCGGTTGTCGACAAGAAGAAGGGTGTTGTCTTGACGAAGAAGGTTACTGAAGCTATACGAACTCCGGTTGTTGACAAGAAGAAGGGTGTTGTTTTGACGAAGAAGGTGACTGAAGCTATACAACCTCCGTTTGTCGACAAGAAGAAGGGTGTTGTTTTGACGAAGAAAGTGCGTTTTGCTGCGGTGCCCAAGACATCCGCTTGCGCAACCACGAAATCTTCTTTGAAGCTGCCTCCTGGAGCCAAAATAAAGGCATGGGGCGTTTGTAGCATAGCGAGGAACTGTAATATGTCCAGAAAGCTTCCGGGTACAGGTACCCGGAAATACAGCTTCTTCAGCCCTGGGAAAAGACCTGTGGCAAAAGCTCGCTAGCGACGTGTTGGTGGGACTTAATTAAGTCCCACCAAGATGTTGCCGAAAGCACGGTGACTGTCTACTGGTCTGGGTACCGACCAGTAGACAGTCTTGTGTAGATGCTGAATAGAGTCGAGTGAAAGAATGCAGGAAGCCACTTTACACGTGAAGGCCGAAAACTTGCAAAACCTTTCACTCTTGATCGTCTTAAGGAGAAAGAAACAGACGTAGTTAGTGGGGTCACATTTTGTAGCAAAATTGCCTCAGTACCATGGGAGTAGTTTAGTTATAGGAAGAGGAAACATATCAGCATTCGCCCATGTGAAACCCCTAATATTCCGTAGCTTAGACAGTAGAACAATAGAATCACAGTCGGACGAGCATCAATGTAATGTAGGAAGTCAGTTACAACCTTGAAAGTAATTTAAAGATTGCACTTGTTTGCCGAAAAAACATCCAC

CDS

>Mapoly0015s0164.1
ATGGCTACTGATTTCCGGCGGGATCTTGAGCCTGCTAGTGGCAAGCTAACTTACGAAGAGGCACGTCTGAAGAGGATCGAAGATAACAAGAAGCGAATGGAGGAACTTGGTTTGAAAGATCAATTGAGTTTGTTTACCAAGAGCCCTTCCAAAACCAACACTCCTAGGAAAGCCATTAAGAAGAATCTGCAGGAATGTGCGGTCGAAATACGACGTTCACCTAGAGTGACCAGGAAGCCTTCTGTTAACTACTACGAGAAAAATCGGGCAGAAGTGGAAGGAACGGGCTGCCCGAGAAAGAGAATAGGACGAGTACTGAAACGAGGATTTATCTCACCTGCCGCCAGAAGCGAGGCATCTGTGAGGGCTAGCGAGATCAAAACTGGTCATCCATCATTTGTGAAGGCCATGCTAAGATCGCACACTTCCGGGGGATTTTGGCTGGGCTTGCCAAGTGATTTCTGCATCACGCACTTCAGAAAAGATGAGTTGGTCATCTTGGAAGACGAAGATGGACTTGAATGGGAAACAATTTATTTGCATCATAAGAAAGGCCTTAGTGGAGGATGGAGGGGCTTTTCCATTGACCACGATCTCGAGGATGGGGATGCGGTGGTTTTTGAACTGGTCAAGCCTACTCGATTCAAGGTACATATTACAAGAGCAGTCGGAAGCAAGAGTCTTGAGTGCACTCCGAATGTTGCCTTACGAAGTAAATCATACAGATATGCTCTTAAGGAGAACAAGGAAAATGAGCATGTAAACTCAGCTTTGCATAAGGTTCTTAAAAGGGAACAGCAGGAAACGGAAGACGCGGAAAACCGTGTCTCAAAAAGGCGTGCAAAGCTCGGGGCAAAAAGTCTCAAGCGTAAGTTGGATTTGTCGGAGGACAGCGCATGCAAATACTCCGTTGGAGACGAGCCATTGCATAAGAAAGTTATCATAGAAGTTTCAGACTCAGACAACGAATCTCCTGGGGACGCAGGACTAAAAGAGAGGCAAAAAAGTTCGGGCCGACGCATCCTCCGTCATCGACCTCCGGCTACGAAAAGCGTAGAGAAGCCGGTTGTCCCTCCCCTCAATGTGAAGATTTCAAAGGGCGAGACTCAGCGAAATAACAAGAATGGAGAGGAGAAGAACGTCCACGAACCGCAGAGGAGGAAGGTGACTGAAGCTATACAAACTCCGGTTGTCGACAAGAAGAAGGGTGTTGTCTTGACGAAGAAGGTTACTGAAGCTATACGAACTCCGGTTGTTGACAAGAAGAAGGGTGTTGTTTTGACGAAGAAGGTGACTGAAGCTATACAACCTCCGTTTGTCGACAAGAAGAAGGGTGTTGTTTTGACGAAGAAAGTGCGTTTTGCTGCGGTGCCCAAGACATCCGCTTGCGCAACCACGAAATCTTCTTTGAAGCTGCCTCCTGGAGCCAAAATAAAGGCATGGGGCGTTTGTAGCATAGCGAGGAACTGTAATATGTCCAGAAAGCTTCCGGGTACAGGTACCCGGAAATACAGCTTCTTCAGCCCTGGGAAAAGACCTGTGGCAAAAGCTCGCTAG

Protein

>Mapoly0015s0164.1
MATDFRRDLEPASGKLTYEEARLKRIEDNKKRMEELGLKDQLSLFTKSPSKTNTPRKAIKKNLQECAVEIRRSPRVTRKPSVNYYEKNRAEVEGTGCPRKRIGRVLKRGFISPAARSEASVRASEIKTGHPSFVKAMLRSHTSGGFWLGLPSDFCITHFRKDELVILEDEDGLEWETIYLHHKKGLSGGWRGFSIDHDLEDGDAVVFELVKPTRFKVHITRAVGSKSLECTPNVALRSKSYRYALKENKENEHVNSALHKVLKREQQETEDAENRVSKRRAKLGAKSLKRKLDLSEDSACKYSVGDEPLHKKVIIEVSDSDNESPGDAGLKERQKSSGRRILRHRPPATKSVEKPVVPPLNVKISKGETQRNNKNGEEKNVHEPQRRKVTEAIQTPVVDKKKGVVLTKKVTEAIRTPVVDKKKGVVLTKKVTEAIQPPFVDKKKGVVLTKKVRFAAVPKTSACATTKSSLKLPPGAKIKAWGVCSIARNCNMSRKLPGTGTRKYSFFSPGKRPVAKAR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>