Mapoly0018s0011



Description

GAGA binding protein-like family

Reference DB

Database ID Description
OrthoMCL OG5_170179
PFAM PF06217 GAGA binding protein-like family
PANTHER PTHR31421 FAMILY NOT NAMED
PANTHER PTHR31421:SF1

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBPC1 transcription factor, BBR/BPC Mapoly0018s0011.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0018s0011.1 scaffold_18:793959..796930  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0018s0011.2 scaffold_18:795072..797473  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0018s0011.1  

Gene structure:

mRNA scaffold_18:793959..796930  ( - strand )
three_prime_UTR scaffold_18:793959..794275  ( - strand )
three_prime_UTR scaffold_18:795577..795676  ( - strand )
CDS scaffold_18:795677..796882  ( - strand )
five_prime_UTR scaffold_18:796883..796930  ( - strand )

Sequences:

Gene

>Mapoly0018s0011.1
TCAATGTTGGTTTGACAAGATGCCGGGGGCCCTGTTCGTTTCATCGTCATGAACGTTTTATGCTGTTTGATTGAAGCTGTGCTTCGCACCATCACCTTCAGTCGCACTGCAATAGGATTTGCCCCCGTGTCACCTTTCTGTACAAGAGAGAGGTTGTTTTTAGCTTATCAAGTACTTGTCTTGACTGGCATGGACGCAGAAACCTTAAGAGAGCGACGCTTTTCTCAAGACAGTTTCTGGAATGAGGGGCTTCCCGATTTTGTGAGCAAGTTTGCACCAGTGACTCAGGGCAGTTCATTAGCGAGAGGTCCTTTCCTCGACGATTTGTCGTACTCTATGGATGACGAGGGAAGAGTTGGCGTTCGGCGAAGAATGATTTGCGATCAAACTGCCCTAAAACTGGTGAAAGCCATTGCTGAACGCGACGCAGCCATCCTCGAGAGGAATAGCGCCATTGCCGAGAAGAAAGCCGCTTGTGTGGAAAGAGATGCAGCTCTTTTGCGTTGTGATCTCGCGTTCTCAGAGCGGGATTCCGCCCTTGTCGAGCGTGATGCAGCAGTCGCCGCCTTGGGGGCCGTGCGGGCAGGAAAGTTTGCAACGTTTACTGAGTGGACGAGGCATGGCTCTCCAAACGCCGTGACCAGCAAGACACTTCAACCCCCTGTTGTTGACAGTAGCCCGTTTAGTGTGGATTTTGCGTCGGCCGCTGCATGCCAGTGGAAGAGTGCTGTAGGACGCACTAATATATGTTCAGAGTACATTCAAAAGCAGAGCATGGCTGGAAACGTCAGGGAAAGTCAGCGAGACCTTCGTTCGAAGAGGAAGATTGGCAAAGATACCAAGCAAGGCTTTCTGTCATCGAGGAAAAGGCCACCTGAGCAGAAGCTCCTGATCTATCAGCGGGAAAATTTGGACCAGAATGAGCGCGGCAGCTCTGTTACAGAGGAAGTTGCCGATGAAAACATTTGCAATTCCATACCCTACTGCTCATGTACTGGTGTTAACCAGCCATGCTACAAGTGGGGCAACGGAGGATGGCAGTCTGCTTGCTGCACCACTATGATCTCCATGTACCCCCTTCCAATGAACCCCAAGAAAAGAAGTTCGCGGTTGGCCGGACGGAAAATGAGTGCCGGGGCTTTTGAAAAGCTCGTGGAGAAACTCACTCTCGAAGGGGTTAATGTCAGATGCCCTATAGATTTGAAAGATCATTGGGCAAAGCATGGCACGAATCGTTATGTCACTCTTAGGTAGTGATATTCGCCTATGCGACCAGGACTTCCTGCTTCGTATCACAGTCTGGAGGTTCCAACCCCTGGAGCAAATTGGAGATTGCACTACTTCAGTTCAGCAAGTCAGTTCCGTTTTTTTGAAGTCGGGTGTATATGATCCTGGAGCTATAGCTGCTTACTGCTTGCTGTAGTTCTGATGCGCCTACTAAAGGGTTATGTCAACGGACGTTTGACAGTTAGTAGACTGGACCTGCTTTTGGGCCTTAAACTATCGTATTGTTTGCTTCGCTTTCTAACGACGCTTTTGACGCACTGTTTGCTACTTCGAGAAGTTATGGAGGAACTCATCAACTGATGTGGGATGCCCAAAATTTTGTTGAAAGCTTAATTGTGGGGGTTTTATTAAGTTCTTTTCCTGGCCGCAGGTATTTTACGTCATAGAACCCTATTTGTTGTTCTTAGTGCTTTCATCGAATGAATGGATCTTCACTCACAAACATGCAAGGATTTCAGCCTTGTTTTGTCGGCTGTCAGTCTCTAATTTCAAAATTGCGGAGTGGGATTTGCAAGTCTCTCGTTTACTATTCAGTTTCTGTCTACCTCGATTCTAATGATTAGTGTGTATACTTAGTTGGACTGTTTCACGAGGAACTCCAGTAGTTACCTTCTGTACGAGATGGACCTTTCGTTGAGTTTTACTCACGAGTAGATTTAAGCCTTTTGTTCTGTTCCCGTACGCACGGCACATCACTGGTTTATCTTCACTGAGAAAACACTGCCCAATATTTCGGTGAAGTACATATACGATATTGTTTAGACAAAGAAGTATGTCTTTGCAAAACACGATGTGCCGACTGTAATAGAAACTTGGATCTAATCGCGCAGTTCGGTCCACAGTCATCCCCGTTTGGATTTTTGAGAATTTGGAGGATGCGTTTGTTTTAAATTTAAAGTGACAAAGGTCGAGTGAAATGGTTGTTGTGGACAATATTTCGAAGGTAATGAACATCTCGTACCGCATGAAGGGCGTTCCTTCATGCGGTACGTGATGGTCATCGTAGTGCAATCTGAGAGGTAATGTCACTTGTGAGCGGGAAAGGTAGGCTTGTATCACTTGTAGAAGAGGTGGGAAATGTTTTCTGGATACTTAGGTTTTCAGGTATGTCTTTATTACCTCTTATGCCAGTAGGGGTTCTTGTCACATTCATAGATATCAGATGTTACGGTCTTTTCTCCCGTATAAAGTATCAATCACCTTCGGATCTATGTGCCGGTGCATCTGAACTAGCTTTGTTTTGCGGCTTCCCGATGAAATTTGATGAAGCACAATGATGTTCAGCACGCAGTGCTCAGTTTACCACTAGCTGGTGTTGACTGAAAGTGACAATCTGAACTCTAATATTTGCCGGAATTAATCCTGCAGTGAATAGGTGGACGTGCTCGTGGAGAGGGTAGGTTCTTTGTTACTGTAAGGGGCTGCGGTGGTAAGTCGCAGATCGGTGACTGTGATCTGCGCAAAATATGGCCATTATAGTTAGGCTAGCAACTTCGTAGGGTTCGAATGAAAGGCAAAGTGCTGCGCAAGGTAATACATTACCGTTACTTGAAGGTGTCCACCATGCTTTCAAGTCACAGTATTTTCAGATATTTGTCACCACGAACTAGTTGTTGAACGATCTTCATTTGATCTTCATCTGAACCCCAAAATGCGTCATTGTTTTGCCACTACTCTCCGATGGG

