Mapoly0016s0098



Description

bZIP transcription factor

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
OrthoMCL OG5_164383
PFAM PF00170 BZIP transcription factor

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP5 transcription factor, bZIP Mapoly0016s0098.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0016s0098.1 scaffold_16:953769..958998  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0016s0098.2 scaffold_16:953769..958998  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0016s0098.1  

Gene structure:

mRNA scaffold_16:953769..958998  ( - strand )
three_prime_UTR scaffold_16:953769..954362  ( - strand )
CDS scaffold_16:954363..955298  ( - strand )
CDS scaffold_16:955466..955531  ( - strand )
CDS scaffold_16:955683..955748  ( - strand )
CDS scaffold_16:955965..956042  ( - strand )
CDS scaffold_16:956187..956519  ( - strand )
CDS scaffold_16:956667..957425  ( - strand )
five_prime_UTR scaffold_16:957426..957469  ( - strand )
five_prime_UTR scaffold_16:957631..958998  ( - strand )

Sequences:

Gene

>Mapoly0016s0098.1
CGGAGGGAGCTAGCCGCGCGGAGGAGAAAAGCGAGCCACGGGCGAAAGCGAGCGAGCGAAAGCGAGAGCCAGAGGAAGAGTGCGACCGAGCGAGAGAGGGAGAGAGGGAGAGAGGGACGGGTAAAGGAGAAGGAGGAGGAGGACGAGGAGTCCGGGCAGGGATTGCTACGCTACCTGTACGGGGCTCGCCGCTCGCTCGCCTGACTGACTTGTGGCACGACTGAATTCTCGCGTCGAGGGGAGACAGCACCGTCCGGTGGACGAGGTGGAAAGCTGGGATTCAATTGGTGCGTTGGCCTTGTGAGGCCTCTCACTGGAGCGCGCACACCACTTGCTCTGGGCTGCCGCCGGGGTGAATATTGGGCCCTGACCCATCCGGATTCAGAGTCGGACACGGCTGCGTTCGCCTTTAGTGCCCGCCCCGGTGTTGGGCTTTCCCCCCTGCCTGCTCGCCTGGTTCTTCTCGGCCGAGTGCTGCTGCCACTCCTCTAGTCGCTGAGTCGCCCTCACACCGGGCCTGCTGCGTGTGCTGCTTGCCCTTCAACTCCCTTCCTCCTTCCCTTCCAGAGGGAAGGGCTGAAAAAGCAAGAGTATCGGAGGAGAGGGCGCTTTTGCAATCTACTTACTTGTCTACGCTTTCTGTTGGCTGTCCGCCTGGCGCATCGTAGGAGCAAGGAAGGTCACGTTGCCCTTGGGTGAGAGAAGAGAGAGAGGAGGGAGGAGAGGGCAGGAGAGTTGTAGTCTCGGACGGGAGAGGAGAAAAGAGAGGCAGTCAGACGGGGGCCTGCCAGAGAGTCGAGTCGACTGTGGCCGAAGCATTGTGCGAGTGAGTGAGTGAGTGAGTGTGGCGCATTTCTCCGAGTTGCGTCTCGTTGCGTCTCGTTGCGGCTCGCCGCGTTGCAGACGAGGAGGAGAAGCGAGAAAGAGGGAGCGAGCGGGAGACGGAGAGTGTTTGTGTCGGCGTGTGCTCACGTGGGAGCGAGCGAAAGGAGGCGGGGCGGTGAAATTGCTATTTGTGCATTGCGTTTGAACGGGAGAGCCTTCGCGTGGTTTTCGTGCAGAGTGGATCTAAAGCAGAGCTTCGCCCCGCCTTTCCGCACTCTTCTTCTTCCCGTGCTTGCTCTCTGGTCTCGACTGTGATCTCTAGCTAGCCAGCGCTCAGGCGTGGAACGTTTCTTTGTCGGGAAAAGAGGCTTCATGCTCTACTCTCATCACCAGCTTTCTATCGTCAGCGAAGTACGTGGATCTGTCTTCAATGAAATGCCCGTTCAGCCGAGTTGTTGTGGCAGGGACGAAGCTTTGACAAGAACGTACGTTAACCAAATCTTTATCAAAGGATAACACTCGCTTAATGCGTAGAACCTCTCGGTACGTGAGTGACAAAGGGCAGCCTCTTTCCATTTGATACATACACTTGCGGTTGTACACCTGGTTTCAGAATTCCTGATAATATATGCACATAGTTAGCCAGCGCTCAGGCGGGGTGCATTGTTCGCTAAGTTGACTGACAGGGTGTTTGGTGTTTGCAGTGTGTGACAGAGTGTGGTGTTTCGAAAGCTGTTTGGTAGAAGATATGGCTTCAGGTGTAACTGTCCTGCCATCTACCAGTGCTGGCGGGAAGCCTAGCGATGGGAGCCGTCAAAAGAGAAAGATTGCGGCTGGACTTCCGAATGTTCGGAAGAGAGTTTGTGTTCCCAAAGATGCCGTGAAAGTCGAAGCAGCGAGGAGCGCAGGCTCCTCGAAACCTTTCGTGACTAAAAGGAAGGATAGGATAGATGATGAAAATACGGGAGATTCCTCTCTGGAGTTGGACGCCGCTAGGGCTCTGACTCAGATGCAAACACAGGTATTGAAGATTATCGAAGAAAGGCCCGTGTTGACTTTGAAGGTCGTTGCACCGCTTCCCCAGTGGTCGAGGAAAAGAATCCGCTCTAGCAGAGCTAAGAGAGCTGATTGCGCGAGCGATGATTCCCACACCAGCGAGCCTGAACCGGAGCAACAATCTGAGGGTGCATCGTCCTTAGGAAAAGATTCACATTCGGCCATCACCACCGCTGTGAAGGTCGAGGCGCCCAGCGGGAGCGTTGAGCAGGGATGCGCCAGCGATACAGAAAAGCAAAACATCAAGCTTCTGTCAGATTCTAGTTGCGATTTTCATCAGCTTGACTCTCGTGCCGAGAGCCCCACCTCTCCTCTACCCGCTTCAGTGAGAATAGACGAAGTTCCAGGGTTCACCGCCTTCCAGATGGTGGAGAATGAACCACGATCAGCCTTCAGAAAGGTTGTGGCCATACGTCCGGTGAAGAAAGCGGCCGTAGCCCGTAAACCGAAGGTAAGAACTTGAAGGGCCGTGCGAAGTGGGTGAGGGTTCATTTGGTTTTGGGTGAGCAGATCAATTTCACATTTTGAAAACGTATTTTGTTAGCATCCACATCAACTTGCTACTTGACCATAGGTCACTGATACTTTTCTTCTTCAGGTCGAGGAGAAATCGTATGAGGCCGCAACGCCCGAGCAAGCAGCTGTCAAGCTCGCCACTCGGAAGAAGCCGAAACCTGCGGGTGTAGGGCAATTGCCTATTGTGAAGACCGAGGAGGCAGACGCCGGCTGGCCAGTTAGCAGTACGGCAGTTGTTCTCAATGAAGATAGTAGAAGATTCGAGGACGCCAAATGTGCGAATGCTGCGAATCCTTGTATGGCGGCGGCGCAGGAAGTTGCCCTGTCGGAGCCAGTTTTGGTCAAGATTGAGACCAAGCCCAGCGTGAAACCTGGCCAGCGCGCTGGCGGCAAACTTAAACCTGCTATCAGCGAGGTATATATTGCAGTCCGTGTATGGTGTTTTTTTTCCTTCAATCTCGAGCTCCATGATCAGGAGCTCACGAAAGCTCGTGGGCTATATATATATATCTTTATATTTATATGGAAGTGGTTTTAAGCGGTGCCTTGTTTTCAACAGAGCGAAAAGGAGGCACGGAGACAGCGTCGGGTCCAAGCTAATCGCGAATCGGCCAGGCAGACAATCCGACGGAAACAGGTGCGTACTAGATACATGAAATTGTGAGAATCTTTGCCGGTTGCATTCCTGCTCACGTGATTATAGACACAGACTGGCTTCGTCGTTAACGTTTGCAAATCGCATGGAGGAAGGGGTGCATCTGTTGCTTCTTCTTCCGTTCCTTCAGGTTCCTCCCTCGTCGTTCGCGGTTGTCTGGTTTTTCAAATACTGATCAAAGGGTTATGTATCTCTCAGGTTCTCTGTGAGGAGCTTTCCCAGAAAGCCCAGCTATACACAATTGACAACGACACATTGAAAAAGGTGAGTTGGGTCGATGGGATCGTCGCTTTGGTTGCTGGCTTCAAAATGTCCTTCAAGTGTGCTGAGGCCGCGAATCGCTTTTCACCTACTGACTGCGTACTCAAGCTACCTTACTATGGTTCTCATAGCTTCTCCACTTTTAAATGTGCAGGAATTGGAGATGAAACTCTTGGACCTAAAAAAGGAGAGTGAACTTAACGCGCGTTTAAGGGAACAAGTAAGTTTGCTTGTATGAGTTCTTAAAGATGATTTTATTTGGACAGCAATTCGTATTGAGACAACCTGTCAGATATCACCCCTGGTCATTTTAAACGTGGAAATGGACGACTAGACGAGTAGTGCTTCTGTGCGGTGTTTCTGATCATTTGATTGTAATTGTTTCAGTTGCTGAAGAGTCACGAAGGAGTCTCCGGATCTGAAGTTGCCGCGACACAACCTGAGCATGGTTCAGCATTCAGATTCAACCCTCCATCGTCCGGAACATTCAATCCGATGATATTGATGCAATTTCCACACTACACGCACCCAAGCGACGTCTGTTTTCCTGGAGCACCGCCTCCCCTTGGTCTTTCTGGGGATTACGCGACTGCTGCAGTATCTTATATGCCAGTGATGTGGACGGGAGGCGCCCATGGGGGTCAGGGTCCTTTGGTATCCTACTTCCCGTATGCGTGCCCGGTGGCTGGCTCCAGCAAATTTACTTCCCCTCGTGGAGAAGAGGCGACGAGCCCGCCGGCATCGTCGTCAGGTCCAGCCGCTTCGTTACCGTCGACTCAGGCAGAGAGTCCGTTCTCCAAAGCCCCCTGTGGAAGGGACAGAGGTTTAGTTACCGCGAAGTCTCTCGGGCCGTACAGAGCGAGCTCATTTTCTGAGTCCACGTTCTCACATGATGTGAAGAAAGCCTCTGTGAAATGTGAGAGTGTATGTGAAGCACCGACTTTCGGTGGGAAGGGACAGTTTTACAAGCTGACCACATCATCGCAGCATGGAACTTCCTGTCTGCCGGGAGTATTGCCCCGGAAGTCTTCAGGGGAGGAATTGTTGTGCTTGCCTCCTCCGAGCGCCCATCTAGCGAGAGCTTCCTCCGGCAATTTAGCTCCGCAGGTGTCGAAGATGGGGAATTCAAGGTTCGTGTTTCCAAGCGGAGGAAGACGCTACTCGGACATGATGGGACAAGAACTTCCACAAATGATGCAGAGTCAAAAACCCTCGGTAGCAGTTGCAAGAGCGGCAGAAGCACGGCGTAATCGGATAGAGTTACAACGGAGTAGGGCACAGAGGCAGCAGGCTGCCCGAATTGCAGAGCCATCGGTGTCGTAACTATATAGCACTATAGAGAAGAGAAGTAAGTAGCTTACAACTATCACTGTTGGGTTATTTTTCAGTTTTTGCTGACTTTTGAGGGTAGATTTAAGATTCGTAGTAGACTGAAACACTTCCAGTCTACTCTGGAAGTGTTTCAGTATGTCGGTGTAAATTCAAATTTGAGTATTAGACTCCACGATAGGCATGTGCTGGCTCACAGAAAACGCTACCATCAATGGAGCGTGTATAACTGGGCATTTTGATATCAGAAAGTGATGTGTGATAACCCAGGAAGATCCCTGATTTGGGATTACTAATCAGACCTTGGGAGAAGAAGACAAGGGGCTCACATCACTCGTAGCAATATTTACCTGGCATCCTTAGTACAAGAGTAGATTTAGAGAGGCCACCTTTACTCCCTGAACTCATGTAATACGGAACCTCGATGTAGTAGGCTTAGTGCAGCGGGGTCCTTTGAGTTCAGAATCTTTGGCAGAGTGCTAGTATTCTTACAGTCAATTCTTATGCAGGGAATGCTTCCCAAGGCATGATTTTATTGTACATTCAATTATTTGTATACGGATCGATCTATATGCTTGCTTAAGCTGG

