Mapoly0019s0045



Description

AUX/IAA family // B3 DNA binding domain // Auxin response factor

Reference DB

Database ID Description
GO GO:0003677 DNA binding
GO GO:0005634 Nucleus
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0009725 Response to hormone stimulus
OrthoMCL OG5_137521
PFAM PF02309 AUX/IAA family
PFAM PF02362 B3 DNA binding domain
PFAM PF06507 Auxin response factor
PANTHER PTHR31384 FAMILY NOT NAMED
PANTHER PTHR31384:SF3

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpB3-3 transcription factor, B3 Mapoly0019s0045.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0019s0045.1 scaffold_19:399142..406810  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0019s0045.2 scaffold_19:399142..406810  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0019s0045.1  

Gene structure:

mRNA scaffold_19:399142..406810  ( - strand )
three_prime_UTR scaffold_19:399142..400080  ( - strand )
CDS scaffold_19:400081..400282  ( - strand )
CDS scaffold_19:400447..400637  ( - strand )
CDS scaffold_19:400881..402082  ( - strand )
CDS scaffold_19:402298..402451  ( - strand )
CDS scaffold_19:402596..402671  ( - strand )
CDS scaffold_19:403001..403123  ( - strand )
CDS scaffold_19:403295..403459  ( - strand )
CDS scaffold_19:403684..403774  ( - strand )
CDS scaffold_19:403933..404026  ( - strand )
CDS scaffold_19:404176..404331  ( - strand )
CDS scaffold_19:404480..404536  ( - strand )
CDS scaffold_19:404639..404737  ( - strand )
CDS scaffold_19:404951..405063  ( - strand )
CDS scaffold_19:406414..406477  ( - strand )
five_prime_UTR scaffold_19:406478..406810  ( - strand )

Sequences:

Gene

>Mapoly0019s0045.1
CAGCGAATGTTGTCGTCATTTCAAGAGGCCTAGGAAGGGGTTCAGCTGTCGCCTTTTGATGGTGCAGTGTTTCGAAGCTTTGGACTAAACCGCGCAGGGAGGAGTGCCAATGAAGAGGTTCTCTTGACTGCAATGTAAAAAGAGGCACGGTCCTAAGAAGCTTCTAGCTGCAGCAGGGATGGGGCGCTGGAAAGGCATGCATAGGAGTGAATATCGCAGATGGAACTTCACTGACATGAGCTCTCCAGTCTCTCTCTGTATATGAGGGAGGTGCTGGTTTGAGCTGTGCAATCTCGGTCGCGTCCGCCATAGAACGATTGCCCTCGGTTCTTTATGTATTCTTGTTCGCCGATGAGGCTGTCTGCCTCTGGATATGCGCAACATCAAACAATGACAGGTAAACTCTCCATTCCTCGGACTAGGTTCCTCCTTCTCTCTGAGTCCTTGGCTGCTGCTCGGCACTCACCACAATGTGATGAGGGACACGCTCTTCAGCTCCGCCGGAACTATGATGATTTATTCGTGGGCTGGAGCTCGCGCGCTCCTGCTCTCATGCAAGCTCACTTTCGCTCAGTCGGCCGGGAAATAGCAGACAGCCTGCAGGGATGATTTTCGGTGCGCCCAATCCTCTGCCGAGCTCCTCGCGACAGCCCAGAGGAGTGTCTCGTATGATTAGACTCGGCTCTTGCATGCCACCCTCACGCCGATTGGCAGAATGTTTGAGGCCATCTAGATAGTGCAGGCTACGCCATGCGACCGTACATAACTCAGGAGCCTTGACAAATCCAATCATGAGAGGTCGGCCGCAATGACACCGTGTAACGACCCAGTGAGCCTCGGCCGACGTTCACGTTCCCGCATTCATGATATGCAAAGGCCGGTGAAGACGATTTGAAGGACAGGAATACTCTGAAGGCTAGGAAGCTGTAAGTCAACCTGCAGTATTAGACGGGATGGAATCAGACGCCATCCCGAAGACTGAAGGCCAAGCGATGGGTAATTAGTTTCTTATCTGCGCCGCCGGAATCGAATCGCGCCGCATGATGAGTTTCTTAGGCCGACCGCAGGAAGGAAGATTTGTGAAGTTCACATTCTGGCCAACCTGGTGACAGCGGCGGCGTGGACGCCACACGGTGAAGCCACCATTTGTCTTCATGGATGTTCGCGTGCTCTCGGAGGCGCCTCCGCTGGTCTCATCTTACACCGCGGGCGTCCCCTCTAGCTGACTACTATCGTTCAGGGACACAGCATTTACAGGGTCTCTTTTCTAGAATCGTTATGGATGTATGAAGGCCTGAAACTGGCGGGTGATCGTGCTCCAGCTCGACGCGGTGTAGGACGAAAGTGAGAGATATGTCGCACTCAATTGCCCTCTGACGAGGACATGGGTGGTCGTACGGACTAGGAGAATGTCTTTTTTTCTGCACGGGCCCTTGCCCTGTGTTCTTGGTTAGAGTTGGCTGACGACGAGATTTATCTGCCCTCCAGCGTCTTGGTTCCAATGCGTATCTCTTTCCCAGATCCTGCTTGGATCACGTGCAAGACTGCATGTTAAGGAGCATAAGCCTCTTCAGTCTAAGCCATCCGAGTTTCTCGGAACATGAACATGGACGTTGTTGGACTTTCCAAGCTGTGTGCCGTGCATCTGTGGTGGCTTTTGCCTTTTGTATCTTACGATTCCAGCTTTAGTATCCAACCCTGGAAGTGGTGAAATTGATCTCAGCTTCCTCCTTTCGTATGGGTGCAGGTGAACAGCGAAGTCTTAACTCTGAGCTATGGCATGCATGTGCGGGTCCTCTTGTGTCTGTGCCTCCCGTGGGCAGCCGCGTGGTCTACTTTCCTCAGGGTCATAGCGAGCAGGTGCGTTTCCCAACTTTTAGACATCGGTTGGTTGGCTCTCATCTTTTAGTCAGACACACCTGATATCAAACTTAGTTTCCGAGTCTTGAAGGTGCCTTACACGAGTTGGCGATATGGTTTCCAATTTATCTGGCCCTTGTGTTGTTTTTCGTTGTTGCTGTGGATTTATTCGAGAGATGCTAGTTTACGAAATCATTCCAATGGTATGTCCAGGTGGCTGCATCAACCCAAAAGGAGGCCGATGTGCATATACCCAGCTATCCCAGTCTCCCATCGCGGTTGATCTGTTTGCTCGACAATGTTACCCTCCATGTAAGTGCCGTCCACGGTGTGTTTGGCCTTGTGCAAAGGATATAGTTCACATTTATTCAATCTTTCTCATCTCTCTAACGTTTTGCCTTCATTCCTGTGCAGGCGGATATGGAGACGGATGAAGTTTACACCCGGATGACACTGCTACCTATGAGTGGGGTAAGTTCTGTTGTTCCTATTGGAAACAGTTTCTTTGGGTTTTAACCTTTGCCACGCAACTTTTTAACGCGTGAGGGTTCGATATGTTTTCTCATGCTCGGGCAAGCATTTAAACCAGACGTTTAAAGTCGTCTTGCACCTTGTGCAGAGTCCGGAGAAGGAACTTGTGATCGTGCCTGACATCACAAGGGACACCAAACAACCTACAGATTTTTTCTGCAAAACATTGACAGCAAGTGATACTAGTACTCATGGTGGTTTTTCAATTCCCCGCCGTGCCGCAGAGAAAGTCTTTCCACCCCTGGTACTCATCCTCCTCATTTTTTCAAGTTGCTCTCGTCCATTGTATTTCGCTCACTGAGATGTCGCTTCCTCGTCTATGTCAGCAGATGCACTGTCAAGCTGAAACTTTTGAATGTAAATACTAACTCTGCTCCCACGGCTATTGTACAGGACTACTCCCAACAACCTCCAGCCCATCCTGCCCAGGAGCTTGTCGCAAGAGACCTTCATGATCAGGAGTGGCACTTCCGGCACATCTACAGAGGTATTCAAGATCATTCTATTGGCAGTTGACGAGTAGTAGCTGTCGTAACAAATTTGTCTTTATTTGATATAGTTTAGAGGTCCAGTTGAGTGACATAGTTCTCTTCATCTTCATCTTCTCTTTATTTTCTAATATATTTGTCATTCATTCTGGCACAGGTCAACCTCGTAGACATCTTCTCACAACTGGATGGAGTGTTTTTGTTAGTGCTAAGAGACTCCAGGCTGGTGATTCTGTTCTTTTTATCAGGTAAAGGTTTTAGATAGCAGACATGAATGCTTGCGTTCTTTTCCTGAATGATTCCGTGTATCATTTGGCAGAATGAGTGTGGCCAATTCTCATTCACCTTTTGTAAGAGTGAGATTGAGAAGTGAGCTTATTGATTTAAACTCCTTCCCTGTATCTGCCCGAGTCAAGACTACAACCATGCATAACCACCTAATCGTCCGATTGTTGTTTTGTTGCATCATTAGAGATGACAAGGGACAGCTTCTTCTAGGCATAAGGCGTGCTAACAGGCAACAGACAGCAATGCCTTCCTCAGTGCTCACGAGTGACAGCATGCATATTGGTGTTCTTGCGGCCGCTAACCATGCAGCCGCCACCAATAGCAGATTCACTATCTTTTACAATCCCAGGTATACATGTCACTTTTGATTTGATGTGAATGTTTGCCATGTTCGTTTCAATATCCGTTCAAATCTCTGACGGTGTCAGTCAAAATTGTTTGTTGCTAGTGCTTAATTGTTTCGCTCTGCTTACTTCATTTACAAACATTCGTAGACTTACATCCCAATGTCTCTTTGCAGGGCAAGCCCATCTGAGTTCGTAATCCCTCTTGCTAAGTACAATAAAGCTATCTACCACACCCAGGTTTCTGTCGGGATGCGTTTCAGGATGGTATTTGAAACAGAGGAATCAGGTGTGCGAAGGTAAGATCCTGCTGAGAACTTTCTACATTGTCACATATCGTACGAGAATCAACCGAGGATATAACATGCGGTTCATTTTAGAGGCCAACCCGCCGAAATCTATTGATAGGGGAGTCGAAGTTTCAATTTCTTGCTGAAGGCATGACATGCCGGTATATCTGGTTAACCAGTTGGTGGTTTCACGGGCAGTCAAGAGCCTTTTCTTTTGCATGTTCTCTCTTGTCCGGGTCTTATCTCGGATAGTTGAGTTAATGCAAATCAAAATCTTAACAACCTCTTTACGAAGGCAAGGCCCATCTATTTATTCCGAAAATACTGGTCGTTTACAGATACATGGGAACTATTACTGGTATCGGCGATGTCGACCCGCTTAGATGGCCGAGCTCGCACTGGCGGTCGTTGAAGGTAAGAGTATATCTGATGGTCATTGATGTTTTAGAAGTGCTCGCTTCTCATTCAGATTGGGGTGAAGTGAATCATTTGTTTTGGGTTTGGGATGCTTCACTGACCTCTGTGTTGAGACACATAACTAATTCATTTAATTTGTAGGTTGGCTGGGATGAATCTACAGCCGGCGAGAGACAGAGGCGTGTGTCTCTGTGGGAAATTGAGCCGTTAACAACCCCTTTCCTGATCTGTCCTCCACTGACATTGAGAGCGAAGCGGCCCCGGGCGTCTTCTCGAGGCCATTCGGGTATGAGTGGTCAGTAACCCAAAATCGTTTGTGTTAGCGTGAGGAAGATAATGGTTATTAAGTTGTGCCACGCTTATTTCCAGCGGAATCTTTTTCCCTTTTCTTGGATCATCTTTTCAATTTTACTTATTGTAGAGTCCTTACTTTAAGACGACTTGCGCGTATGCCTTCTCTGCACGTTGTGAGACTTTTGTTAAACACTGTCGCCTTTTTCCGGATTGCAGGTGAAGATGAGGAAGGAGATGGCTCGGTCAAGAAGTCTTCTATGTGGTTAAGAGATGACGAGAGAGACGGTCTATCGAATCTACCTTTCAGGGGCCTTGGGATGGACCCTTGGACACCCAGGTTACCACAGAGTCCAGATTCAGTAGCTCCTGGTACACCAACAGATTTTTATCGGGTCATGGCTGCGGCTGCTCTTCAAGAGATTCGCGGCAACGAGACGTCCAAGCAACTGCTTCAGCGACAACCACAGCAGTCCTTGCAGAATCATCAGATGCAATTTCGTCCCCAGCAGCAACAACCTCCTCTACAGCAACAAGAGCAGCAGCAACAACAGCAGCAACAACAGCAACAACAGCAGCAGCTTAATATGCAACAGCAGCAGCAACAAGTTCTGCAGTCTCCTCAGCCGTTGCCATTACCTGATGTTACTGGGCCCTTACTCCAACTTTCATCAAGCAGGCCACAATCTCCTATGCAGTTATCTACATTGCGGGCGTCATCAGGATATACGGACTCGGATGTGCACTTATCTCCTGCTTCCACTGCGTCAGGATCATTTCCTTTACAGAGTCTTCTGAGCAGGACTCAACAAGGCAGTGTACTCACCACTGAAGATACAAATCAGTTTTCAAATCTTCTCCGCAGCAATCAAAGCGCAATGCAACAAGCTACTATGCTACCTGGTTCCGCTATGGTAGGGCGGGACTCTCCTGTATCGAGTGCCTGGTATTCTATGCGGGATTCCACTACATCCGATTGCGCTCATCCAAGTTCCCGCATGGGGCGAGCAGACTCATCCCCCAGTTCTGCTCCCACATATGCTCTTTCATCCAATGAACCTTGTCAATCTGGTTTGACAGCCCTACCCATGCAGAATCCTACTTATGCAGTGTTTCGGGACAATTCACAGGAGCAAGATCAAGTACAGTCAGATCCTCGTAGTCATCTCCTTTTCGGTGTATCCATTGATCAAATGCCAAACGGAGCTGGGGGTCTGGGATCAAGGGGCTTTGGTAAGGCGAAGGATAACCAGGCGCGATTTGCTGGCGGTAGCCTACTGCCTGCTCCTTATTGCTCATCGGCGGGACAAGATCTGCCCATCAGCCCTGGCATAATATCCCATGGTAGTATAAATGATAGCCAATTTATGCAGCGGGGATTCATGGCACCCGTATCTTCTCCCCAGCGGAGCTACACAAAGGTAATTTAGAGAATGTGCAGGGTTTACATCTGCTTTGAATGCACCATCAGTGTCAAGGGTCAAACAGCATGCATTTCTAACGTTCATTTTGTACGCTCTTATGTGTTTTGTATGCTGAGAGTGCTTTAATGACTCAAGCTCTACAGCATGTCCGTAGGCGATTCTGCGTGCAACCGTTTGCGTTACTGGAGTATCACGGGCTGCTACCCTCTAGTTGATCTAATATCTGGAACCTCGTGGCAGGTCTACAAGCTTGGTTCCGTCGGGAGATCCCTAGATGTGGCCCAGTTCACCAACTATACAGATTTGCGTGTTCACCTTGCCCGCATGTTCGGACTCGAGGGGCAGCTTGAAGATCCACAAAGATCAGGCTGGCAGCTCGTGTTCGTGGACAATGAGCAAGATGTGCTTCTAGTTGGCGACGACCCCTGGGAGTAAGTTTCTAATTGTTACGACTTTTGCCCTGTAAAATATGTGGAACTATGGCATGAACTTATGGAATGAAGGTGGTCGTTCTCGAACAGGCGTGTCTATATTGCAGATGTTTCTGTTGTCTGTGTCACGGGTCAATTGACTCCATTCTCTGCGGTTGATGCAGTGAGTTCGTCAATTGCGTTCGTAGCATCCGGATCTTGTCACCGTCGGAAGTGATGCACATGAGCCAGGAAGGATTGGAGCTCCTGAATATCGTTCCGCCAACTGCCCCCCGGCCAACGAGCAGTGGTTCTGAGGATGGTGCCACCATGCCTGCCGGATTCGAGAAATCCTGTGGGAATGATGCCCAGCGGGGGTGCCCCTGATTACTCCCCGAGGGCATGCCTTGGTTAGCATTCTGGAGTCGGTAGGTGACGCATTATGTCTATTCTGAGAATTTCTCCCACTATCAAGACTCTAGCTCGAGTAAGGATGGAAAGACTGTGTACCGGCACTGAGGCTCTTCTGAGAGGTTGACTCTGTATAGTGGAACCATCCACACGCAGTCAATCCTATTTTGCTGCTTTGGACTTGGAACTAATGTGCAGCTGTGCATGGGGAGAGAAGAGGAAGGGCAGACCGGCGGGGAAGACAGGGCAGTTGGGCGTTCGGAGGTGGTAACTGTTCCGTGCAGGGCGAACAGCTTAGCTAGCAGACTTCGATTTTATATCTCGGCCTGGTGAGCATCATCGCGGTGGGATCAGGACCCGCATCCGAAGAAGCCAGCGATTTTGTAAGGGGAAAGGCTGTCGTGTGTGGTGGGACAAACTCGTACGACTCGCAAAACTACTTCTGGCTTCCTCCAGAGTACGAAGGAATGCTATGATCCCATTTGAAGGCGAGGCCGATCCGGCAAGATCCCGGGGTTCGTCTGCACCCGGAATCTTGCAAGCTGTAGAGCTGCGCATGAACCATATCTTTTCACGTTTTTCACACCATGGAAGGTGTGTTTCATGCCGGTTCTCGAGCGGATCATCTTCCTGAAAGGGCCGCTACACTCCCGTTGTCTAGCGAGACAGGGATGGGAGCTTCCATGGGCCCACATTGCTCTAATGGACTGTATTAGTGAGCTCAATACATTCTTTGGCTAAAAGGTTACTCAATGTCCGGGCCTGTGTTTTGCAATGTAGATTGTATCGGTGTAGTAAGAGCTAATCCTTGCAACAAGGATTTACGCAAAAGAATGGTTTTGGTCGAAGCTTCGGAGGCTGCCATTTGTATTGCTATTGTCCATGATGATAAAACCATCTTGTAGATTATTTTGC

