Mapoly0016s0110



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_170346
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR16223 FAMILY NOT NAMED
PANTHER PTHR16223:SF13

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH18 transcription factor, bHLH Mapoly0016s0110.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0016s0110.1 scaffold_16:1053023..1056486  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0016s0110.1  

Gene structure:

mRNA scaffold_16:1053023..1056486  ( - strand )
three_prime_UTR scaffold_16:1053023..1053530  ( - strand )
CDS scaffold_16:1053531..1053554  ( - strand )
CDS scaffold_16:1053725..1053802  ( - strand )
CDS scaffold_16:1054011..1054082  ( - strand )
CDS scaffold_16:1054257..1054403  ( - strand )
CDS scaffold_16:1054774..1055566  ( - strand )
CDS scaffold_16:1055956..1056047  ( - strand )
five_prime_UTR scaffold_16:1056048..1056486  ( - strand )

Sequences:

Gene

>Mapoly0016s0110.1
CAAAGACATTTTAAACTTTCAGCGAAATAGTGTCGGACGAGGACACTTCCATCCTTGTTGATTGAATCGTACTCGCTGTTGTAGGCTTTGGTTCTTTCTAGTGCTCTGGAAGCTGCATTGCTTCGTCCACTGCGCTGTTGTCAACCTCAGTCGGATCATACGGAGGAGGGAGCCGCATTGCCCTCTTGTTAAATTTGGAGCTCGGAGGTTTCTGATTGTCAATTTTGTCGTTAAACTATTTGTCAGAGAGCTTTGTACGTGCTTTCTCCATTGGATCGGTCCTACTATACACGCGGAGCGGAAGCCAATGAACTTCTCCAACAATTACATGTCTGCAGCGTCTGCTGTGAGGACTCGAGCTTTCTAAGTCTACATCGGCAGAAGACAGCAGATTCTAGATACTGCATAGCAAACATCTTAGTCGGATATCTTCAGCATCATGGATGGTCTAAAACCTCCAGAGGTCGCTGCATCTGCTGAAGCGTCAACATCTGCGTTTTACGCTAATGCAGACACGTCTTCCTCCGACATGTACGTAGCCCGGATTTTACATTGACTTGCTTGTCAGGTCTAGTTTCGCATTTTTCAATTTTCACTGTTTGAATGGAGGAATTTGATCGATAGTTAAGGCTTGGTGATACTTGTTCCATGTAAGAATCTGTTATGTATGAATAATACCGTTCAAACACGTAGGTGGTGTAGCATTTAAAACGTTAGCATCAAATTGAAATGATTTACTCGGGGGAAAAGTGAAAGGTGATGTCTATCCGTTCTGAATGTTGAAAGATTTCATTGACTGTTTACAGAAGATTGAAGCTGAACACCATACAATGTATTTCAGCGTAAGAGTCCAATTTCATATTTTGCAGGTAACGTAGACACTGATTTCGTGCATATTTCTCACGCACCTTTCTTGACAGGAAATGTAAACATTTTGCAACAAGGGAAACTTCAGGTCAAGATCCATGGATTGAGGAGAAAATACCAGAAAGTCCGATTATGGGATCTACAACTTGTCTCTCCCAAGATGAAAACAGGGACACTTCATATGTCCCATGTCTCATGCTTTCTGAAAACTTTTATGATTCACGTGGAACACTAACCAATCAACAAACTACTTGCTGGGAGATGGACCGCTCACGTGTGCTCCAACATGCGACATCGCACTCAGAGAAGCATACTGAATTGCCTGCAAGGTCTACTCCTGGTGATTTGTCATGGACTTCCCTGAACAATATCACTAGTAGCAGGTACCCATCGAACCTGGACGTGAAAATCAAAAGGGTTGATGCCAACGTTAATGCCCACTACACAGGTACAAGAAACGAATCTGAGATACTTGCTGACAACACACCCTTTGTCGGTCGAGATCTATCAGTACCAAATAAGGAGAGTCTGAAGATGTCTGATGTATATGACGAAGATATTGAACACTCTCGAAACTCGACTCTTCTCAATCTAAACAAGACATTTATCGATCATCAAGTATCATGTGAAGGCAGCTATATAAGGTCAAATAATGTTCACGTAGAAAGGGTAGTCGTTCAGTCTTCCAAAAATATCTACGGAGAAGCATCTCGGATCAAGCCGACTGAGCAGAATGATATCCACCAGAAGTTCAAATCTATACTCACGAAAGTTCCGAGAAACAGTAAGGAAAGTAAGGAAATGAGCGTGGAACAGCTACAATCAATGGATCTCCTTACTAACAAGGTTAGTCCTTACCAAGAAAGATGAAACCTACGTATGAATTTGAGTACGATGTTTGTTGTTAGACTTCGGTAAATGAAGTAGAGTCGTATTGAACACAATTTTGAAGTTTAGTGCTAGACAGAGATTAGTGCTTCCATTTGGCGTTTGCGTAAACAGAACTTCATTCCAACGAATTCGGGTACGTCTATTGTTGCACACTTACCTGCAATATGGCTGAAGTGATCTCGAGCGGAGATACGGAACTTGGATGGAAAATTAACAATGCAGAACCGAAGGGCTTTATATATAGGTTCCATTAGTTTGTATCCGAGCTCTATCAAAGAAATCCAATTACTGAAGTCCTGTTAATGTTTGTTAATCTCATGTACAGGACGCAGTGAGTTCCAGTTGCACGAGCATCAGCGAAGAAAACTTCAACACCACGCCCGAGTCCAAAGATCCAGAGCTTTTTTCTGAACATTGCAGTTATCGGGCAGCTCGGGGCTGCGCTGTTCATCCCAGAAGTATTGCAGAACGAGTAAGACAATGTCTGATTTCTTTTACACGTATATTAAAGAATCTCTTTGAATTTTCCTCATATAATCAGGTTACGATATTCTTATGTAGCTGTGATCTTTCCTCAGGTAGTGCTTAGACATAAACATAACGGTTCAATTTTCTGCACATGACTCGCTAAGCTGTTTACCCACAGGTGAGGAGATCTCGTATTGCTGAAAGAGTGAAAATACTAGAGGCCAAACTGCCATATCCTACCAAAAAAAAGGTGGGCCTAGCGTTCTAATCCATACAGCGTTATAATTGATCGGTTAGAACCGAGTTTAGTACATGAATTTGAGTGGGCAAGTAGTGGTTTTCTTAAGTTTTCGAATATATGTGCAATTCCATAGTTGGAAGTAAAAGTCCATGAAAGTAGGAAAAATAAATGTTGTAGTAGTTTTTTTATCCTTCCTCAGATTATTCTACGTATGCAGGGAAAGCGTACACTACACACAGATGAAATACTAGAGAGAACAGTCAACTACATCAAATGGCTTGAGGAGTGCATAAAGGTGATATTCTTGATTACCAAAAAGTCCAGAACTTGCCGTAAATATTCGAAGGTTATTGAAGTAACTCAATTCACAAATTAAAAGAACTGAATTTTGTGCACTGCATTCTCACGATTGTTGAGCTGCTAAAGATAAAACTTTAATATCTGATATTTCTCAACTTTTTGCAGATGCTCCAGTCAGAAATATCCTAGTGCTTCTATGGGATGTTCAAATACCTCTTGTAACAAATCCAGAGGGTATTCGACAGACATCAAGAAAATTGTGGACACATTTGATCAGACCAGAAGAGTTGGATGATACCCCAGATGTCTAACTATTCATGTCCATTTTTACAATTCATGTGCATTTAGGACTTCAAAGAAAAATGGAGGCATGATATAAAAAATTTGAATTTTGTATATAGCCCTACTTCGATGGAAGTGATCCAGTAGATATGCTCACTTCATAATCAATTGTTAGTTCCTTATAGATATAAGGGCCACTAGGGTTACCGTAGACTTAAGAAGACCTCGGAGGAGACATGGAATTATAGATGCAAGAAAAGTTGGTCAGTGCTTTACGTAGAGAACCTTGTTTGACTTGACCGACATTAGATTACCATGTAGAAACTTCCGTCAGTCAGACGGGACGTAAAATAACAAGTGCATATCTACATTCAACGACAATGTCACAATAATAAACATGACATATTTGAAATTT