mRNA

>Mapoly0016s0098.1
CGGAGGGAGCTAGCCGCGCGGAGGAGAAAAGCGAGCCACGGGCGAAAGCGAGCGAGCGAAAGCGAGAGCCAGAGGAAGAGTGCGACCGAGCGAGAGAGGGAGAGAGGGAGAGAGGGACGGGTAAAGGAGAAGGAGGAGGAGGACGAGGAGTCCGGGCAGGGATTGCTACGCTACCTGTACGGGGCTCGCCGCTCGCTCGCCTGACTGACTTGTGGCACGACTGAATTCTCGCGTCGAGGGGAGACAGCACCGTCCGGTGGACGAGGTGGAAAGCTGGGATTCAATTGGTGCGTTGGCCTTGTGAGGCCTCTCACTGGAGCGCGCACACCACTTGCTCTGGGCTGCCGCCGGGGTGAATATTGGGCCCTGACCCATCCGGATTCAGAGTCGGACACGGCTGCGTTCGCCTTTAGTGCCCGCCCCGGTGTTGGGCTTTCCCCCCTGCCTGCTCGCCTGGTTCTTCTCGGCCGAGTGCTGCTGCCACTCCTCTAGTCGCTGAGTCGCCCTCACACCGGGCCTGCTGCGTGTGCTGCTTGCCCTTCAACTCCCTTCCTCCTTCCCTTCCAGAGGGAAGGGCTGAAAAAGCAAGAGTATCGGAGGAGAGGGCGCTTTTGCAATCTACTTACTTGTCTACGCTTTCTGTTGGCTGTCCGCCTGGCGCATCGTAGGAGCAAGGAAGGTCACGTTGCCCTTGGGTGAGAGAAGAGAGAGAGGAGGGAGGAGAGGGCAGGAGAGTTGTAGTCTCGGACGGGAGAGGAGAAAAGAGAGGCAGTCAGACGGGGGCCTGCCAGAGAGTCGAGTCGACTGTGGCCGAAGCATTGTGCGAGTGAGTGAGTGAGTGAGTGTGGCGCATTTCTCCGAGTTGCGTCTCGTTGCGTCTCGTTGCGGCTCGCCGCGTTGCAGACGAGGAGGAGAAGCGAGAAAGAGGGAGCGAGCGGGAGACGGAGAGTGTTTGTGTCGGCGTGTGCTCACGTGGGAGCGAGCGAAAGGAGGCGGGGCGGTGAAATTGCTATTTGTGCATTGCGTTTGAACGGGAGAGCCTTCGCGTGGTTTTCGTGCAGAGTGGATCTAAAGCAGAGCTTCGCCCCGCCTTTCCGCACTCTTCTTCTTCCCGTGCTTGCTCTCTGGTCTCGACTGTGATCTCTAGCTAGCCAGCGCTCAGGCGTGGAACGTTTCTTTGTCGGGAAAAGAGGCTTCATGCTCTACTCTCATCACCAGCTTTCTATCGTCAGCGAAGTACGTGGATCTGTCTTCAATGAAATGCCCGTTCAGCCGAGTTGTTGTGGCAGGGACGAAGCTTTGACAAGAACGTACGTTAACCAAATCTTTATCAAAGGATAACACTCGCTTAATGCGTAGAACCTCTCGTGTGTGACAGAGTGTGGTGTTTCGAAAGCTGTTTGGTAGAAGATATGGCTTCAGGTGTAACTGTCCTGCCATCTACCAGTGCTGGCGGGAAGCCTAGCGATGGGAGCCGTCAAAAGAGAAAGATTGCGGCTGGACTTCCGAATGTTCGGAAGAGAGTTTGTGTTCCCAAAGATGCCGTGAAAGTCGAAGCAGCGAGGAGCGCAGGCTCCTCGAAACCTTTCGTGACTAAAAGGAAGGATAGGATAGATGATGAAAATACGGGAGATTCCTCTCTGGAGTTGGACGCCGCTAGGGCTCTGACTCAGATGCAAACACAGGTATTGAAGATTATCGAAGAAAGGCCCGTGTTGACTTTGAAGGTCGTTGCACCGCTTCCCCAGTGGTCGAGGAAAAGAATCCGCTCTAGCAGAGCTAAGAGAGCTGATTGCGCGAGCGATGATTCCCACACCAGCGAGCCTGAACCGGAGCAACAATCTGAGGGTGCATCGTCCTTAGGAAAAGATTCACATTCGGCCATCACCACCGCTGTGAAGGTCGAGGCGCCCAGCGGGAGCGTTGAGCAGGGATGCGCCAGCGATACAGAAAAGCAAAACATCAAGCTTCTGTCAGATTCTAGTTGCGATTTTCATCAGCTTGACTCTCGTGCCGAGAGCCCCACCTCTCCTCTACCCGCTTCAGTGAGAATAGACGAAGTTCCAGGGTTCACCGCCTTCCAGATGGTGGAGAATGAACCACGATCAGCCTTCAGAAAGGTTGTGGCCATACGTCCGGTGAAGAAAGCGGCCGTAGCCCGTAAACCGAAGGTCGAGGAGAAATCGTATGAGGCCGCAACGCCCGAGCAAGCAGCTGTCAAGCTCGCCACTCGGAAGAAGCCGAAACCTGCGGGTGTAGGGCAATTGCCTATTGTGAAGACCGAGGAGGCAGACGCCGGCTGGCCAGTTAGCAGTACGGCAGTTGTTCTCAATGAAGATAGTAGAAGATTCGAGGACGCCAAATGTGCGAATGCTGCGAATCCTTGTATGGCGGCGGCGCAGGAAGTTGCCCTGTCGGAGCCAGTTTTGGTCAAGATTGAGACCAAGCCCAGCGTGAAACCTGGCCAGCGCGCTGGCGGCAAACTTAAACCTGCTATCAGCGAGAGCGAAAAGGAGGCACGGAGACAGCGTCGGGTCCAAGCTAATCGCGAATCGGCCAGGCAGACAATCCGACGGAAACAGGTTCTCTGTGAGGAGCTTTCCCAGAAAGCCCAGCTATACACAATTGACAACGACACATTGAAAAAGGAATTGGAGATGAAACTCTTGGACCTAAAAAAGGAGAGTGAACTTAACGCGCGTTTAAGGGAACAATTGCTGAAGAGTCACGAAGGAGTCTCCGGATCTGAAGTTGCCGCGACACAACCTGAGCATGGTTCAGCATTCAGATTCAACCCTCCATCGTCCGGAACATTCAATCCGATGATATTGATGCAATTTCCACACTACACGCACCCAAGCGACGTCTGTTTTCCTGGAGCACCGCCTCCCCTTGGTCTTTCTGGGGATTACGCGACTGCTGCAGTATCTTATATGCCAGTGATGTGGACGGGAGGCGCCCATGGGGGTCAGGGTCCTTTGGTATCCTACTTCCCGTATGCGTGCCCGGTGGCTGGCTCCAGCAAATTTACTTCCCCTCGTGGAGAAGAGGCGACGAGCCCGCCGGCATCGTCGTCAGGTCCAGCCGCTTCGTTACCGTCGACTCAGGCAGAGAGTCCGTTCTCCAAAGCCCCCTGTGGAAGGGACAGAGGTTTAGTTACCGCGAAGTCTCTCGGGCCGTACAGAGCGAGCTCATTTTCTGAGTCCACGTTCTCACATGATGTGAAGAAAGCCTCTGTGAAATGTGAGAGTGTATGTGAAGCACCGACTTTCGGTGGGAAGGGACAGTTTTACAAGCTGACCACATCATCGCAGCATGGAACTTCCTGTCTGCCGGGAGTATTGCCCCGGAAGTCTTCAGGGGAGGAATTGTTGTGCTTGCCTCCTCCGAGCGCCCATCTAGCGAGAGCTTCCTCCGGCAATTTAGCTCCGCAGGTGTCGAAGATGGGGAATTCAAGGTTCGTGTTTCCAAGCGGAGGAAGACGCTACTCGGACATGATGGGACAAGAACTTCCACAAATGATGCAGAGTCAAAAACCCTCGGTAGCAGTTGCAAGAGCGGCAGAAGCACGGCGTAATCGGATAGAGTTACAACGGAGTAGGGCACAGAGGCAGCAGGCTGCCCGAATTGCAGAGCCATCGGTGTCGTAACTATATAGCACTATAGAGAAGAGAAGTAAGTAGCTTACAACTATCACTGTTGGGTTATTTTTCAGTTTTTGCTGACTTTTGAGGGTAGATTTAAGATTCGTAGTAGACTGAAACACTTCCAGTCTACTCTGGAAGTGTTTCAGTATGTCGGTGTAAATTCAAATTTGAGTATTAGACTCCACGATAGGCATGTGCTGGCTCACAGAAAACGCTACCATCAATGGAGCGTGTATAACTGGGCATTTTGATATCAGAAAGTGATGTGTGATAACCCAGGAAGATCCCTGATTTGGGATTACTAATCAGACCTTGGGAGAAGAAGACAAGGGGCTCACATCACTCGTAGCAATATTTACCTGGCATCCTTAGTACAAGAGTAGATTTAGAGAGGCCACCTTTACTCCCTGAACTCATGTAATACGGAACCTCGATGTAGTAGGCTTAGTGCAGCGGGGTCCTTTGAGTTCAGAATCTTTGGCAGAGTGCTAGTATTCTTACAGTCAATTCTTATGCAGGGAATGCTTCCCAAGGCATGATTTTATTGTACATTCAATTATTTGTATACGGATCGATCTATATGCTTGCTTAAGCTGG