mRNA

>Mapoly0019s0045.1
CAGCGAATGTTGTCGTCATTTCAAGAGGCCTAGGAAGGGGTTCAGCTGTCGCCTTTTGATGGTGCAGTGTTTCGAAGCTTTGGACTAAACCGCGCAGGGAGGAGTGCCAATGAAGAGGTTCTCTTGACTGCAATGTAAAAAGAGGCACGGTCCTAAGAAGCTTCTAGCTGCAGCAGGGATGGGGCGCTGGAAAGGCATGCATAGGAGTGAATATCGCAGATGGAACTTCACTGACATGAGCTCTCCAGTCTCTCTCTGTATATGAGGGAGGTGCTGGTTTGAGCTGTGCAATCTCGGTCGCGTCCGCCATAGAACGATTGCCCTCGGTTCTTTATGTATTCTTGTTCGCCGATGAGGCTGTCTGCCTCTGGATATGCGCAACATCAAACAATGACAGGTGAACAGCGAAGTCTTAACTCTGAGCTATGGCATGCATGTGCGGGTCCTCTTGTGTCTGTGCCTCCCGTGGGCAGCCGCGTGGTCTACTTTCCTCAGGGTCATAGCGAGCAGGTGGCTGCATCAACCCAAAAGGAGGCCGATGTGCATATACCCAGCTATCCCAGTCTCCCATCGCGGTTGATCTGTTTGCTCGACAATGTTACCCTCCATGCGGATATGGAGACGGATGAAGTTTACACCCGGATGACACTGCTACCTATGAGTGGGAGTCCGGAGAAGGAACTTGTGATCGTGCCTGACATCACAAGGGACACCAAACAACCTACAGATTTTTTCTGCAAAACATTGACAGCAAGTGATACTAGTACTCATGGTGGTTTTTCAATTCCCCGCCGTGCCGCAGAGAAAGTCTTTCCACCCCTGGACTACTCCCAACAACCTCCAGCCCATCCTGCCCAGGAGCTTGTCGCAAGAGACCTTCATGATCAGGAGTGGCACTTCCGGCACATCTACAGAGGTCAACCTCGTAGACATCTTCTCACAACTGGATGGAGTGTTTTTGTTAGTGCTAAGAGACTCCAGGCTGGTGATTCTGTTCTTTTTATCAGAGATGACAAGGGACAGCTTCTTCTAGGCATAAGGCGTGCTAACAGGCAACAGACAGCAATGCCTTCCTCAGTGCTCACGAGTGACAGCATGCATATTGGTGTTCTTGCGGCCGCTAACCATGCAGCCGCCACCAATAGCAGATTCACTATCTTTTACAATCCCAGGGCAAGCCCATCTGAGTTCGTAATCCCTCTTGCTAAGTACAATAAAGCTATCTACCACACCCAGGTTTCTGTCGGGATGCGTTTCAGGATGGTATTTGAAACAGAGGAATCAGGTGTGCGAAGATACATGGGAACTATTACTGGTATCGGCGATGTCGACCCGCTTAGATGGCCGAGCTCGCACTGGCGGTCGTTGAAGGTTGGCTGGGATGAATCTACAGCCGGCGAGAGACAGAGGCGTGTGTCTCTGTGGGAAATTGAGCCGTTAACAACCCCTTTCCTGATCTGTCCTCCACTGACATTGAGAGCGAAGCGGCCCCGGGCGTCTTCTCGAGGCCATTCGGGTATGAGTGGTGAAGATGAGGAAGGAGATGGCTCGGTCAAGAAGTCTTCTATGTGGTTAAGAGATGACGAGAGAGACGGTCTATCGAATCTACCTTTCAGGGGCCTTGGGATGGACCCTTGGACACCCAGGTTACCACAGAGTCCAGATTCAGTAGCTCCTGGTACACCAACAGATTTTTATCGGGTCATGGCTGCGGCTGCTCTTCAAGAGATTCGCGGCAACGAGACGTCCAAGCAACTGCTTCAGCGACAACCACAGCAGTCCTTGCAGAATCATCAGATGCAATTTCGTCCCCAGCAGCAACAACCTCCTCTACAGCAACAAGAGCAGCAGCAACAACAGCAGCAACAACAGCAACAACAGCAGCAGCTTAATATGCAACAGCAGCAGCAACAAGTTCTGCAGTCTCCTCAGCCGTTGCCATTACCTGATGTTACTGGGCCCTTACTCCAACTTTCATCAAGCAGGCCACAATCTCCTATGCAGTTATCTACATTGCGGGCGTCATCAGGATATACGGACTCGGATGTGCACTTATCTCCTGCTTCCACTGCGTCAGGATCATTTCCTTTACAGAGTCTTCTGAGCAGGACTCAACAAGGCAGTGTACTCACCACTGAAGATACAAATCAGTTTTCAAATCTTCTCCGCAGCAATCAAAGCGCAATGCAACAAGCTACTATGCTACCTGGTTCCGCTATGGTAGGGCGGGACTCTCCTGTATCGAGTGCCTGGTATTCTATGCGGGATTCCACTACATCCGATTGCGCTCATCCAAGTTCCCGCATGGGGCGAGCAGACTCATCCCCCAGTTCTGCTCCCACATATGCTCTTTCATCCAATGAACCTTGTCAATCTGGTTTGACAGCCCTACCCATGCAGAATCCTACTTATGCAGTGTTTCGGGACAATTCACAGGAGCAAGATCAAGTACAGTCAGATCCTCGTAGTCATCTCCTTTTCGGTGTATCCATTGATCAAATGCCAAACGGAGCTGGGGGTCTGGGATCAAGGGGCTTTGGTAAGGCGAAGGATAACCAGGCGCGATTTGCTGGCGGTAGCCTACTGCCTGCTCCTTATTGCTCATCGGCGGGACAAGATCTGCCCATCAGCCCTGGCATAATATCCCATGGTAGTATAAATGATAGCCAATTTATGCAGCGGGGATTCATGGCACCCGTATCTTCTCCCCAGCGGAGCTACACAAAGGTCTACAAGCTTGGTTCCGTCGGGAGATCCCTAGATGTGGCCCAGTTCACCAACTATACAGATTTGCGTGTTCACCTTGCCCGCATGTTCGGACTCGAGGGGCAGCTTGAAGATCCACAAAGATCAGGCTGGCAGCTCGTGTTCGTGGACAATGAGCAAGATGTGCTTCTAGTTGGCGACGACCCCTGGGATGAGTTCGTCAATTGCGTTCGTAGCATCCGGATCTTGTCACCGTCGGAAGTGATGCACATGAGCCAGGAAGGATTGGAGCTCCTGAATATCGTTCCGCCAACTGCCCCCCGGCCAACGAGCAGTGGTTCTGAGGATGGTGCCACCATGCCTGCCGGATTCGAGAAATCCTGTGGGAATGATGCCCAGCGGGGGTGCCCCTGATTACTCCCCGAGGGCATGCCTTGGTTAGCATTCTGGAGTCGGTAGGTGACGCATTATGTCTATTCTGAGAATTTCTCCCACTATCAAGACTCTAGCTCGAGTAAGGATGGAAAGACTGTGTACCGGCACTGAGGCTCTTCTGAGAGGTTGACTCTGTATAGTGGAACCATCCACACGCAGTCAATCCTATTTTGCTGCTTTGGACTTGGAACTAATGTGCAGCTGTGCATGGGGAGAGAAGAGGAAGGGCAGACCGGCGGGGAAGACAGGGCAGTTGGGCGTTCGGAGGTGGTAACTGTTCCGTGCAGGGCGAACAGCTTAGCTAGCAGACTTCGATTTTATATCTCGGCCTGGTGAGCATCATCGCGGTGGGATCAGGACCCGCATCCGAAGAAGCCAGCGATTTTGTAAGGGGAAAGGCTGTCGTGTGTGGTGGGACAAACTCGTACGACTCGCAAAACTACTTCTGGCTTCCTCCAGAGTACGAAGGAATGCTATGATCCCATTTGAAGGCGAGGCCGATCCGGCAAGATCCCGGGGTTCGTCTGCACCCGGAATCTTGCAAGCTGTAGAGCTGCGCATGAACCATATCTTTTCACGTTTTTCACACCATGGAAGGTGTGTTTCATGCCGGTTCTCGAGCGGATCATCTTCCTGAAAGGGCCGCTACACTCCCGTTGTCTAGCGAGACAGGGATGGGAGCTTCCATGGGCCCACATTGCTCTAATGGACTGTATTAGTGAGCTCAATACATTCTTTGGCTAAAAGGTTACTCAATGTCCGGGCCTGTGTTTTGCAATGTAGATTGTATCGGTGTAGTAAGAGCTAATCCTTGCAACAAGGATTTACGCAAAAGAATGGTTTTGGTCGAAGCTTCGGAGGCTGCCATTTGTATTGCTATTGTCCATGATGATAAAACCATCTTGTAGATTATTTTGC