mRNA

>Mapoly0016s0110.1
CAAAGACATTTTAAACTTTCAGCGAAATAGTGTCGGACGAGGACACTTCCATCCTTGTTGATTGAATCGTACTCGCTGTTGTAGGCTTTGGTTCTTTCTAGTGCTCTGGAAGCTGCATTGCTTCGTCCACTGCGCTGTTGTCAACCTCAGTCGGATCATACGGAGGAGGGAGCCGCATTGCCCTCTTGTTAAATTTGGAGCTCGGAGGTTTCTGATTGTCAATTTTGTCGTTAAACTATTTGTCAGAGAGCTTTGTACGTGCTTTCTCCATTGGATCGGTCCTACTATACACGCGGAGCGGAAGCCAATGAACTTCTCCAACAATTACATGTCTGCAGCGTCTGCTGTGAGGACTCGAGCTTTCTAAGTCTACATCGGCAGAAGACAGCAGATTCTAGATACTGCATAGCAAACATCTTAGTCGGATATCTTCAGCATCATGGATGGTCTAAAACCTCCAGAGGTCGCTGCATCTGCTGAAGCGTCAACATCTGCGTTTTACGCTAATGCAGACACGTCTTCCTCCGACATGAAATGTAAACATTTTGCAACAAGGGAAACTTCAGGTCAAGATCCATGGATTGAGGAGAAAATACCAGAAAGTCCGATTATGGGATCTACAACTTGTCTCTCCCAAGATGAAAACAGGGACACTTCATATGTCCCATGTCTCATGCTTTCTGAAAACTTTTATGATTCACGTGGAACACTAACCAATCAACAAACTACTTGCTGGGAGATGGACCGCTCACGTGTGCTCCAACATGCGACATCGCACTCAGAGAAGCATACTGAATTGCCTGCAAGGTCTACTCCTGGTGATTTGTCATGGACTTCCCTGAACAATATCACTAGTAGCAGGTACCCATCGAACCTGGACGTGAAAATCAAAAGGGTTGATGCCAACGTTAATGCCCACTACACAGGTACAAGAAACGAATCTGAGATACTTGCTGACAACACACCCTTTGTCGGTCGAGATCTATCAGTACCAAATAAGGAGAGTCTGAAGATGTCTGATGTATATGACGAAGATATTGAACACTCTCGAAACTCGACTCTTCTCAATCTAAACAAGACATTTATCGATCATCAAGTATCATGTGAAGGCAGCTATATAAGGTCAAATAATGTTCACGTAGAAAGGGTAGTCGTTCAGTCTTCCAAAAATATCTACGGAGAAGCATCTCGGATCAAGCCGACTGAGCAGAATGATATCCACCAGAAGTTCAAATCTATACTCACGAAAGTTCCGAGAAACAGTAAGGAAAGTAAGGAAATGAGCGTGGAACAGCTACAATCAATGGATCTCCTTACTAACAAGGACGCAGTGAGTTCCAGTTGCACGAGCATCAGCGAAGAAAACTTCAACACCACGCCCGAGTCCAAAGATCCAGAGCTTTTTTCTGAACATTGCAGTTATCGGGCAGCTCGGGGCTGCGCTGTTCATCCCAGAAGTATTGCAGAACGAGTGAGGAGATCTCGTATTGCTGAAAGAGTGAAAATACTAGAGGCCAAACTGCCATATCCTACCAAAAAAAAGGGAAAGCGTACACTACACACAGATGAAATACTAGAGAGAACAGTCAACTACATCAAATGGCTTGAGGAGTGCATAAAGATGCTCCAGTCAGAAATATCCTAGTGCTTCTATGGGATGTTCAAATACCTCTTGTAACAAATCCAGAGGGTATTCGACAGACATCAAGAAAATTGTGGACACATTTGATCAGACCAGAAGAGTTGGATGATACCCCAGATGTCTAACTATTCATGTCCATTTTTACAATTCATGTGCATTTAGGACTTCAAAGAAAAATGGAGGCATGATATAAAAAATTTGAATTTTGTATATAGCCCTACTTCGATGGAAGTGATCCAGTAGATATGCTCACTTCATAATCAATTGTTAGTTCCTTATAGATATAAGGGCCACTAGGGTTACCGTAGACTTAAGAAGACCTCGGAGGAGACATGGAATTATAGATGCAAGAAAAGTTGGTCAGTGCTTTACGTAGAGAACCTTGTTTGACTTGACCGACATTAGATTACCATGTAGAAACTTCCGTCAGTCAGACGGGACGTAAAATAACAAGTGCATATCTACATTCAACGACAATGTCACAATAATAAACATGACATATTTGAAATTT