CDS

>Mapoly0016s0098.1
ATGGCTTCAGGTGTAACTGTCCTGCCATCTACCAGTGCTGGCGGGAAGCCTAGCGATGGGAGCCGTCAAAAGAGAAAGATTGCGGCTGGACTTCCGAATGTTCGGAAGAGAGTTTGTGTTCCCAAAGATGCCGTGAAAGTCGAAGCAGCGAGGAGCGCAGGCTCCTCGAAACCTTTCGTGACTAAAAGGAAGGATAGGATAGATGATGAAAATACGGGAGATTCCTCTCTGGAGTTGGACGCCGCTAGGGCTCTGACTCAGATGCAAACACAGGTATTGAAGATTATCGAAGAAAGGCCCGTGTTGACTTTGAAGGTCGTTGCACCGCTTCCCCAGTGGTCGAGGAAAAGAATCCGCTCTAGCAGAGCTAAGAGAGCTGATTGCGCGAGCGATGATTCCCACACCAGCGAGCCTGAACCGGAGCAACAATCTGAGGGTGCATCGTCCTTAGGAAAAGATTCACATTCGGCCATCACCACCGCTGTGAAGGTCGAGGCGCCCAGCGGGAGCGTTGAGCAGGGATGCGCCAGCGATACAGAAAAGCAAAACATCAAGCTTCTGTCAGATTCTAGTTGCGATTTTCATCAGCTTGACTCTCGTGCCGAGAGCCCCACCTCTCCTCTACCCGCTTCAGTGAGAATAGACGAAGTTCCAGGGTTCACCGCCTTCCAGATGGTGGAGAATGAACCACGATCAGCCTTCAGAAAGGTTGTGGCCATACGTCCGGTGAAGAAAGCGGCCGTAGCCCGTAAACCGAAGGTCGAGGAGAAATCGTATGAGGCCGCAACGCCCGAGCAAGCAGCTGTCAAGCTCGCCACTCGGAAGAAGCCGAAACCTGCGGGTGTAGGGCAATTGCCTATTGTGAAGACCGAGGAGGCAGACGCCGGCTGGCCAGTTAGCAGTACGGCAGTTGTTCTCAATGAAGATAGTAGAAGATTCGAGGACGCCAAATGTGCGAATGCTGCGAATCCTTGTATGGCGGCGGCGCAGGAAGTTGCCCTGTCGGAGCCAGTTTTGGTCAAGATTGAGACCAAGCCCAGCGTGAAACCTGGCCAGCGCGCTGGCGGCAAACTTAAACCTGCTATCAGCGAGAGCGAAAAGGAGGCACGGAGACAGCGTCGGGTCCAAGCTAATCGCGAATCGGCCAGGCAGACAATCCGACGGAAACAGGTTCTCTGTGAGGAGCTTTCCCAGAAAGCCCAGCTATACACAATTGACAACGACACATTGAAAAAGGAATTGGAGATGAAACTCTTGGACCTAAAAAAGGAGAGTGAACTTAACGCGCGTTTAAGGGAACAATTGCTGAAGAGTCACGAAGGAGTCTCCGGATCTGAAGTTGCCGCGACACAACCTGAGCATGGTTCAGCATTCAGATTCAACCCTCCATCGTCCGGAACATTCAATCCGATGATATTGATGCAATTTCCACACTACACGCACCCAAGCGACGTCTGTTTTCCTGGAGCACCGCCTCCCCTTGGTCTTTCTGGGGATTACGCGACTGCTGCAGTATCTTATATGCCAGTGATGTGGACGGGAGGCGCCCATGGGGGTCAGGGTCCTTTGGTATCCTACTTCCCGTATGCGTGCCCGGTGGCTGGCTCCAGCAAATTTACTTCCCCTCGTGGAGAAGAGGCGACGAGCCCGCCGGCATCGTCGTCAGGTCCAGCCGCTTCGTTACCGTCGACTCAGGCAGAGAGTCCGTTCTCCAAAGCCCCCTGTGGAAGGGACAGAGGTTTAGTTACCGCGAAGTCTCTCGGGCCGTACAGAGCGAGCTCATTTTCTGAGTCCACGTTCTCACATGATGTGAAGAAAGCCTCTGTGAAATGTGAGAGTGTATGTGAAGCACCGACTTTCGGTGGGAAGGGACAGTTTTACAAGCTGACCACATCATCGCAGCATGGAACTTCCTGTCTGCCGGGAGTATTGCCCCGGAAGTCTTCAGGGGAGGAATTGTTGTGCTTGCCTCCTCCGAGCGCCCATCTAGCGAGAGCTTCCTCCGGCAATTTAGCTCCGCAGGTGTCGAAGATGGGGAATTCAAGGTTCGTGTTTCCAAGCGGAGGAAGACGCTACTCGGACATGATGGGACAAGAACTTCCACAAATGATGCAGAGTCAAAAACCCTCGGTAGCAGTTGCAAGAGCGGCAGAAGCACGGCGTAATCGGATAGAGTTACAACGGAGTAGGGCACAGAGGCAGCAGGCTGCCCGAATTGCAGAGCCATCGGTGTCGTAA

Protein

>Mapoly0016s0098.1
MASGVTVLPSTSAGGKPSDGSRQKRKIAAGLPNVRKRVCVPKDAVKVEAARSAGSSKPFVTKRKDRIDDENTGDSSLELDAARALTQMQTQVLKIIEERPVLTLKVVAPLPQWSRKRIRSSRAKRADCASDDSHTSEPEPEQQSEGASSLGKDSHSAITTAVKVEAPSGSVEQGCASDTEKQNIKLLSDSSCDFHQLDSRAESPTSPLPASVRIDEVPGFTAFQMVENEPRSAFRKVVAIRPVKKAAVARKPKVEEKSYEAATPEQAAVKLATRKKPKPAGVGQLPIVKTEEADAGWPVSSTAVVLNEDSRRFEDAKCANAANPCMAAAQEVALSEPVLVKIETKPSVKPGQRAGGKLKPAISESEKEARRQRRVQANRESARQTIRRKQVLCEELSQKAQLYTIDNDTLKKELEMKLLDLKKESELNARLREQLLKSHEGVSGSEVAATQPEHGSAFRFNPPSSGTFNPMILMQFPHYTHPSDVCFPGAPPPLGLSGDYATAAVSYMPVMWTGGAHGGQGPLVSYFPYACPVAGSSKFTSPRGEEATSPPASSSGPAASLPSTQAESPFSKAPCGRDRGLVTAKSLGPYRASSFSESTFSHDVKKASVKCESVCEAPTFGGKGQFYKLTTSSQHGTSCLPGVLPRKSSGEELLCLPPPSAHLARASSGNLAPQVSKMGNSRFVFPSGGRRYSDMMGQELPQMMQSQKPSVAVARAAEARRNRIELQRSRAQRQQAARIAEPSVS