CDS

>Mapoly0019s0045.1
ATGTATTCTTGTTCGCCGATGAGGCTGTCTGCCTCTGGATATGCGCAACATCAAACAATGACAGGTGAACAGCGAAGTCTTAACTCTGAGCTATGGCATGCATGTGCGGGTCCTCTTGTGTCTGTGCCTCCCGTGGGCAGCCGCGTGGTCTACTTTCCTCAGGGTCATAGCGAGCAGGTGGCTGCATCAACCCAAAAGGAGGCCGATGTGCATATACCCAGCTATCCCAGTCTCCCATCGCGGTTGATCTGTTTGCTCGACAATGTTACCCTCCATGCGGATATGGAGACGGATGAAGTTTACACCCGGATGACACTGCTACCTATGAGTGGGAGTCCGGAGAAGGAACTTGTGATCGTGCCTGACATCACAAGGGACACCAAACAACCTACAGATTTTTTCTGCAAAACATTGACAGCAAGTGATACTAGTACTCATGGTGGTTTTTCAATTCCCCGCCGTGCCGCAGAGAAAGTCTTTCCACCCCTGGACTACTCCCAACAACCTCCAGCCCATCCTGCCCAGGAGCTTGTCGCAAGAGACCTTCATGATCAGGAGTGGCACTTCCGGCACATCTACAGAGGTCAACCTCGTAGACATCTTCTCACAACTGGATGGAGTGTTTTTGTTAGTGCTAAGAGACTCCAGGCTGGTGATTCTGTTCTTTTTATCAGAGATGACAAGGGACAGCTTCTTCTAGGCATAAGGCGTGCTAACAGGCAACAGACAGCAATGCCTTCCTCAGTGCTCACGAGTGACAGCATGCATATTGGTGTTCTTGCGGCCGCTAACCATGCAGCCGCCACCAATAGCAGATTCACTATCTTTTACAATCCCAGGGCAAGCCCATCTGAGTTCGTAATCCCTCTTGCTAAGTACAATAAAGCTATCTACCACACCCAGGTTTCTGTCGGGATGCGTTTCAGGATGGTATTTGAAACAGAGGAATCAGGTGTGCGAAGATACATGGGAACTATTACTGGTATCGGCGATGTCGACCCGCTTAGATGGCCGAGCTCGCACTGGCGGTCGTTGAAGGTTGGCTGGGATGAATCTACAGCCGGCGAGAGACAGAGGCGTGTGTCTCTGTGGGAAATTGAGCCGTTAACAACCCCTTTCCTGATCTGTCCTCCACTGACATTGAGAGCGAAGCGGCCCCGGGCGTCTTCTCGAGGCCATTCGGGTATGAGTGGTGAAGATGAGGAAGGAGATGGCTCGGTCAAGAAGTCTTCTATGTGGTTAAGAGATGACGAGAGAGACGGTCTATCGAATCTACCTTTCAGGGGCCTTGGGATGGACCCTTGGACACCCAGGTTACCACAGAGTCCAGATTCAGTAGCTCCTGGTACACCAACAGATTTTTATCGGGTCATGGCTGCGGCTGCTCTTCAAGAGATTCGCGGCAACGAGACGTCCAAGCAACTGCTTCAGCGACAACCACAGCAGTCCTTGCAGAATCATCAGATGCAATTTCGTCCCCAGCAGCAACAACCTCCTCTACAGCAACAAGAGCAGCAGCAACAACAGCAGCAACAACAGCAACAACAGCAGCAGCTTAATATGCAACAGCAGCAGCAACAAGTTCTGCAGTCTCCTCAGCCGTTGCCATTACCTGATGTTACTGGGCCCTTACTCCAACTTTCATCAAGCAGGCCACAATCTCCTATGCAGTTATCTACATTGCGGGCGTCATCAGGATATACGGACTCGGATGTGCACTTATCTCCTGCTTCCACTGCGTCAGGATCATTTCCTTTACAGAGTCTTCTGAGCAGGACTCAACAAGGCAGTGTACTCACCACTGAAGATACAAATCAGTTTTCAAATCTTCTCCGCAGCAATCAAAGCGCAATGCAACAAGCTACTATGCTACCTGGTTCCGCTATGGTAGGGCGGGACTCTCCTGTATCGAGTGCCTGGTATTCTATGCGGGATTCCACTACATCCGATTGCGCTCATCCAAGTTCCCGCATGGGGCGAGCAGACTCATCCCCCAGTTCTGCTCCCACATATGCTCTTTCATCCAATGAACCTTGTCAATCTGGTTTGACAGCCCTACCCATGCAGAATCCTACTTATGCAGTGTTTCGGGACAATTCACAGGAGCAAGATCAAGTACAGTCAGATCCTCGTAGTCATCTCCTTTTCGGTGTATCCATTGATCAAATGCCAAACGGAGCTGGGGGTCTGGGATCAAGGGGCTTTGGTAAGGCGAAGGATAACCAGGCGCGATTTGCTGGCGGTAGCCTACTGCCTGCTCCTTATTGCTCATCGGCGGGACAAGATCTGCCCATCAGCCCTGGCATAATATCCCATGGTAGTATAAATGATAGCCAATTTATGCAGCGGGGATTCATGGCACCCGTATCTTCTCCCCAGCGGAGCTACACAAAGGTCTACAAGCTTGGTTCCGTCGGGAGATCCCTAGATGTGGCCCAGTTCACCAACTATACAGATTTGCGTGTTCACCTTGCCCGCATGTTCGGACTCGAGGGGCAGCTTGAAGATCCACAAAGATCAGGCTGGCAGCTCGTGTTCGTGGACAATGAGCAAGATGTGCTTCTAGTTGGCGACGACCCCTGGGATGAGTTCGTCAATTGCGTTCGTAGCATCCGGATCTTGTCACCGTCGGAAGTGATGCACATGAGCCAGGAAGGATTGGAGCTCCTGAATATCGTTCCGCCAACTGCCCCCCGGCCAACGAGCAGTGGTTCTGAGGATGGTGCCACCATGCCTGCCGGATTCGAGAAATCCTGTGGGAATGATGCCCAGCGGGGGTGCCCCTGA

Protein

>Mapoly0019s0045.1
MYSCSPMRLSASGYAQHQTMTGEQRSLNSELWHACAGPLVSVPPVGSRVVYFPQGHSEQVAASTQKEADVHIPSYPSLPSRLICLLDNVTLHADMETDEVYTRMTLLPMSGSPEKELVIVPDITRDTKQPTDFFCKTLTASDTSTHGGFSIPRRAAEKVFPPLDYSQQPPAHPAQELVARDLHDQEWHFRHIYRGQPRRHLLTTGWSVFVSAKRLQAGDSVLFIRDDKGQLLLGIRRANRQQTAMPSSVLTSDSMHIGVLAAANHAAATNSRFTIFYNPRASPSEFVIPLAKYNKAIYHTQVSVGMRFRMVFETEESGVRRYMGTITGIGDVDPLRWPSSHWRSLKVGWDESTAGERQRRVSLWEIEPLTTPFLICPPLTLRAKRPRASSRGHSGMSGEDEEGDGSVKKSSMWLRDDERDGLSNLPFRGLGMDPWTPRLPQSPDSVAPGTPTDFYRVMAAAALQEIRGNETSKQLLQRQPQQSLQNHQMQFRPQQQQPPLQQQEQQQQQQQQQQQQQQLNMQQQQQQVLQSPQPLPLPDVTGPLLQLSSSRPQSPMQLSTLRASSGYTDSDVHLSPASTASGSFPLQSLLSRTQQGSVLTTEDTNQFSNLLRSNQSAMQQATMLPGSAMVGRDSPVSSAWYSMRDSTTSDCAHPSSRMGRADSSPSSAPTYALSSNEPCQSGLTALPMQNPTYAVFRDNSQEQDQVQSDPRSHLLFGVSIDQMPNGAGGLGSRGFGKAKDNQARFAGGSLLPAPYCSSAGQDLPISPGIISHGSINDSQFMQRGFMAPVSSPQRSYTKVYKLGSVGRSLDVAQFTNYTDLRVHLARMFGLEGQLEDPQRSGWQLVFVDNEQDVLLVGDDPWDEFVNCVRSIRILSPSEVMHMSQEGLELLNIVPPTAPRPTSSGSEDGATMPAGFEKSCGNDAQRGCP