CDS

>Mapoly0016s0110.1
ATGGATGGTCTAAAACCTCCAGAGGTCGCTGCATCTGCTGAAGCGTCAACATCTGCGTTTTACGCTAATGCAGACACGTCTTCCTCCGACATGAAATGTAAACATTTTGCAACAAGGGAAACTTCAGGTCAAGATCCATGGATTGAGGAGAAAATACCAGAAAGTCCGATTATGGGATCTACAACTTGTCTCTCCCAAGATGAAAACAGGGACACTTCATATGTCCCATGTCTCATGCTTTCTGAAAACTTTTATGATTCACGTGGAACACTAACCAATCAACAAACTACTTGCTGGGAGATGGACCGCTCACGTGTGCTCCAACATGCGACATCGCACTCAGAGAAGCATACTGAATTGCCTGCAAGGTCTACTCCTGGTGATTTGTCATGGACTTCCCTGAACAATATCACTAGTAGCAGGTACCCATCGAACCTGGACGTGAAAATCAAAAGGGTTGATGCCAACGTTAATGCCCACTACACAGGTACAAGAAACGAATCTGAGATACTTGCTGACAACACACCCTTTGTCGGTCGAGATCTATCAGTACCAAATAAGGAGAGTCTGAAGATGTCTGATGTATATGACGAAGATATTGAACACTCTCGAAACTCGACTCTTCTCAATCTAAACAAGACATTTATCGATCATCAAGTATCATGTGAAGGCAGCTATATAAGGTCAAATAATGTTCACGTAGAAAGGGTAGTCGTTCAGTCTTCCAAAAATATCTACGGAGAAGCATCTCGGATCAAGCCGACTGAGCAGAATGATATCCACCAGAAGTTCAAATCTATACTCACGAAAGTTCCGAGAAACAGTAAGGAAAGTAAGGAAATGAGCGTGGAACAGCTACAATCAATGGATCTCCTTACTAACAAGGACGCAGTGAGTTCCAGTTGCACGAGCATCAGCGAAGAAAACTTCAACACCACGCCCGAGTCCAAAGATCCAGAGCTTTTTTCTGAACATTGCAGTTATCGGGCAGCTCGGGGCTGCGCTGTTCATCCCAGAAGTATTGCAGAACGAGTGAGGAGATCTCGTATTGCTGAAAGAGTGAAAATACTAGAGGCCAAACTGCCATATCCTACCAAAAAAAAGGGAAAGCGTACACTACACACAGATGAAATACTAGAGAGAACAGTCAACTACATCAAATGGCTTGAGGAGTGCATAAAGATGCTCCAGTCAGAAATATCCTAG

Protein

>Mapoly0016s0110.1
MDGLKPPEVAASAEASTSAFYANADTSSSDMKCKHFATRETSGQDPWIEEKIPESPIMGSTTCLSQDENRDTSYVPCLMLSENFYDSRGTLTNQQTTCWEMDRSRVLQHATSHSEKHTELPARSTPGDLSWTSLNNITSSRYPSNLDVKIKRVDANVNAHYTGTRNESEILADNTPFVGRDLSVPNKESLKMSDVYDEDIEHSRNSTLLNLNKTFIDHQVSCEGSYIRSNNVHVERVVVQSSKNIYGEASRIKPTEQNDIHQKFKSILTKVPRNSKESKEMSVEQLQSMDLLTNKDAVSSSCTSISEENFNTTPESKDPELFSEHCSYRAARGCAVHPRSIAERVRRSRIAERVKILEAKLPYPTKKKGKRTLHTDEILERTVNYIKWLEECIKMLQSEIS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>