Mapoly0016s0098.2  

Gene structure:

mRNA scaffold_16:953769..958998  ( - strand )
three_prime_UTR scaffold_16:953769..954362  ( - strand )
CDS scaffold_16:954363..955298  ( - strand )
CDS scaffold_16:955466..955531  ( - strand )
CDS scaffold_16:955683..955748  ( - strand )
CDS scaffold_16:955965..956042  ( - strand )
CDS scaffold_16:956187..956519  ( - strand )
CDS scaffold_16:956667..957425  ( - strand )
five_prime_UTR scaffold_16:957426..957469  ( - strand )
five_prime_UTR scaffold_16:957689..958998  ( - strand )

Sequences:

Gene

>Mapoly0016s0098.2
CGGAGGGAGCTAGCCGCGCGGAGGAGAAAAGCGAGCCACGGGCGAAAGCGAGCGAGCGAAAGCGAGAGCCAGAGGAAGAGTGCGACCGAGCGAGAGAGGGAGAGAGGGAGAGAGGGACGGGTAAAGGAGAAGGAGGAGGAGGACGAGGAGTCCGGGCAGGGATTGCTACGCTACCTGTACGGGGCTCGCCGCTCGCTCGCCTGACTGACTTGTGGCACGACTGAATTCTCGCGTCGAGGGGAGACAGCACCGTCCGGTGGACGAGGTGGAAAGCTGGGATTCAATTGGTGCGTTGGCCTTGTGAGGCCTCTCACTGGAGCGCGCACACCACTTGCTCTGGGCTGCCGCCGGGGTGAATATTGGGCCCTGACCCATCCGGATTCAGAGTCGGACACGGCTGCGTTCGCCTTTAGTGCCCGCCCCGGTGTTGGGCTTTCCCCCCTGCCTGCTCGCCTGGTTCTTCTCGGCCGAGTGCTGCTGCCACTCCTCTAGTCGCTGAGTCGCCCTCACACCGGGCCTGCTGCGTGTGCTGCTTGCCCTTCAACTCCCTTCCTCCTTCCCTTCCAGAGGGAAGGGCTGAAAAAGCAAGAGTATCGGAGGAGAGGGCGCTTTTGCAATCTACTTACTTGTCTACGCTTTCTGTTGGCTGTCCGCCTGGCGCATCGTAGGAGCAAGGAAGGTCACGTTGCCCTTGGGTGAGAGAAGAGAGAGAGGAGGGAGGAGAGGGCAGGAGAGTTGTAGTCTCGGACGGGAGAGGAGAAAAGAGAGGCAGTCAGACGGGGGCCTGCCAGAGAGTCGAGTCGACTGTGGCCGAAGCATTGTGCGAGTGAGTGAGTGAGTGAGTGTGGCGCATTTCTCCGAGTTGCGTCTCGTTGCGTCTCGTTGCGGCTCGCCGCGTTGCAGACGAGGAGGAGAAGCGAGAAAGAGGGAGCGAGCGGGAGACGGAGAGTGTTTGTGTCGGCGTGTGCTCACGTGGGAGCGAGCGAAAGGAGGCGGGGCGGTGAAATTGCTATTTGTGCATTGCGTTTGAACGGGAGAGCCTTCGCGTGGTTTTCGTGCAGAGTGGATCTAAAGCAGAGCTTCGCCCCGCCTTTCCGCACTCTTCTTCTTCCCGTGCTTGCTCTCTGGTCTCGACTGTGATCTCTAGCTAGCCAGCGCTCAGGCGTGGAACGTTTCTTTGTCGGGAAAAGAGGCTTCATGCTCTACTCTCATCACCAGCTTTCTATCGTCAGCGAAGTACGTGGATCTGTCTTCAATGAAATGCCCGTTCAGCCGAGTTGTTGTGGCAGGGACGAAGCTTTGACAAGAACGTACGTTAACCAAATCTTTATCAAAGGATAACACTCGCTTAATGCGTAGAACCTCTCGGTACGTGAGTGACAAAGGGCAGCCTCTTTCCATTTGATACATACACTTGCGGTTGTACACCTGGTTTCAGAATTCCTGATAATATATGCACATAGTTAGCCAGCGCTCAGGCGGGGTGCATTGTTCGCTAAGTTGACTGACAGGGTGTTTGGTGTTTGCAGTGTGTGACAGAGTGTGGTGTTTCGAAAGCTGTTTGGTAGAAGATATGGCTTCAGGTGTAACTGTCCTGCCATCTACCAGTGCTGGCGGGAAGCCTAGCGATGGGAGCCGTCAAAAGAGAAAGATTGCGGCTGGACTTCCGAATGTTCGGAAGAGAGTTTGTGTTCCCAAAGATGCCGTGAAAGTCGAAGCAGCGAGGAGCGCAGGCTCCTCGAAACCTTTCGTGACTAAAAGGAAGGATAGGATAGATGATGAAAATACGGGAGATTCCTCTCTGGAGTTGGACGCCGCTAGGGCTCTGACTCAGATGCAAACACAGGTATTGAAGATTATCGAAGAAAGGCCCGTGTTGACTTTGAAGGTCGTTGCACCGCTTCCCCAGTGGTCGAGGAAAAGAATCCGCTCTAGCAGAGCTAAGAGAGCTGATTGCGCGAGCGATGATTCCCACACCAGCGAGCCTGAACCGGAGCAACAATCTGAGGGTGCATCGTCCTTAGGAAAAGATTCACATTCGGCCATCACCACCGCTGTGAAGGTCGAGGCGCCCAGCGGGAGCGTTGAGCAGGGATGCGCCAGCGATACAGAAAAGCAAAACATCAAGCTTCTGTCAGATTCTAGTTGCGATTTTCATCAGCTTGACTCTCGTGCCGAGAGCCCCACCTCTCCTCTACCCGCTTCAGTGAGAATAGACGAAGTTCCAGGGTTCACCGCCTTCCAGATGGTGGAGAATGAACCACGATCAGCCTTCAGAAAGGTTGTGGCCATACGTCCGGTGAAGAAAGCGGCCGTAGCCCGTAAACCGAAGGTAAGAACTTGAAGGGCCGTGCGAAGTGGGTGAGGGTTCATTTGGTTTTGGGTGAGCAGATCAATTTCACATTTTGAAAACGTATTTTGTTAGCATCCACATCAACTTGCTACTTGACCATAGGTCACTGATACTTTTCTTCTTCAGGTCGAGGAGAAATCGTATGAGGCCGCAACGCCCGAGCAAGCAGCTGTCAAGCTCGCCACTCGGAAGAAGCCGAAACCTGCGGGTGTAGGGCAATTGCCTATTGTGAAGACCGAGGAGGCAGACGCCGGCTGGCCAGTTAGCAGTACGGCAGTTGTTCTCAATGAAGATAGTAGAAGATTCGAGGACGCCAAATGTGCGAATGCTGCGAATCCTTGTATGGCGGCGGCGCAGGAAGTTGCCCTGTCGGAGCCAGTTTTGGTCAAGATTGAGACCAAGCCCAGCGTGAAACCTGGCCAGCGCGCTGGCGGCAAACTTAAACCTGCTATCAGCGAGGTATATATTGCAGTCCGTGTATGGTGTTTTTTTTCCTTCAATCTCGAGCTCCATGATCAGGAGCTCACGAAAGCTCGTGGGCTATATATATATATCTTTATATTTATATGGAAGTGGTTTTAAGCGGTGCCTTGTTTTCAACAGAGCGAAAAGGAGGCACGGAGACAGCGTCGGGTCCAAGCTAATCGCGAATCGGCCAGGCAGACAATCCGACGGAAACAGGTGCGTACTAGATACATGAAATTGTGAGAATCTTTGCCGGTTGCATTCCTGCTCACGTGATTATAGACACAGACTGGCTTCGTCGTTAACGTTTGCAAATCGCATGGAGGAAGGGGTGCATCTGTTGCTTCTTCTTCCGTTCCTTCAGGTTCCTCCCTCGTCGTTCGCGGTTGTCTGGTTTTTCAAATACTGATCAAAGGGTTATGTATCTCTCAGGTTCTCTGTGAGGAGCTTTCCCAGAAAGCCCAGCTATACACAATTGACAACGACACATTGAAAAAGGTGAGTTGGGTCGATGGGATCGTCGCTTTGGTTGCTGGCTTCAAAATGTCCTTCAAGTGTGCTGAGGCCGCGAATCGCTTTTCACCTACTGACTGCGTACTCAAGCTACCTTACTATGGTTCTCATAGCTTCTCCACTTTTAAATGTGCAGGAATTGGAGATGAAACTCTTGGACCTAAAAAAGGAGAGTGAACTTAACGCGCGTTTAAGGGAACAAGTAAGTTTGCTTGTATGAGTTCTTAAAGATGATTTTATTTGGACAGCAATTCGTATTGAGACAACCTGTCAGATATCACCCCTGGTCATTTTAAACGTGGAAATGGACGACTAGACGAGTAGTGCTTCTGTGCGGTGTTTCTGATCATTTGATTGTAATTGTTTCAGTTGCTGAAGAGTCACGAAGGAGTCTCCGGATCTGAAGTTGCCGCGACACAACCTGAGCATGGTTCAGCATTCAGATTCAACCCTCCATCGTCCGGAACATTCAATCCGATGATATTGATGCAATTTCCACACTACACGCACCCAAGCGACGTCTGTTTTCCTGGAGCACCGCCTCCCCTTGGTCTTTCTGGGGATTACGCGACTGCTGCAGTATCTTATATGCCAGTGATGTGGACGGGAGGCGCCCATGGGGGTCAGGGTCCTTTGGTATCCTACTTCCCGTATGCGTGCCCGGTGGCTGGCTCCAGCAAATTTACTTCCCCTCGTGGAGAAGAGGCGACGAGCCCGCCGGCATCGTCGTCAGGTCCAGCCGCTTCGTTACCGTCGACTCAGGCAGAGAGTCCGTTCTCCAAAGCCCCCTGTGGAAGGGACAGAGGTTTAGTTACCGCGAAGTCTCTCGGGCCGTACAGAGCGAGCTCATTTTCTGAGTCCACGTTCTCACATGATGTGAAGAAAGCCTCTGTGAAATGTGAGAGTGTATGTGAAGCACCGACTTTCGGTGGGAAGGGACAGTTTTACAAGCTGACCACATCATCGCAGCATGGAACTTCCTGTCTGCCGGGAGTATTGCCCCGGAAGTCTTCAGGGGAGGAATTGTTGTGCTTGCCTCCTCCGAGCGCCCATCTAGCGAGAGCTTCCTCCGGCAATTTAGCTCCGCAGGTGTCGAAGATGGGGAATTCAAGGTTCGTGTTTCCAAGCGGAGGAAGACGCTACTCGGACATGATGGGACAAGAACTTCCACAAATGATGCAGAGTCAAAAACCCTCGGTAGCAGTTGCAAGAGCGGCAGAAGCACGGCGTAATCGGATAGAGTTACAACGGAGTAGGGCACAGAGGCAGCAGGCTGCCCGAATTGCAGAGCCATCGGTGTCGTAACTATATAGCACTATAGAGAAGAGAAGTAAGTAGCTTACAACTATCACTGTTGGGTTATTTTTCAGTTTTTGCTGACTTTTGAGGGTAGATTTAAGATTCGTAGTAGACTGAAACACTTCCAGTCTACTCTGGAAGTGTTTCAGTATGTCGGTGTAAATTCAAATTTGAGTATTAGACTCCACGATAGGCATGTGCTGGCTCACAGAAAACGCTACCATCAATGGAGCGTGTATAACTGGGCATTTTGATATCAGAAAGTGATGTGTGATAACCCAGGAAGATCCCTGATTTGGGATTACTAATCAGACCTTGGGAGAAGAAGACAAGGGGCTCACATCACTCGTAGCAATATTTACCTGGCATCCTTAGTACAAGAGTAGATTTAGAGAGGCCACCTTTACTCCCTGAACTCATGTAATACGGAACCTCGATGTAGTAGGCTTAGTGCAGCGGGGTCCTTTGAGTTCAGAATCTTTGGCAGAGTGCTAGTATTCTTACAGTCAATTCTTATGCAGGGAATGCTTCCCAAGGCATGATTTTATTGTACATTCAATTATTTGTATACGGATCGATCTATATGCTTGCTTAAGCTGG