Mapoly0019s0045.2  

Gene structure:

mRNA scaffold_19:399142..406810  ( - strand )
three_prime_UTR scaffold_19:399142..400080  ( - strand )
CDS scaffold_19:400081..400282  ( - strand )
CDS scaffold_19:400447..400637  ( - strand )
CDS scaffold_19:400881..402082  ( - strand )
CDS scaffold_19:402307..402451  ( - strand )
CDS scaffold_19:402596..402671  ( - strand )
CDS scaffold_19:403001..403123  ( - strand )
CDS scaffold_19:403295..403459  ( - strand )
CDS scaffold_19:403684..403774  ( - strand )
CDS scaffold_19:403933..404026  ( - strand )
CDS scaffold_19:404176..404331  ( - strand )
CDS scaffold_19:404480..404536  ( - strand )
CDS scaffold_19:404639..404737  ( - strand )
CDS scaffold_19:404951..405063  ( - strand )
CDS scaffold_19:406414..406477  ( - strand )
five_prime_UTR scaffold_19:406478..406810  ( - strand )

Sequences:

Gene

>Mapoly0019s0045.2
CAGCGAATGTTGTCGTCATTTCAAGAGGCCTAGGAAGGGGTTCAGCTGTCGCCTTTTGATGGTGCAGTGTTTCGAAGCTTTGGACTAAACCGCGCAGGGAGGAGTGCCAATGAAGAGGTTCTCTTGACTGCAATGTAAAAAGAGGCACGGTCCTAAGAAGCTTCTAGCTGCAGCAGGGATGGGGCGCTGGAAAGGCATGCATAGGAGTGAATATCGCAGATGGAACTTCACTGACATGAGCTCTCCAGTCTCTCTCTGTATATGAGGGAGGTGCTGGTTTGAGCTGTGCAATCTCGGTCGCGTCCGCCATAGAACGATTGCCCTCGGTTCTTTATGTATTCTTGTTCGCCGATGAGGCTGTCTGCCTCTGGATATGCGCAACATCAAACAATGACAGGTAAACTCTCCATTCCTCGGACTAGGTTCCTCCTTCTCTCTGAGTCCTTGGCTGCTGCTCGGCACTCACCACAATGTGATGAGGGACACGCTCTTCAGCTCCGCCGGAACTATGATGATTTATTCGTGGGCTGGAGCTCGCGCGCTCCTGCTCTCATGCAAGCTCACTTTCGCTCAGTCGGCCGGGAAATAGCAGACAGCCTGCAGGGATGATTTTCGGTGCGCCCAATCCTCTGCCGAGCTCCTCGCGACAGCCCAGAGGAGTGTCTCGTATGATTAGACTCGGCTCTTGCATGCCACCCTCACGCCGATTGGCAGAATGTTTGAGGCCATCTAGATAGTGCAGGCTACGCCATGCGACCGTACATAACTCAGGAGCCTTGACAAATCCAATCATGAGAGGTCGGCCGCAATGACACCGTGTAACGACCCAGTGAGCCTCGGCCGACGTTCACGTTCCCGCATTCATGATATGCAAAGGCCGGTGAAGACGATTTGAAGGACAGGAATACTCTGAAGGCTAGGAAGCTGTAAGTCAACCTGCAGTATTAGACGGGATGGAATCAGACGCCATCCCGAAGACTGAAGGCCAAGCGATGGGTAATTAGTTTCTTATCTGCGCCGCCGGAATCGAATCGCGCCGCATGATGAGTTTCTTAGGCCGACCGCAGGAAGGAAGATTTGTGAAGTTCACATTCTGGCCAACCTGGTGACAGCGGCGGCGTGGACGCCACACGGTGAAGCCACCATTTGTCTTCATGGATGTTCGCGTGCTCTCGGAGGCGCCTCCGCTGGTCTCATCTTACACCGCGGGCGTCCCCTCTAGCTGACTACTATCGTTCAGGGACACAGCATTTACAGGGTCTCTTTTCTAGAATCGTTATGGATGTATGAAGGCCTGAAACTGGCGGGTGATCGTGCTCCAGCTCGACGCGGTGTAGGACGAAAGTGAGAGATATGTCGCACTCAATTGCCCTCTGACGAGGACATGGGTGGTCGTACGGACTAGGAGAATGTCTTTTTTTCTGCACGGGCCCTTGCCCTGTGTTCTTGGTTAGAGTTGGCTGACGACGAGATTTATCTGCCCTCCAGCGTCTTGGTTCCAATGCGTATCTCTTTCCCAGATCCTGCTTGGATCACGTGCAAGACTGCATGTTAAGGAGCATAAGCCTCTTCAGTCTAAGCCATCCGAGTTTCTCGGAACATGAACATGGACGTTGTTGGACTTTCCAAGCTGTGTGCCGTGCATCTGTGGTGGCTTTTGCCTTTTGTATCTTACGATTCCAGCTTTAGTATCCAACCCTGGAAGTGGTGAAATTGATCTCAGCTTCCTCCTTTCGTATGGGTGCAGGTGAACAGCGAAGTCTTAACTCTGAGCTATGGCATGCATGTGCGGGTCCTCTTGTGTCTGTGCCTCCCGTGGGCAGCCGCGTGGTCTACTTTCCTCAGGGTCATAGCGAGCAGGTGCGTTTCCCAACTTTTAGACATCGGTTGGTTGGCTCTCATCTTTTAGTCAGACACACCTGATATCAAACTTAGTTTCCGAGTCTTGAAGGTGCCTTACACGAGTTGGCGATATGGTTTCCAATTTATCTGGCCCTTGTGTTGTTTTTCGTTGTTGCTGTGGATTTATTCGAGAGATGCTAGTTTACGAAATCATTCCAATGGTATGTCCAGGTGGCTGCATCAACCCAAAAGGAGGCCGATGTGCATATACCCAGCTATCCCAGTCTCCCATCGCGGTTGATCTGTTTGCTCGACAATGTTACCCTCCATGTAAGTGCCGTCCACGGTGTGTTTGGCCTTGTGCAAAGGATATAGTTCACATTTATTCAATCTTTCTCATCTCTCTAACGTTTTGCCTTCATTCCTGTGCAGGCGGATATGGAGACGGATGAAGTTTACACCCGGATGACACTGCTACCTATGAGTGGGGTAAGTTCTGTTGTTCCTATTGGAAACAGTTTCTTTGGGTTTTAACCTTTGCCACGCAACTTTTTAACGCGTGAGGGTTCGATATGTTTTCTCATGCTCGGGCAAGCATTTAAACCAGACGTTTAAAGTCGTCTTGCACCTTGTGCAGAGTCCGGAGAAGGAACTTGTGATCGTGCCTGACATCACAAGGGACACCAAACAACCTACAGATTTTTTCTGCAAAACATTGACAGCAAGTGATACTAGTACTCATGGTGGTTTTTCAATTCCCCGCCGTGCCGCAGAGAAAGTCTTTCCACCCCTGGTACTCATCCTCCTCATTTTTTCAAGTTGCTCTCGTCCATTGTATTTCGCTCACTGAGATGTCGCTTCCTCGTCTATGTCAGCAGATGCACTGTCAAGCTGAAACTTTTGAATGTAAATACTAACTCTGCTCCCACGGCTATTGTACAGGACTACTCCCAACAACCTCCAGCCCATCCTGCCCAGGAGCTTGTCGCAAGAGACCTTCATGATCAGGAGTGGCACTTCCGGCACATCTACAGAGGTATTCAAGATCATTCTATTGGCAGTTGACGAGTAGTAGCTGTCGTAACAAATTTGTCTTTATTTGATATAGTTTAGAGGTCCAGTTGAGTGACATAGTTCTCTTCATCTTCATCTTCTCTTTATTTTCTAATATATTTGTCATTCATTCTGGCACAGGTCAACCTCGTAGACATCTTCTCACAACTGGATGGAGTGTTTTTGTTAGTGCTAAGAGACTCCAGGCTGGTGATTCTGTTCTTTTTATCAGGTAAAGGTTTTAGATAGCAGACATGAATGCTTGCGTTCTTTTCCTGAATGATTCCGTGTATCATTTGGCAGAATGAGTGTGGCCAATTCTCATTCACCTTTTGTAAGAGTGAGATTGAGAAGTGAGCTTATTGATTTAAACTCCTTCCCTGTATCTGCCCGAGTCAAGACTACAACCATGCATAACCACCTAATCGTCCGATTGTTGTTTTGTTGCATCATTAGAGATGACAAGGGACAGCTTCTTCTAGGCATAAGGCGTGCTAACAGGCAACAGACAGCAATGCCTTCCTCAGTGCTCACGAGTGACAGCATGCATATTGGTGTTCTTGCGGCCGCTAACCATGCAGCCGCCACCAATAGCAGATTCACTATCTTTTACAATCCCAGGTATACATGTCACTTTTGATTTGATGTGAATGTTTGCCATGTTCGTTTCAATATCCGTTCAAATCTCTGACGGTGTCAGTCAAAATTGTTTGTTGCTAGTGCTTAATTGTTTCGCTCTGCTTACTTCATTTACAAACATTCGTAGACTTACATCCCAATGTCTCTTTGCAGGGCAAGCCCATCTGAGTTCGTAATCCCTCTTGCTAAGTACAATAAAGCTATCTACCACACCCAGGTTTCTGTCGGGATGCGTTTCAGGATGGTATTTGAAACAGAGGAATCAGGTGTGCGAAGGTAAGATCCTGCTGAGAACTTTCTACATTGTCACATATCGTACGAGAATCAACCGAGGATATAACATGCGGTTCATTTTAGAGGCCAACCCGCCGAAATCTATTGATAGGGGAGTCGAAGTTTCAATTTCTTGCTGAAGGCATGACATGCCGGTATATCTGGTTAACCAGTTGGTGGTTTCACGGGCAGTCAAGAGCCTTTTCTTTTGCATGTTCTCTCTTGTCCGGGTCTTATCTCGGATAGTTGAGTTAATGCAAATCAAAATCTTAACAACCTCTTTACGAAGGCAAGGCCCATCTATTTATTCCGAAAATACTGGTCGTTTACAGATACATGGGAACTATTACTGGTATCGGCGATGTCGACCCGCTTAGATGGCCGAGCTCGCACTGGCGGTCGTTGAAGGTAAGAGTATATCTGATGGTCATTGATGTTTTAGAAGTGCTCGCTTCTCATTCAGATTGGGGTGAAGTGAATCATTTGTTTTGGGTTTGGGATGCTTCACTGACCTCTGTGTTGAGACACATAACTAATTCATTTAATTTGTAGGTTGGCTGGGATGAATCTACAGCCGGCGAGAGACAGAGGCGTGTGTCTCTGTGGGAAATTGAGCCGTTAACAACCCCTTTCCTGATCTGTCCTCCACTGACATTGAGAGCGAAGCGGCCCCGGGCGTCTTCTCGAGGCCATTCGGGTATGAGTGGTCAGTAACCCAAAATCGTTTGTGTTAGCGTGAGGAAGATAATGGTTATTAAGTTGTGCCACGCTTATTTCCAGCGGAATCTTTTTCCCTTTTCTTGGATCATCTTTTCAATTTTACTTATTGTAGAGTCCTTACTTTAAGACGACTTGCGCGTATGCCTTCTCTGCACGTTGTGAGACTTTTGTTAAACACTGTCGCCTTTTTCCGGATTGCAGGTGAAGATGAGGAAGGAGATGGCTCGGTCAAGAAGTCTTCTATGTGGTTAAGAGATGACGAGAGAGACGGTCTATCGAATCTACCTTTCAGGGGCCTTGGGATGGACCCTTGGACACCCAGGTTACCACAGAGTCCAGATTCAGTAGCTCCTGGTACACCAACAGATTTTTATCGGGTCATGGCTGCGGCTGCTCTTCAAGAGATTCGCGGCAACGAGACGTCCAAGCAACTGCTTCAGCGACAACCACAGCAGTCCTTGCAGAATCATCAGATGCAATTTCGTCCCCAGCAGCAACAACCTCCTCTACAGCAACAAGAGCAGCAGCAACAACAGCAGCAACAACAGCAACAACAGCAGCAGCTTAATATGCAACAGCAGCAGCAACAAGTTCTGCAGTCTCCTCAGCCGTTGCCATTACCTGATGTTACTGGGCCCTTACTCCAACTTTCATCAAGCAGGCCACAATCTCCTATGCAGTTATCTACATTGCGGGCGTCATCAGGATATACGGACTCGGATGTGCACTTATCTCCTGCTTCCACTGCGTCAGGATCATTTCCTTTACAGAGTCTTCTGAGCAGGACTCAACAAGGCAGTGTACTCACCACTGAAGATACAAATCAGTTTTCAAATCTTCTCCGCAGCAATCAAAGCGCAATGCAACAAGCTACTATGCTACCTGGTTCCGCTATGGTAGGGCGGGACTCTCCTGTATCGAGTGCCTGGTATTCTATGCGGGATTCCACTACATCCGATTGCGCTCATCCAAGTTCCCGCATGGGGCGAGCAGACTCATCCCCCAGTTCTGCTCCCACATATGCTCTTTCATCCAATGAACCTTGTCAATCTGGTTTGACAGCCCTACCCATGCAGAATCCTACTTATGCAGTGTTTCGGGACAATTCACAGGAGCAAGATCAAGTACAGTCAGATCCTCGTAGTCATCTCCTTTTCGGTGTATCCATTGATCAAATGCCAAACGGAGCTGGGGGTCTGGGATCAAGGGGCTTTGGTAAGGCGAAGGATAACCAGGCGCGATTTGCTGGCGGTAGCCTACTGCCTGCTCCTTATTGCTCATCGGCGGGACAAGATCTGCCCATCAGCCCTGGCATAATATCCCATGGTAGTATAAATGATAGCCAATTTATGCAGCGGGGATTCATGGCACCCGTATCTTCTCCCCAGCGGAGCTACACAAAGGTAATTTAGAGAATGTGCAGGGTTTACATCTGCTTTGAATGCACCATCAGTGTCAAGGGTCAAACAGCATGCATTTCTAACGTTCATTTTGTACGCTCTTATGTGTTTTGTATGCTGAGAGTGCTTTAATGACTCAAGCTCTACAGCATGTCCGTAGGCGATTCTGCGTGCAACCGTTTGCGTTACTGGAGTATCACGGGCTGCTACCCTCTAGTTGATCTAATATCTGGAACCTCGTGGCAGGTCTACAAGCTTGGTTCCGTCGGGAGATCCCTAGATGTGGCCCAGTTCACCAACTATACAGATTTGCGTGTTCACCTTGCCCGCATGTTCGGACTCGAGGGGCAGCTTGAAGATCCACAAAGATCAGGCTGGCAGCTCGTGTTCGTGGACAATGAGCAAGATGTGCTTCTAGTTGGCGACGACCCCTGGGAGTAAGTTTCTAATTGTTACGACTTTTGCCCTGTAAAATATGTGGAACTATGGCATGAACTTATGGAATGAAGGTGGTCGTTCTCGAACAGGCGTGTCTATATTGCAGATGTTTCTGTTGTCTGTGTCACGGGTCAATTGACTCCATTCTCTGCGGTTGATGCAGTGAGTTCGTCAATTGCGTTCGTAGCATCCGGATCTTGTCACCGTCGGAAGTGATGCACATGAGCCAGGAAGGATTGGAGCTCCTGAATATCGTTCCGCCAACTGCCCCCCGGCCAACGAGCAGTGGTTCTGAGGATGGTGCCACCATGCCTGCCGGATTCGAGAAATCCTGTGGGAATGATGCCCAGCGGGGGTGCCCCTGATTACTCCCCGAGGGCATGCCTTGGTTAGCATTCTGGAGTCGGTAGGTGACGCATTATGTCTATTCTGAGAATTTCTCCCACTATCAAGACTCTAGCTCGAGTAAGGATGGAAAGACTGTGTACCGGCACTGAGGCTCTTCTGAGAGGTTGACTCTGTATAGTGGAACCATCCACACGCAGTCAATCCTATTTTGCTGCTTTGGACTTGGAACTAATGTGCAGCTGTGCATGGGGAGAGAAGAGGAAGGGCAGACCGGCGGGGAAGACAGGGCAGTTGGGCGTTCGGAGGTGGTAACTGTTCCGTGCAGGGCGAACAGCTTAGCTAGCAGACTTCGATTTTATATCTCGGCCTGGTGAGCATCATCGCGGTGGGATCAGGACCCGCATCCGAAGAAGCCAGCGATTTTGTAAGGGGAAAGGCTGTCGTGTGTGGTGGGACAAACTCGTACGACTCGCAAAACTACTTCTGGCTTCCTCCAGAGTACGAAGGAATGCTATGATCCCATTTGAAGGCGAGGCCGATCCGGCAAGATCCCGGGGTTCGTCTGCACCCGGAATCTTGCAAGCTGTAGAGCTGCGCATGAACCATATCTTTTCACGTTTTTCACACCATGGAAGGTGTGTTTCATGCCGGTTCTCGAGCGGATCATCTTCCTGAAAGGGCCGCTACACTCCCGTTGTCTAGCGAGACAGGGATGGGAGCTTCCATGGGCCCACATTGCTCTAATGGACTGTATTAGTGAGCTCAATACATTCTTTGGCTAAAAGGTTACTCAATGTCCGGGCCTGTGTTTTGCAATGTAGATTGTATCGGTGTAGTAAGAGCTAATCCTTGCAACAAGGATTTACGCAAAAGAATGGTTTTGGTCGAAGCTTCGGAGGCTGCCATTTGTATTGCTATTGTCCATGATGATAAAACCATCTTGTAGATTATTTTGC