mRNA

>Mapoly0018s0011.1
TCAATGTTGGTTTGACAAGATGCCGGGGGCCCTGTTCGTTTCATCGTCATGAACGTTTTATGCTGTTTGATTGAAGCTGTGCTTCGCACCATCACCTTCAGTCGCACTGCAATAGGATTTGCCCCCGTGTCACCTTTCTGTACAAGAGAGAGGTTGTTTTTAGCTTATCAAGTACTTGTCTTGACTGGCATGGACGCAGAAACCTTAAGAGAGCGACGCTTTTCTCAAGACAGTTTCTGGAATGAGGGGCTTCCCGATTTTGTGAGCAAGTTTGCACCAGTGACTCAGGGCAGTTCATTAGCGAGAGGTCCTTTCCTCGACGATTTGTCGTACTCTATGGATGACGAGGGAAGAGTTGGCGTTCGGCGAAGAATGATTTGCGATCAAACTGCCCTAAAACTGGTGAAAGCCATTGCTGAACGCGACGCAGCCATCCTCGAGAGGAATAGCGCCATTGCCGAGAAGAAAGCCGCTTGTGTGGAAAGAGATGCAGCTCTTTTGCGTTGTGATCTCGCGTTCTCAGAGCGGGATTCCGCCCTTGTCGAGCGTGATGCAGCAGTCGCCGCCTTGGGGGCCGTGCGGGCAGGAAAGTTTGCAACGTTTACTGAGTGGACGAGGCATGGCTCTCCAAACGCCGTGACCAGCAAGACACTTCAACCCCCTGTTGTTGACAGTAGCCCGTTTAGTGTGGATTTTGCGTCGGCCGCTGCATGCCAGTGGAAGAGTGCTGTAGGACGCACTAATATATGTTCAGAGTACATTCAAAAGCAGAGCATGGCTGGAAACGTCAGGGAAAGTCAGCGAGACCTTCGTTCGAAGAGGAAGATTGGCAAAGATACCAAGCAAGGCTTTCTGTCATCGAGGAAAAGGCCACCTGAGCAGAAGCTCCTGATCTATCAGCGGGAAAATTTGGACCAGAATGAGCGCGGCAGCTCTGTTACAGAGGAAGTTGCCGATGAAAACATTTGCAATTCCATACCCTACTGCTCATGTACTGGTGTTAACCAGCCATGCTACAAGTGGGGCAACGGAGGATGGCAGTCTGCTTGCTGCACCACTATGATCTCCATGTACCCCCTTCCAATGAACCCCAAGAAAAGAAGTTCGCGGTTGGCCGGACGGAAAATGAGTGCCGGGGCTTTTGAAAAGCTCGTGGAGAAACTCACTCTCGAAGGGGTTAATGTCAGATGCCCTATAGATTTGAAAGATCATTGGGCAAAGCATGGCACGAATCGTTATGTCACTCTTAGGTAGTGATATTCGCCTATGCGACCAGGACTTCCTGCTTCGTATCACAGTCTGGAGGTTCCAACCCCTGGAGCAAATTGGAGATTGCACTACTTCAGTTCAGCAATGAATAGGTGGACGTGCTCGTGGAGAGGGTAGGTTCTTTGTTACTGTAAGGGGCTGCGGTGGTAAGTCGCAGATCGGTGACTGTGATCTGCGCAAAATATGGCCATTATAGTTAGGCTAGCAACTTCGTAGGGTTCGAATGAAAGGCAAAGTGCTGCGCAAGGTAATACATTACCGTTACTTGAAGGTGTCCACCATGCTTTCAAGTCACAGTATTTTCAGATATTTGTCACCACGAACTAGTTGTTGAACGATCTTCATTTGATCTTCATCTGAACCCCAAAATGCGTCATTGTTTTGCCACTACTCTCCGATGGG