mRNA

>Mapoly0016s0098.2
CGGAGGGAGCTAGCCGCGCGGAGGAGAAAAGCGAGCCACGGGCGAAAGCGAGCGAGCGAAAGCGAGAGCCAGAGGAAGAGTGCGACCGAGCGAGAGAGGGAGAGAGGGAGAGAGGGACGGGTAAAGGAGAAGGAGGAGGAGGACGAGGAGTCCGGGCAGGGATTGCTACGCTACCTGTACGGGGCTCGCCGCTCGCTCGCCTGACTGACTTGTGGCACGACTGAATTCTCGCGTCGAGGGGAGACAGCACCGTCCGGTGGACGAGGTGGAAAGCTGGGATTCAATTGGTGCGTTGGCCTTGTGAGGCCTCTCACTGGAGCGCGCACACCACTTGCTCTGGGCTGCCGCCGGGGTGAATATTGGGCCCTGACCCATCCGGATTCAGAGTCGGACACGGCTGCGTTCGCCTTTAGTGCCCGCCCCGGTGTTGGGCTTTCCCCCCTGCCTGCTCGCCTGGTTCTTCTCGGCCGAGTGCTGCTGCCACTCCTCTAGTCGCTGAGTCGCCCTCACACCGGGCCTGCTGCGTGTGCTGCTTGCCCTTCAACTCCCTTCCTCCTTCCCTTCCAGAGGGAAGGGCTGAAAAAGCAAGAGTATCGGAGGAGAGGGCGCTTTTGCAATCTACTTACTTGTCTACGCTTTCTGTTGGCTGTCCGCCTGGCGCATCGTAGGAGCAAGGAAGGTCACGTTGCCCTTGGGTGAGAGAAGAGAGAGAGGAGGGAGGAGAGGGCAGGAGAGTTGTAGTCTCGGACGGGAGAGGAGAAAAGAGAGGCAGTCAGACGGGGGCCTGCCAGAGAGTCGAGTCGACTGTGGCCGAAGCATTGTGCGAGTGAGTGAGTGAGTGAGTGTGGCGCATTTCTCCGAGTTGCGTCTCGTTGCGTCTCGTTGCGGCTCGCCGCGTTGCAGACGAGGAGGAGAAGCGAGAAAGAGGGAGCGAGCGGGAGACGGAGAGTGTTTGTGTCGGCGTGTGCTCACGTGGGAGCGAGCGAAAGGAGGCGGGGCGGTGAAATTGCTATTTGTGCATTGCGTTTGAACGGGAGAGCCTTCGCGTGGTTTTCGTGCAGAGTGGATCTAAAGCAGAGCTTCGCCCCGCCTTTCCGCACTCTTCTTCTTCCCGTGCTTGCTCTCTGGTCTCGACTGTGATCTCTAGCTAGCCAGCGCTCAGGCGTGGAACGTTTCTTTGTCGGGAAAAGAGGCTTCATGCTCTACTCTCATCACCAGCTTTCTATCGTCAGCGAAGTACGTGGATCTGTCTTCAATGAAATGCCCGTTCAGCCGAGTTGTTGTGGCAGGGACGAAGCTTTGACAAGAACTGTGTGACAGAGTGTGGTGTTTCGAAAGCTGTTTGGTAGAAGATATGGCTTCAGGTGTAACTGTCCTGCCATCTACCAGTGCTGGCGGGAAGCCTAGCGATGGGAGCCGTCAAAAGAGAAAGATTGCGGCTGGACTTCCGAATGTTCGGAAGAGAGTTTGTGTTCCCAAAGATGCCGTGAAAGTCGAAGCAGCGAGGAGCGCAGGCTCCTCGAAACCTTTCGTGACTAAAAGGAAGGATAGGATAGATGATGAAAATACGGGAGATTCCTCTCTGGAGTTGGACGCCGCTAGGGCTCTGACTCAGATGCAAACACAGGTATTGAAGATTATCGAAGAAAGGCCCGTGTTGACTTTGAAGGTCGTTGCACCGCTTCCCCAGTGGTCGAGGAAAAGAATCCGCTCTAGCAGAGCTAAGAGAGCTGATTGCGCGAGCGATGATTCCCACACCAGCGAGCCTGAACCGGAGCAACAATCTGAGGGTGCATCGTCCTTAGGAAAAGATTCACATTCGGCCATCACCACCGCTGTGAAGGTCGAGGCGCCCAGCGGGAGCGTTGAGCAGGGATGCGCCAGCGATACAGAAAAGCAAAACATCAAGCTTCTGTCAGATTCTAGTTGCGATTTTCATCAGCTTGACTCTCGTGCCGAGAGCCCCACCTCTCCTCTACCCGCTTCAGTGAGAATAGACGAAGTTCCAGGGTTCACCGCCTTCCAGATGGTGGAGAATGAACCACGATCAGCCTTCAGAAAGGTTGTGGCCATACGTCCGGTGAAGAAAGCGGCCGTAGCCCGTAAACCGAAGGTCGAGGAGAAATCGTATGAGGCCGCAACGCCCGAGCAAGCAGCTGTCAAGCTCGCCACTCGGAAGAAGCCGAAACCTGCGGGTGTAGGGCAATTGCCTATTGTGAAGACCGAGGAGGCAGACGCCGGCTGGCCAGTTAGCAGTACGGCAGTTGTTCTCAATGAAGATAGTAGAAGATTCGAGGACGCCAAATGTGCGAATGCTGCGAATCCTTGTATGGCGGCGGCGCAGGAAGTTGCCCTGTCGGAGCCAGTTTTGGTCAAGATTGAGACCAAGCCCAGCGTGAAACCTGGCCAGCGCGCTGGCGGCAAACTTAAACCTGCTATCAGCGAGAGCGAAAAGGAGGCACGGAGACAGCGTCGGGTCCAAGCTAATCGCGAATCGGCCAGGCAGACAATCCGACGGAAACAGGTTCTCTGTGAGGAGCTTTCCCAGAAAGCCCAGCTATACACAATTGACAACGACACATTGAAAAAGGAATTGGAGATGAAACTCTTGGACCTAAAAAAGGAGAGTGAACTTAACGCGCGTTTAAGGGAACAATTGCTGAAGAGTCACGAAGGAGTCTCCGGATCTGAAGTTGCCGCGACACAACCTGAGCATGGTTCAGCATTCAGATTCAACCCTCCATCGTCCGGAACATTCAATCCGATGATATTGATGCAATTTCCACACTACACGCACCCAAGCGACGTCTGTTTTCCTGGAGCACCGCCTCCCCTTGGTCTTTCTGGGGATTACGCGACTGCTGCAGTATCTTATATGCCAGTGATGTGGACGGGAGGCGCCCATGGGGGTCAGGGTCCTTTGGTATCCTACTTCCCGTATGCGTGCCCGGTGGCTGGCTCCAGCAAATTTACTTCCCCTCGTGGAGAAGAGGCGACGAGCCCGCCGGCATCGTCGTCAGGTCCAGCCGCTTCGTTACCGTCGACTCAGGCAGAGAGTCCGTTCTCCAAAGCCCCCTGTGGAAGGGACAGAGGTTTAGTTACCGCGAAGTCTCTCGGGCCGTACAGAGCGAGCTCATTTTCTGAGTCCACGTTCTCACATGATGTGAAGAAAGCCTCTGTGAAATGTGAGAGTGTATGTGAAGCACCGACTTTCGGTGGGAAGGGACAGTTTTACAAGCTGACCACATCATCGCAGCATGGAACTTCCTGTCTGCCGGGAGTATTGCCCCGGAAGTCTTCAGGGGAGGAATTGTTGTGCTTGCCTCCTCCGAGCGCCCATCTAGCGAGAGCTTCCTCCGGCAATTTAGCTCCGCAGGTGTCGAAGATGGGGAATTCAAGGTTCGTGTTTCCAAGCGGAGGAAGACGCTACTCGGACATGATGGGACAAGAACTTCCACAAATGATGCAGAGTCAAAAACCCTCGGTAGCAGTTGCAAGAGCGGCAGAAGCACGGCGTAATCGGATAGAGTTACAACGGAGTAGGGCACAGAGGCAGCAGGCTGCCCGAATTGCAGAGCCATCGGTGTCGTAACTATATAGCACTATAGAGAAGAGAAGTAAGTAGCTTACAACTATCACTGTTGGGTTATTTTTCAGTTTTTGCTGACTTTTGAGGGTAGATTTAAGATTCGTAGTAGACTGAAACACTTCCAGTCTACTCTGGAAGTGTTTCAGTATGTCGGTGTAAATTCAAATTTGAGTATTAGACTCCACGATAGGCATGTGCTGGCTCACAGAAAACGCTACCATCAATGGAGCGTGTATAACTGGGCATTTTGATATCAGAAAGTGATGTGTGATAACCCAGGAAGATCCCTGATTTGGGATTACTAATCAGACCTTGGGAGAAGAAGACAAGGGGCTCACATCACTCGTAGCAATATTTACCTGGCATCCTTAGTACAAGAGTAGATTTAGAGAGGCCACCTTTACTCCCTGAACTCATGTAATACGGAACCTCGATGTAGTAGGCTTAGTGCAGCGGGGTCCTTTGAGTTCAGAATCTTTGGCAGAGTGCTAGTATTCTTACAGTCAATTCTTATGCAGGGAATGCTTCCCAAGGCATGATTTTATTGTACATTCAATTATTTGTATACGGATCGATCTATATGCTTGCTTAAGCTGG