mRNA

>Mapoly0019s0045.2
CAGCGAATGTTGTCGTCATTTCAAGAGGCCTAGGAAGGGGTTCAGCTGTCGCCTTTTGATGGTGCAGTGTTTCGAAGCTTTGGACTAAACCGCGCAGGGAGGAGTGCCAATGAAGAGGTTCTCTTGACTGCAATGTAAAAAGAGGCACGGTCCTAAGAAGCTTCTAGCTGCAGCAGGGATGGGGCGCTGGAAAGGCATGCATAGGAGTGAATATCGCAGATGGAACTTCACTGACATGAGCTCTCCAGTCTCTCTCTGTATATGAGGGAGGTGCTGGTTTGAGCTGTGCAATCTCGGTCGCGTCCGCCATAGAACGATTGCCCTCGGTTCTTTATGTATTCTTGTTCGCCGATGAGGCTGTCTGCCTCTGGATATGCGCAACATCAAACAATGACAGGTGAACAGCGAAGTCTTAACTCTGAGCTATGGCATGCATGTGCGGGTCCTCTTGTGTCTGTGCCTCCCGTGGGCAGCCGCGTGGTCTACTTTCCTCAGGGTCATAGCGAGCAGGTGGCTGCATCAACCCAAAAGGAGGCCGATGTGCATATACCCAGCTATCCCAGTCTCCCATCGCGGTTGATCTGTTTGCTCGACAATGTTACCCTCCATGCGGATATGGAGACGGATGAAGTTTACACCCGGATGACACTGCTACCTATGAGTGGGAGTCCGGAGAAGGAACTTGTGATCGTGCCTGACATCACAAGGGACACCAAACAACCTACAGATTTTTTCTGCAAAACATTGACAGCAAGTGATACTAGTACTCATGGTGGTTTTTCAATTCCCCGCCGTGCCGCAGAGAAAGTCTTTCCACCCCTGGACTACTCCCAACAACCTCCAGCCCATCCTGCCCAGGAGCTTGTCGCAAGAGACCTTCATGATCAGGAGTGGCACTTCCGGCACATCTACAGAGGTCAACCTCGTAGACATCTTCTCACAACTGGATGGAGTGTTTTTGTTAGTGCTAAGAGACTCCAGGCTGGTGATTCTGTTCTTTTTATCAGAGATGACAAGGGACAGCTTCTTCTAGGCATAAGGCGTGCTAACAGGCAACAGACAGCAATGCCTTCCTCAGTGCTCACGAGTGACAGCATGCATATTGGTGTTCTTGCGGCCGCTAACCATGCAGCCGCCACCAATAGCAGATTCACTATCTTTTACAATCCCAGGGCAAGCCCATCTGAGTTCGTAATCCCTCTTGCTAAGTACAATAAAGCTATCTACCACACCCAGGTTTCTGTCGGGATGCGTTTCAGGATGGTATTTGAAACAGAGGAATCAGGTGTGCGAAGATACATGGGAACTATTACTGGTATCGGCGATGTCGACCCGCTTAGATGGCCGAGCTCGCACTGGCGGTCGTTGAAGGTTGGCTGGGATGAATCTACAGCCGGCGAGAGACAGAGGCGTGTGTCTCTGTGGGAAATTGAGCCGTTAACAACCCCTTTCCTGATCTGTCCTCCACTGACATTGAGAGCGAAGCGGCCCCGGGCGTCTTCTCGAGGCCATTCGGGTGAAGATGAGGAAGGAGATGGCTCGGTCAAGAAGTCTTCTATGTGGTTAAGAGATGACGAGAGAGACGGTCTATCGAATCTACCTTTCAGGGGCCTTGGGATGGACCCTTGGACACCCAGGTTACCACAGAGTCCAGATTCAGTAGCTCCTGGTACACCAACAGATTTTTATCGGGTCATGGCTGCGGCTGCTCTTCAAGAGATTCGCGGCAACGAGACGTCCAAGCAACTGCTTCAGCGACAACCACAGCAGTCCTTGCAGAATCATCAGATGCAATTTCGTCCCCAGCAGCAACAACCTCCTCTACAGCAACAAGAGCAGCAGCAACAACAGCAGCAACAACAGCAACAACAGCAGCAGCTTAATATGCAACAGCAGCAGCAACAAGTTCTGCAGTCTCCTCAGCCGTTGCCATTACCTGATGTTACTGGGCCCTTACTCCAACTTTCATCAAGCAGGCCACAATCTCCTATGCAGTTATCTACATTGCGGGCGTCATCAGGATATACGGACTCGGATGTGCACTTATCTCCTGCTTCCACTGCGTCAGGATCATTTCCTTTACAGAGTCTTCTGAGCAGGACTCAACAAGGCAGTGTACTCACCACTGAAGATACAAATCAGTTTTCAAATCTTCTCCGCAGCAATCAAAGCGCAATGCAACAAGCTACTATGCTACCTGGTTCCGCTATGGTAGGGCGGGACTCTCCTGTATCGAGTGCCTGGTATTCTATGCGGGATTCCACTACATCCGATTGCGCTCATCCAAGTTCCCGCATGGGGCGAGCAGACTCATCCCCCAGTTCTGCTCCCACATATGCTCTTTCATCCAATGAACCTTGTCAATCTGGTTTGACAGCCCTACCCATGCAGAATCCTACTTATGCAGTGTTTCGGGACAATTCACAGGAGCAAGATCAAGTACAGTCAGATCCTCGTAGTCATCTCCTTTTCGGTGTATCCATTGATCAAATGCCAAACGGAGCTGGGGGTCTGGGATCAAGGGGCTTTGGTAAGGCGAAGGATAACCAGGCGCGATTTGCTGGCGGTAGCCTACTGCCTGCTCCTTATTGCTCATCGGCGGGACAAGATCTGCCCATCAGCCCTGGCATAATATCCCATGGTAGTATAAATGATAGCCAATTTATGCAGCGGGGATTCATGGCACCCGTATCTTCTCCCCAGCGGAGCTACACAAAGGTCTACAAGCTTGGTTCCGTCGGGAGATCCCTAGATGTGGCCCAGTTCACCAACTATACAGATTTGCGTGTTCACCTTGCCCGCATGTTCGGACTCGAGGGGCAGCTTGAAGATCCACAAAGATCAGGCTGGCAGCTCGTGTTCGTGGACAATGAGCAAGATGTGCTTCTAGTTGGCGACGACCCCTGGGATGAGTTCGTCAATTGCGTTCGTAGCATCCGGATCTTGTCACCGTCGGAAGTGATGCACATGAGCCAGGAAGGATTGGAGCTCCTGAATATCGTTCCGCCAACTGCCCCCCGGCCAACGAGCAGTGGTTCTGAGGATGGTGCCACCATGCCTGCCGGATTCGAGAAATCCTGTGGGAATGATGCCCAGCGGGGGTGCCCCTGATTACTCCCCGAGGGCATGCCTTGGTTAGCATTCTGGAGTCGGTAGGTGACGCATTATGTCTATTCTGAGAATTTCTCCCACTATCAAGACTCTAGCTCGAGTAAGGATGGAAAGACTGTGTACCGGCACTGAGGCTCTTCTGAGAGGTTGACTCTGTATAGTGGAACCATCCACACGCAGTCAATCCTATTTTGCTGCTTTGGACTTGGAACTAATGTGCAGCTGTGCATGGGGAGAGAAGAGGAAGGGCAGACCGGCGGGGAAGACAGGGCAGTTGGGCGTTCGGAGGTGGTAACTGTTCCGTGCAGGGCGAACAGCTTAGCTAGCAGACTTCGATTTTATATCTCGGCCTGGTGAGCATCATCGCGGTGGGATCAGGACCCGCATCCGAAGAAGCCAGCGATTTTGTAAGGGGAAAGGCTGTCGTGTGTGGTGGGACAAACTCGTACGACTCGCAAAACTACTTCTGGCTTCCTCCAGAGTACGAAGGAATGCTATGATCCCATTTGAAGGCGAGGCCGATCCGGCAAGATCCCGGGGTTCGTCTGCACCCGGAATCTTGCAAGCTGTAGAGCTGCGCATGAACCATATCTTTTCACGTTTTTCACACCATGGAAGGTGTGTTTCATGCCGGTTCTCGAGCGGATCATCTTCCTGAAAGGGCCGCTACACTCCCGTTGTCTAGCGAGACAGGGATGGGAGCTTCCATGGGCCCACATTGCTCTAATGGACTGTATTAGTGAGCTCAATACATTCTTTGGCTAAAAGGTTACTCAATGTCCGGGCCTGTGTTTTGCAATGTAGATTGTATCGGTGTAGTAAGAGCTAATCCTTGCAACAAGGATTTACGCAAAAGAATGGTTTTGGTCGAAGCTTCGGAGGCTGCCATTTGTATTGCTATTGTCCATGATGATAAAACCATCTTGTAGATTATTTTGC