CDS

>Mapoly0018s0011.1
ATGAACGTTTTATGCTGTTTGATTGAAGCTGTGCTTCGCACCATCACCTTCAGTCGCACTGCAATAGGATTTGCCCCCGTGTCACCTTTCTGTACAAGAGAGAGGTTGTTTTTAGCTTATCAAGTACTTGTCTTGACTGGCATGGACGCAGAAACCTTAAGAGAGCGACGCTTTTCTCAAGACAGTTTCTGGAATGAGGGGCTTCCCGATTTTGTGAGCAAGTTTGCACCAGTGACTCAGGGCAGTTCATTAGCGAGAGGTCCTTTCCTCGACGATTTGTCGTACTCTATGGATGACGAGGGAAGAGTTGGCGTTCGGCGAAGAATGATTTGCGATCAAACTGCCCTAAAACTGGTGAAAGCCATTGCTGAACGCGACGCAGCCATCCTCGAGAGGAATAGCGCCATTGCCGAGAAGAAAGCCGCTTGTGTGGAAAGAGATGCAGCTCTTTTGCGTTGTGATCTCGCGTTCTCAGAGCGGGATTCCGCCCTTGTCGAGCGTGATGCAGCAGTCGCCGCCTTGGGGGCCGTGCGGGCAGGAAAGTTTGCAACGTTTACTGAGTGGACGAGGCATGGCTCTCCAAACGCCGTGACCAGCAAGACACTTCAACCCCCTGTTGTTGACAGTAGCCCGTTTAGTGTGGATTTTGCGTCGGCCGCTGCATGCCAGTGGAAGAGTGCTGTAGGACGCACTAATATATGTTCAGAGTACATTCAAAAGCAGAGCATGGCTGGAAACGTCAGGGAAAGTCAGCGAGACCTTCGTTCGAAGAGGAAGATTGGCAAAGATACCAAGCAAGGCTTTCTGTCATCGAGGAAAAGGCCACCTGAGCAGAAGCTCCTGATCTATCAGCGGGAAAATTTGGACCAGAATGAGCGCGGCAGCTCTGTTACAGAGGAAGTTGCCGATGAAAACATTTGCAATTCCATACCCTACTGCTCATGTACTGGTGTTAACCAGCCATGCTACAAGTGGGGCAACGGAGGATGGCAGTCTGCTTGCTGCACCACTATGATCTCCATGTACCCCCTTCCAATGAACCCCAAGAAAAGAAGTTCGCGGTTGGCCGGACGGAAAATGAGTGCCGGGGCTTTTGAAAAGCTCGTGGAGAAACTCACTCTCGAAGGGGTTAATGTCAGATGCCCTATAGATTTGAAAGATCATTGGGCAAAGCATGGCACGAATCGTTATGTCACTCTTAGGTAG

Protein

>Mapoly0018s0011.1
MNVLCCLIEAVLRTITFSRTAIGFAPVSPFCTRERLFLAYQVLVLTGMDAETLRERRFSQDSFWNEGLPDFVSKFAPVTQGSSLARGPFLDDLSYSMDDEGRVGVRRRMICDQTALKLVKAIAERDAAILERNSAIAEKKAACVERDAALLRCDLAFSERDSALVERDAAVAALGAVRAGKFATFTEWTRHGSPNAVTSKTLQPPVVDSSPFSVDFASAAACQWKSAVGRTNICSEYIQKQSMAGNVRESQRDLRSKRKIGKDTKQGFLSSRKRPPEQKLLIYQRENLDQNERGSSVTEEVADENICNSIPYCSCTGVNQPCYKWGNGGWQSACCTTMISMYPLPMNPKKRSSRLAGRKMSAGAFEKLVEKLTLEGVNVRCPIDLKDHWAKHGTNRYVTLR

Mapoly0018s0011.2  

Gene structure:

mRNA scaffold_18:795072..797473  ( - strand )
three_prime_UTR scaffold_18:795072..795676  ( - strand )
CDS scaffold_18:795677..796731  ( - strand )
CDS scaffold_18:797001..797037  ( - strand )
five_prime_UTR scaffold_18:797038..797473  ( - strand )

Sequences:

Gene

>Mapoly0018s0011.2
CTTGAGCGCAGAACGAAGTGAGACTTACTACCAACTCTTATTAAATTATAGCTACCCACTATGAAAGCCCTAATAGCCTGGTGAAAAAGTGGCGTTGTGTCCGGTTTGAAAATACTCGAAAAGTCGGAAAAAGTGGAAAAGAAAGTCCCGACAGTCATGATGGCAGATAACCTACGCCAACCTCTGGTACTTTGATACATCGTTTCAGAGCGTGCGGAGTGAGCTATTCGCCTTAGTTTGTGGTATTCGCGCAGGACTTCAAGCCCATGTGTGTTGTTATGGCCTGTCAGCGATCCAACCTCTTTTGAACTGGCGTAGGCATCGACCTTCTCGTAGCGGAGCTAAAACTGTCTGAAATTGCCCTACAAATAGCTCGCTGGACTTAAGTATCTTGTTCCTGCGATCTGGCCTTAATGGGAGTGATTATTTTGACGAGATGGTGACAACGTCTACAGGATTGAAGTATGTTGTGGGTGAGTAAATAGCAGGTTCTACTCTTGTGAGTCGGAGGAGCTTTTCTATTACAGTCATTTGAGAACAAAGTCAATGTTGGTTTGACAAGATGCCGGGGGCCCTGTTCGTTTCATCGTCATGAACGTTTTATGCTGTTTGATTGAAGCTGTGCTTCGCACCATCACCTTCAGTCGCACTGCAATAGGATTTGCCCCCGTGTCACCTTTCTGTACAAGAGAGAGGTTGTTTTTAGCTTATCAAGTACTTGTCTTGACTGGCATGGACGCAGAAACCTTAAGAGAGCGACGCTTTTCTCAAGACAGTTTCTGGAATGAGGGGCTTCCCGATTTTGTGAGCAAGTTTGCACCAGTGACTCAGGGCAGTTCATTAGCGAGAGGTCCTTTCCTCGACGATTTGTCGTACTCTATGGATGACGAGGGAAGAGTTGGCGTTCGGCGAAGAATGATTTGCGATCAAACTGCCCTAAAACTGGTGAAAGCCATTGCTGAACGCGACGCAGCCATCCTCGAGAGGAATAGCGCCATTGCCGAGAAGAAAGCCGCTTGTGTGGAAAGAGATGCAGCTCTTTTGCGTTGTGATCTCGCGTTCTCAGAGCGGGATTCCGCCCTTGTCGAGCGTGATGCAGCAGTCGCCGCCTTGGGGGCCGTGCGGGCAGGAAAGTTTGCAACGTTTACTGAGTGGACGAGGCATGGCTCTCCAAACGCCGTGACCAGCAAGACACTTCAACCCCCTGTTGTTGACAGTAGCCCGTTTAGTGTGGATTTTGCGTCGGCCGCTGCATGCCAGTGGAAGAGTGCTGTAGGACGCACTAATATATGTTCAGAGTACATTCAAAAGCAGAGCATGGCTGGAAACGTCAGGGAAAGTCAGCGAGACCTTCGTTCGAAGAGGAAGATTGGCAAAGATACCAAGCAAGGCTTTCTGTCATCGAGGAAAAGGCCACCTGAGCAGAAGCTCCTGATCTATCAGCGGGAAAATTTGGACCAGAATGAGCGCGGCAGCTCTGTTACAGAGGAAGTTGCCGATGAAAACATTTGCAATTCCATACCCTACTGCTCATGTACTGGTGTTAACCAGCCATGCTACAAGTGGGGCAACGGAGGATGGCAGTCTGCTTGCTGCACCACTATGATCTCCATGTACCCCCTTCCAATGAACCCCAAGAAAAGAAGTTCGCGGTTGGCCGGACGGAAAATGAGTGCCGGGGCTTTTGAAAAGCTCGTGGAGAAACTCACTCTCGAAGGGGTTAATGTCAGATGCCCTATAGATTTGAAAGATCATTGGGCAAAGCATGGCACGAATCGTTATGTCACTCTTAGGTAGTGATATTCGCCTATGCGACCAGGACTTCCTGCTTCGTATCACAGTCTGGAGGTTCCAACCCCTGGAGCAAATTGGAGATTGCACTACTTCAGTTCAGCAAGTCAGTTCCGTTTTTTTGAAGTCGGGTGTATATGATCCTGGAGCTATAGCTGCTTACTGCTTGCTGTAGTTCTGATGCGCCTACTAAAGGGTTATGTCAACGGACGTTTGACAGTTAGTAGACTGGACCTGCTTTTGGGCCTTAAACTATCGTATTGTTTGCTTCGCTTTCTAACGACGCTTTTGACGCACTGTTTGCTACTTCGAGAAGTTATGGAGGAACTCATCAACTGATGTGGGATGCCCAAAATTTTGTTGAAAGCTTAATTGTGGGGGTTTTATTAAGTTCTTTTCCTGGCCGCAGGTATTTTACGTCATAGAACCCTATTTGTTGTTCTTAGTGCTTTCATCGAATGAATGGATCTTCACTCACAAACATGCAAGGATTTCAGCCTTGTTTTGTCGGCTGTCAGTCTCTAATTTCAAAATTGCGGAGTGGGATTTGCAAGTCTCTCGTTTACTATTCAGTTTCTGTCTACCTCGATTCTAATGATTAGTGTGTATAC