CDS

>Mapoly0016s0098.2
ATGGCTTCAGGTGTAACTGTCCTGCCATCTACCAGTGCTGGCGGGAAGCCTAGCGATGGGAGCCGTCAAAAGAGAAAGATTGCGGCTGGACTTCCGAATGTTCGGAAGAGAGTTTGTGTTCCCAAAGATGCCGTGAAAGTCGAAGCAGCGAGGAGCGCAGGCTCCTCGAAACCTTTCGTGACTAAAAGGAAGGATAGGATAGATGATGAAAATACGGGAGATTCCTCTCTGGAGTTGGACGCCGCTAGGGCTCTGACTCAGATGCAAACACAGGTATTGAAGATTATCGAAGAAAGGCCCGTGTTGACTTTGAAGGTCGTTGCACCGCTTCCCCAGTGGTCGAGGAAAAGAATCCGCTCTAGCAGAGCTAAGAGAGCTGATTGCGCGAGCGATGATTCCCACACCAGCGAGCCTGAACCGGAGCAACAATCTGAGGGTGCATCGTCCTTAGGAAAAGATTCACATTCGGCCATCACCACCGCTGTGAAGGTCGAGGCGCCCAGCGGGAGCGTTGAGCAGGGATGCGCCAGCGATACAGAAAAGCAAAACATCAAGCTTCTGTCAGATTCTAGTTGCGATTTTCATCAGCTTGACTCTCGTGCCGAGAGCCCCACCTCTCCTCTACCCGCTTCAGTGAGAATAGACGAAGTTCCAGGGTTCACCGCCTTCCAGATGGTGGAGAATGAACCACGATCAGCCTTCAGAAAGGTTGTGGCCATACGTCCGGTGAAGAAAGCGGCCGTAGCCCGTAAACCGAAGGTCGAGGAGAAATCGTATGAGGCCGCAACGCCCGAGCAAGCAGCTGTCAAGCTCGCCACTCGGAAGAAGCCGAAACCTGCGGGTGTAGGGCAATTGCCTATTGTGAAGACCGAGGAGGCAGACGCCGGCTGGCCAGTTAGCAGTACGGCAGTTGTTCTCAATGAAGATAGTAGAAGATTCGAGGACGCCAAATGTGCGAATGCTGCGAATCCTTGTATGGCGGCGGCGCAGGAAGTTGCCCTGTCGGAGCCAGTTTTGGTCAAGATTGAGACCAAGCCCAGCGTGAAACCTGGCCAGCGCGCTGGCGGCAAACTTAAACCTGCTATCAGCGAGAGCGAAAAGGAGGCACGGAGACAGCGTCGGGTCCAAGCTAATCGCGAATCGGCCAGGCAGACAATCCGACGGAAACAGGTTCTCTGTGAGGAGCTTTCCCAGAAAGCCCAGCTATACACAATTGACAACGACACATTGAAAAAGGAATTGGAGATGAAACTCTTGGACCTAAAAAAGGAGAGTGAACTTAACGCGCGTTTAAGGGAACAATTGCTGAAGAGTCACGAAGGAGTCTCCGGATCTGAAGTTGCCGCGACACAACCTGAGCATGGTTCAGCATTCAGATTCAACCCTCCATCGTCCGGAACATTCAATCCGATGATATTGATGCAATTTCCACACTACACGCACCCAAGCGACGTCTGTTTTCCTGGAGCACCGCCTCCCCTTGGTCTTTCTGGGGATTACGCGACTGCTGCAGTATCTTATATGCCAGTGATGTGGACGGGAGGCGCCCATGGGGGTCAGGGTCCTTTGGTATCCTACTTCCCGTATGCGTGCCCGGTGGCTGGCTCCAGCAAATTTACTTCCCCTCGTGGAGAAGAGGCGACGAGCCCGCCGGCATCGTCGTCAGGTCCAGCCGCTTCGTTACCGTCGACTCAGGCAGAGAGTCCGTTCTCCAAAGCCCCCTGTGGAAGGGACAGAGGTTTAGTTACCGCGAAGTCTCTCGGGCCGTACAGAGCGAGCTCATTTTCTGAGTCCACGTTCTCACATGATGTGAAGAAAGCCTCTGTGAAATGTGAGAGTGTATGTGAAGCACCGACTTTCGGTGGGAAGGGACAGTTTTACAAGCTGACCACATCATCGCAGCATGGAACTTCCTGTCTGCCGGGAGTATTGCCCCGGAAGTCTTCAGGGGAGGAATTGTTGTGCTTGCCTCCTCCGAGCGCCCATCTAGCGAGAGCTTCCTCCGGCAATTTAGCTCCGCAGGTGTCGAAGATGGGGAATTCAAGGTTCGTGTTTCCAAGCGGAGGAAGACGCTACTCGGACATGATGGGACAAGAACTTCCACAAATGATGCAGAGTCAAAAACCCTCGGTAGCAGTTGCAAGAGCGGCAGAAGCACGGCGTAATCGGATAGAGTTACAACGGAGTAGGGCACAGAGGCAGCAGGCTGCCCGAATTGCAGAGCCATCGGTGTCGTAA

Protein

>Mapoly0016s0098.2
MASGVTVLPSTSAGGKPSDGSRQKRKIAAGLPNVRKRVCVPKDAVKVEAARSAGSSKPFVTKRKDRIDDENTGDSSLELDAARALTQMQTQVLKIIEERPVLTLKVVAPLPQWSRKRIRSSRAKRADCASDDSHTSEPEPEQQSEGASSLGKDSHSAITTAVKVEAPSGSVEQGCASDTEKQNIKLLSDSSCDFHQLDSRAESPTSPLPASVRIDEVPGFTAFQMVENEPRSAFRKVVAIRPVKKAAVARKPKVEEKSYEAATPEQAAVKLATRKKPKPAGVGQLPIVKTEEADAGWPVSSTAVVLNEDSRRFEDAKCANAANPCMAAAQEVALSEPVLVKIETKPSVKPGQRAGGKLKPAISESEKEARRQRRVQANRESARQTIRRKQVLCEELSQKAQLYTIDNDTLKKELEMKLLDLKKESELNARLREQLLKSHEGVSGSEVAATQPEHGSAFRFNPPSSGTFNPMILMQFPHYTHPSDVCFPGAPPPLGLSGDYATAAVSYMPVMWTGGAHGGQGPLVSYFPYACPVAGSSKFTSPRGEEATSPPASSSGPAASLPSTQAESPFSKAPCGRDRGLVTAKSLGPYRASSFSESTFSHDVKKASVKCESVCEAPTFGGKGQFYKLTTSSQHGTSCLPGVLPRKSSGEELLCLPPPSAHLARASSGNLAPQVSKMGNSRFVFPSGGRRYSDMMGQELPQMMQSQKPSVAVARAAEARRNRIELQRSRAQRQQAARIAEPSVS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>