CDS

>Mapoly0019s0045.2
ATGTATTCTTGTTCGCCGATGAGGCTGTCTGCCTCTGGATATGCGCAACATCAAACAATGACAGGTGAACAGCGAAGTCTTAACTCTGAGCTATGGCATGCATGTGCGGGTCCTCTTGTGTCTGTGCCTCCCGTGGGCAGCCGCGTGGTCTACTTTCCTCAGGGTCATAGCGAGCAGGTGGCTGCATCAACCCAAAAGGAGGCCGATGTGCATATACCCAGCTATCCCAGTCTCCCATCGCGGTTGATCTGTTTGCTCGACAATGTTACCCTCCATGCGGATATGGAGACGGATGAAGTTTACACCCGGATGACACTGCTACCTATGAGTGGGAGTCCGGAGAAGGAACTTGTGATCGTGCCTGACATCACAAGGGACACCAAACAACCTACAGATTTTTTCTGCAAAACATTGACAGCAAGTGATACTAGTACTCATGGTGGTTTTTCAATTCCCCGCCGTGCCGCAGAGAAAGTCTTTCCACCCCTGGACTACTCCCAACAACCTCCAGCCCATCCTGCCCAGGAGCTTGTCGCAAGAGACCTTCATGATCAGGAGTGGCACTTCCGGCACATCTACAGAGGTCAACCTCGTAGACATCTTCTCACAACTGGATGGAGTGTTTTTGTTAGTGCTAAGAGACTCCAGGCTGGTGATTCTGTTCTTTTTATCAGAGATGACAAGGGACAGCTTCTTCTAGGCATAAGGCGTGCTAACAGGCAACAGACAGCAATGCCTTCCTCAGTGCTCACGAGTGACAGCATGCATATTGGTGTTCTTGCGGCCGCTAACCATGCAGCCGCCACCAATAGCAGATTCACTATCTTTTACAATCCCAGGGCAAGCCCATCTGAGTTCGTAATCCCTCTTGCTAAGTACAATAAAGCTATCTACCACACCCAGGTTTCTGTCGGGATGCGTTTCAGGATGGTATTTGAAACAGAGGAATCAGGTGTGCGAAGATACATGGGAACTATTACTGGTATCGGCGATGTCGACCCGCTTAGATGGCCGAGCTCGCACTGGCGGTCGTTGAAGGTTGGCTGGGATGAATCTACAGCCGGCGAGAGACAGAGGCGTGTGTCTCTGTGGGAAATTGAGCCGTTAACAACCCCTTTCCTGATCTGTCCTCCACTGACATTGAGAGCGAAGCGGCCCCGGGCGTCTTCTCGAGGCCATTCGGGTGAAGATGAGGAAGGAGATGGCTCGGTCAAGAAGTCTTCTATGTGGTTAAGAGATGACGAGAGAGACGGTCTATCGAATCTACCTTTCAGGGGCCTTGGGATGGACCCTTGGACACCCAGGTTACCACAGAGTCCAGATTCAGTAGCTCCTGGTACACCAACAGATTTTTATCGGGTCATGGCTGCGGCTGCTCTTCAAGAGATTCGCGGCAACGAGACGTCCAAGCAACTGCTTCAGCGACAACCACAGCAGTCCTTGCAGAATCATCAGATGCAATTTCGTCCCCAGCAGCAACAACCTCCTCTACAGCAACAAGAGCAGCAGCAACAACAGCAGCAACAACAGCAACAACAGCAGCAGCTTAATATGCAACAGCAGCAGCAACAAGTTCTGCAGTCTCCTCAGCCGTTGCCATTACCTGATGTTACTGGGCCCTTACTCCAACTTTCATCAAGCAGGCCACAATCTCCTATGCAGTTATCTACATTGCGGGCGTCATCAGGATATACGGACTCGGATGTGCACTTATCTCCTGCTTCCACTGCGTCAGGATCATTTCCTTTACAGAGTCTTCTGAGCAGGACTCAACAAGGCAGTGTACTCACCACTGAAGATACAAATCAGTTTTCAAATCTTCTCCGCAGCAATCAAAGCGCAATGCAACAAGCTACTATGCTACCTGGTTCCGCTATGGTAGGGCGGGACTCTCCTGTATCGAGTGCCTGGTATTCTATGCGGGATTCCACTACATCCGATTGCGCTCATCCAAGTTCCCGCATGGGGCGAGCAGACTCATCCCCCAGTTCTGCTCCCACATATGCTCTTTCATCCAATGAACCTTGTCAATCTGGTTTGACAGCCCTACCCATGCAGAATCCTACTTATGCAGTGTTTCGGGACAATTCACAGGAGCAAGATCAAGTACAGTCAGATCCTCGTAGTCATCTCCTTTTCGGTGTATCCATTGATCAAATGCCAAACGGAGCTGGGGGTCTGGGATCAAGGGGCTTTGGTAAGGCGAAGGATAACCAGGCGCGATTTGCTGGCGGTAGCCTACTGCCTGCTCCTTATTGCTCATCGGCGGGACAAGATCTGCCCATCAGCCCTGGCATAATATCCCATGGTAGTATAAATGATAGCCAATTTATGCAGCGGGGATTCATGGCACCCGTATCTTCTCCCCAGCGGAGCTACACAAAGGTCTACAAGCTTGGTTCCGTCGGGAGATCCCTAGATGTGGCCCAGTTCACCAACTATACAGATTTGCGTGTTCACCTTGCCCGCATGTTCGGACTCGAGGGGCAGCTTGAAGATCCACAAAGATCAGGCTGGCAGCTCGTGTTCGTGGACAATGAGCAAGATGTGCTTCTAGTTGGCGACGACCCCTGGGATGAGTTCGTCAATTGCGTTCGTAGCATCCGGATCTTGTCACCGTCGGAAGTGATGCACATGAGCCAGGAAGGATTGGAGCTCCTGAATATCGTTCCGCCAACTGCCCCCCGGCCAACGAGCAGTGGTTCTGAGGATGGTGCCACCATGCCTGCCGGATTCGAGAAATCCTGTGGGAATGATGCCCAGCGGGGGTGCCCCTGA

Protein

>Mapoly0019s0045.2
MYSCSPMRLSASGYAQHQTMTGEQRSLNSELWHACAGPLVSVPPVGSRVVYFPQGHSEQVAASTQKEADVHIPSYPSLPSRLICLLDNVTLHADMETDEVYTRMTLLPMSGSPEKELVIVPDITRDTKQPTDFFCKTLTASDTSTHGGFSIPRRAAEKVFPPLDYSQQPPAHPAQELVARDLHDQEWHFRHIYRGQPRRHLLTTGWSVFVSAKRLQAGDSVLFIRDDKGQLLLGIRRANRQQTAMPSSVLTSDSMHIGVLAAANHAAATNSRFTIFYNPRASPSEFVIPLAKYNKAIYHTQVSVGMRFRMVFETEESGVRRYMGTITGIGDVDPLRWPSSHWRSLKVGWDESTAGERQRRVSLWEIEPLTTPFLICPPLTLRAKRPRASSRGHSGEDEEGDGSVKKSSMWLRDDERDGLSNLPFRGLGMDPWTPRLPQSPDSVAPGTPTDFYRVMAAAALQEIRGNETSKQLLQRQPQQSLQNHQMQFRPQQQQPPLQQQEQQQQQQQQQQQQQQLNMQQQQQQVLQSPQPLPLPDVTGPLLQLSSSRPQSPMQLSTLRASSGYTDSDVHLSPASTASGSFPLQSLLSRTQQGSVLTTEDTNQFSNLLRSNQSAMQQATMLPGSAMVGRDSPVSSAWYSMRDSTTSDCAHPSSRMGRADSSPSSAPTYALSSNEPCQSGLTALPMQNPTYAVFRDNSQEQDQVQSDPRSHLLFGVSIDQMPNGAGGLGSRGFGKAKDNQARFAGGSLLPAPYCSSAGQDLPISPGIISHGSINDSQFMQRGFMAPVSSPQRSYTKVYKLGSVGRSLDVAQFTNYTDLRVHLARMFGLEGQLEDPQRSGWQLVFVDNEQDVLLVGDDPWDEFVNCVRSIRILSPSEVMHMSQEGLELLNIVPPTAPRPTSSGSEDGATMPAGFEKSCGNDAQRGCP

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>