mRNA

>Mapoly0018s0011.2
CTTGAGCGCAGAACGAAGTGAGACTTACTACCAACTCTTATTAAATTATAGCTACCCACTATGAAAGCCCTAATAGCCTGGTGAAAAAGTGGCGTTGTGTCCGGTTTGAAAATACTCGAAAAGTCGGAAAAAGTGGAAAAGAAAGTCCCGACAGTCATGATGGCAGATAACCTACGCCAACCTCTGGTACTTTGATACATCGTTTCAGAGCGTGCGGAGTGAGCTATTCGCCTTAGTTTGTGGTATTCGCGCAGGACTTCAAGCCCATGTGTGTTGTTATGGCCTGTCAGCGATCCAACCTCTTTTGAACTGGCGTAGGCATCGACCTTCTCGTAGCGGAGCTAAAACTGTCTGAAATTGCCCTACAAATAGCTCGCTGGACTTAAGTATCTTGTTCCTGCGATCTGGCCTTAATGGGAGTGATTATTTTGACGAGATGGTGACAACGTCTACAGGATTGAAGTATGTTGTGGAAACCTTAAGAGAGCGACGCTTTTCTCAAGACAGTTTCTGGAATGAGGGGCTTCCCGATTTTGTGAGCAAGTTTGCACCAGTGACTCAGGGCAGTTCATTAGCGAGAGGTCCTTTCCTCGACGATTTGTCGTACTCTATGGATGACGAGGGAAGAGTTGGCGTTCGGCGAAGAATGATTTGCGATCAAACTGCCCTAAAACTGGTGAAAGCCATTGCTGAACGCGACGCAGCCATCCTCGAGAGGAATAGCGCCATTGCCGAGAAGAAAGCCGCTTGTGTGGAAAGAGATGCAGCTCTTTTGCGTTGTGATCTCGCGTTCTCAGAGCGGGATTCCGCCCTTGTCGAGCGTGATGCAGCAGTCGCCGCCTTGGGGGCCGTGCGGGCAGGAAAGTTTGCAACGTTTACTGAGTGGACGAGGCATGGCTCTCCAAACGCCGTGACCAGCAAGACACTTCAACCCCCTGTTGTTGACAGTAGCCCGTTTAGTGTGGATTTTGCGTCGGCCGCTGCATGCCAGTGGAAGAGTGCTGTAGGACGCACTAATATATGTTCAGAGTACATTCAAAAGCAGAGCATGGCTGGAAACGTCAGGGAAAGTCAGCGAGACCTTCGTTCGAAGAGGAAGATTGGCAAAGATACCAAGCAAGGCTTTCTGTCATCGAGGAAAAGGCCACCTGAGCAGAAGCTCCTGATCTATCAGCGGGAAAATTTGGACCAGAATGAGCGCGGCAGCTCTGTTACAGAGGAAGTTGCCGATGAAAACATTTGCAATTCCATACCCTACTGCTCATGTACTGGTGTTAACCAGCCATGCTACAAGTGGGGCAACGGAGGATGGCAGTCTGCTTGCTGCACCACTATGATCTCCATGTACCCCCTTCCAATGAACCCCAAGAAAAGAAGTTCGCGGTTGGCCGGACGGAAAATGAGTGCCGGGGCTTTTGAAAAGCTCGTGGAGAAACTCACTCTCGAAGGGGTTAATGTCAGATGCCCTATAGATTTGAAAGATCATTGGGCAAAGCATGGCACGAATCGTTATGTCACTCTTAGGTAGTGATATTCGCCTATGCGACCAGGACTTCCTGCTTCGTATCACAGTCTGGAGGTTCCAACCCCTGGAGCAAATTGGAGATTGCACTACTTCAGTTCAGCAAGTCAGTTCCGTTTTTTTGAAGTCGGGTGTATATGATCCTGGAGCTATAGCTGCTTACTGCTTGCTGTAGTTCTGATGCGCCTACTAAAGGGTTATGTCAACGGACGTTTGACAGTTAGTAGACTGGACCTGCTTTTGGGCCTTAAACTATCGTATTGTTTGCTTCGCTTTCTAACGACGCTTTTGACGCACTGTTTGCTACTTCGAGAAGTTATGGAGGAACTCATCAACTGATGTGGGATGCCCAAAATTTTGTTGAAAGCTTAATTGTGGGGGTTTTATTAAGTTCTTTTCCTGGCCGCAGGTATTTTACGTCATAGAACCCTATTTGTTGTTCTTAGTGCTTTCATCGAATGAATGGATCTTCACTCACAAACATGCAAGGATTTCAGCCTTGTTTTGTCGGCTGTCAGTCTCTAATTTCAAAATTGCGGAGTGGGATTTGCAAGTCTCTCGTTTACTATTCAGTTTCTGTCTACCTCGATTCTAATGATTAGTGTGTATAC

CDS

>Mapoly0018s0011.2
ATGGTGACAACGTCTACAGGATTGAAGTATGTTGTGGAAACCTTAAGAGAGCGACGCTTTTCTCAAGACAGTTTCTGGAATGAGGGGCTTCCCGATTTTGTGAGCAAGTTTGCACCAGTGACTCAGGGCAGTTCATTAGCGAGAGGTCCTTTCCTCGACGATTTGTCGTACTCTATGGATGACGAGGGAAGAGTTGGCGTTCGGCGAAGAATGATTTGCGATCAAACTGCCCTAAAACTGGTGAAAGCCATTGCTGAACGCGACGCAGCCATCCTCGAGAGGAATAGCGCCATTGCCGAGAAGAAAGCCGCTTGTGTGGAAAGAGATGCAGCTCTTTTGCGTTGTGATCTCGCGTTCTCAGAGCGGGATTCCGCCCTTGTCGAGCGTGATGCAGCAGTCGCCGCCTTGGGGGCCGTGCGGGCAGGAAAGTTTGCAACGTTTACTGAGTGGACGAGGCATGGCTCTCCAAACGCCGTGACCAGCAAGACACTTCAACCCCCTGTTGTTGACAGTAGCCCGTTTAGTGTGGATTTTGCGTCGGCCGCTGCATGCCAGTGGAAGAGTGCTGTAGGACGCACTAATATATGTTCAGAGTACATTCAAAAGCAGAGCATGGCTGGAAACGTCAGGGAAAGTCAGCGAGACCTTCGTTCGAAGAGGAAGATTGGCAAAGATACCAAGCAAGGCTTTCTGTCATCGAGGAAAAGGCCACCTGAGCAGAAGCTCCTGATCTATCAGCGGGAAAATTTGGACCAGAATGAGCGCGGCAGCTCTGTTACAGAGGAAGTTGCCGATGAAAACATTTGCAATTCCATACCCTACTGCTCATGTACTGGTGTTAACCAGCCATGCTACAAGTGGGGCAACGGAGGATGGCAGTCTGCTTGCTGCACCACTATGATCTCCATGTACCCCCTTCCAATGAACCCCAAGAAAAGAAGTTCGCGGTTGGCCGGACGGAAAATGAGTGCCGGGGCTTTTGAAAAGCTCGTGGAGAAACTCACTCTCGAAGGGGTTAATGTCAGATGCCCTATAGATTTGAAAGATCATTGGGCAAAGCATGGCACGAATCGTTATGTCACTCTTAGGTAG

Protein

>Mapoly0018s0011.2
MVTTSTGLKYVVETLRERRFSQDSFWNEGLPDFVSKFAPVTQGSSLARGPFLDDLSYSMDDEGRVGVRRRMICDQTALKLVKAIAERDAAILERNSAIAEKKAACVERDAALLRCDLAFSERDSALVERDAAVAALGAVRAGKFATFTEWTRHGSPNAVTSKTLQPPVVDSSPFSVDFASAAACQWKSAVGRTNICSEYIQKQSMAGNVRESQRDLRSKRKIGKDTKQGFLSSRKRPPEQKLLIYQRENLDQNERGSSVTEEVADENICNSIPYCSCTGVNQPCYKWGNGGWQSACCTTMISMYPLPMNPKKRSSRLAGRKMSAGAFEKLVEKLTLEGVNVRCPIDLKDHWAKHGTNRYVTLR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>