Mapoly0019s0115



Description

ZINC FINGER CCHC DOMAIN CONTAINING PROTEIN

Reference DB

Database ID Description
GO GO:0003676 Nucleic acid binding
GO GO:0008270 Zinc ion binding
OrthoMCL OG5_190270
PFAM PF00098 Zinc knuckle
PFAM PF14392 Zinc knuckle
PANTHER PTHR23002 ZINC FINGER CCHC DOMAIN CONTAINING PROTEIN
PANTHER PTHR23002:SF54

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-5 transcription factor, C2H2-ZnF Mapoly0019s0115.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0019s0115.1 scaffold_19:974882..981027  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0019s0115.1  

Gene structure:

mRNA scaffold_19:974882..981027  ( - strand )
three_prime_UTR scaffold_19:974882..975192  ( - strand )
CDS scaffold_19:975193..975555  ( - strand )
CDS scaffold_19:975842..975964  ( - strand )
CDS scaffold_19:976122..976238  ( - strand )
CDS scaffold_19:976335..976505  ( - strand )
CDS scaffold_19:976658..976816  ( - strand )
CDS scaffold_19:977368..977463  ( - strand )
CDS scaffold_19:980029..980634  ( - strand )
five_prime_UTR scaffold_19:980635..981027  ( - strand )

Sequences:

Gene

>Mapoly0019s0115.1
GAGAGCTTTGAATTGGCAACAGATCAAATTGCTTGCAGCTCAAAATCCAGTAGCCATGTGGCAGAAATTGTTTGCCAATGAGTAGCAGTCCTGGAATTCCTCATTGAAGCAGATCTGTGTCAGGAAACGACCAGATTCGAACAAGAGCAGCAAACTGAAACTATGTCATTCGACGAGGACCCATTCGGAGAGAAGGAAAGGATGATGGGAGGGAAGAGAAATCAAATGAAGTAGGGTTTGAACGGACGCGCGAAGAATCCAGACAGGAGTGCAAATTGCAGGAGACTCGAAAGCACGAGCACGGAATTGTGGGAATGCGGGATTTGCTGGAATGATCGAATGCTCGATTGGATGGAGGAATTTTGACTTCAGACAGTCAGACTGACCGCCGCGATGGCACGGGAAGTGGAAGCGGAGGAGGACGAAGAGGAGAGTGGAGAGTTGGGCCAGGAGACGCCGAGAAGCTCCGAAGGTGTGGCGAAAGGGAGCCGTGGTTATGGTGGAGGCGGCGGAGGAGCCGACGAGGACGAAGGAAGCGTGGAGGATGAGGGGTATGGGCTGAATTTGGAGACCCGGAGGTATTCGGTTGTCCAGCGAGGTGAGCAGGAGGATGGCGAAGCTGATGATGATGATATTGGAGATGAAGATGACAGTCATGCGAATGAAGATTTGAGTTTGCACATTGTCGAGAAAGCCAAGAAGAGGCGGAAGCTAGAGCCTCGGGCGGCAGATGAGGGTGTTGTCATTATAGATGGTCGTGCAGAGGAGGAGCTGATTGTTGAGAAGCGCAGCAGTGAGGGAAATTCTGTTGCTGCAGACGAGTGCAAAGAACCGTTGTCCAGGAGCGATACTCCGGAGGAAGGCGAGCTACAGGAGGACGGCGAAGGAAACCTTGTGCTTGCCGCAGACCTTTTCGAAGCAGAGGACGCCCCAGATGAAGGTGGAGGAAAGAAGAGGAAAAAGAGGAAGAAAGAAAAGAAAGAAAAGAAGAAGAAGAAGGTAAGAGTATGTTCCGAATTCGAATCCTTGCATGCCATTTTCCATGTTTTTTAACTAGCTATGAGGCTTCATTGGGGAGCTGGAGAATGGGCCACACCATTTGCTGCAAATGCCATTTTGTTGTCTCATATCAGGTATGAATAGGACTCATAGCTTTGTCAAAATTAAGGTGAAATTGCTGAGTTGTTACACGCCAGTGAGTTTGAGATGATGTAGTTAAGGTCATTGTAACTATTTCATGACTCTTACCAGACTTCTGAGCCCTAACTAGGACACTGTAAAAATTGAACAGTTAAAGGTGAAATTTACAGTGTTGCCTTCTATTCAGGTACCATGCTTCTCTAATCAAAGAAAGGAGATGCACATGGTAGCCTCACAATTCATCAAAATGTCCTTCAGTTGATAGAATTCCATGCGAGCACTGAATTTGCCTTTATCAAACCGCAGCATTTTTGTCATACAGAGTATAGAAGTGTGGAACATACTGCCGGTTTCTGGAAGTTTTTCATAGATTACAAAGATCACAATATGATATTAATGTTGTTAGCAATTGATTATAGAGTTTCATTTTCAGAGGTAATATACCGTGTGTCTATCGACTGAAGTAGGTCAGTAGATGTCAGCTATGATTGTATGAGGAGTGTCAACGGGAAAGCATTCTCTGTGCTGACTTCATGTCCGAAGGTTACATTGTTCACATTTTTCATTTTGTTTAGCAAGAATGTAGCAAAGAGAAATGTACCGGACATTAGTTTAAATCAGTCTTCAAAAGGTTTTAAGAAGTTACGGTAGCAAAGGAGAATGGACAGACAACTCGAATCTGAACAAGAATTTGCCAGCACAGGATAGGACGGAACTATGACAGAAGATAGAAGCCAAGTGGAGAAGAAGTAGTAAGAAGAAACTTTTAGGAGTTTACAAATTAAAACGTTTTCCTGACATTCTGAAATACTGCTCAAACGTTCCAAACTGATGTTAATTTCAAATGAATCTTGATTTGAAGAGGATGCCGAACATTTTCTATTTCAGATACTGGTTAGTCAGAGCCTGGTTTCGGAACGGATTTTTGTGTCAATAACGGGAATTTTTATGCATGTAATTACCGTCGGGAAAAAACCTCGACAGACAAACTCGCAACTCATTATCATTCTAACAATCTGTCGAATGATAGTCCTAAAATAACAGACACTTCACAGGACTTGGTAACATAGTCATCGAGCTTTCAATATGCTACTTACTGACAAATTGATCTAAAACAGTAACAGAAATATGTCATTTGTCTACGACTTGAACATCTGCAAGCGTCAGATTATATTAGCTTTGAAGTACCTCCTGCAAGATGAAAATGAAGGCTATCGTTGTTATAGAGAAAGCTTAACGTGTGAAGAAAACAAACAGAGCTCGTCAAAGCAGTTTAGAACAGCCAAGAATTGCTTTCAGTACAGGCGGGGGCTATCATATCTTGGTTGAAAACGACATATTGAAGAACTCTTATGGCCTCACCATATCATATTTGATTGTTGTTAGCAGCATATCTCAGGTTGTTTACTTCTAGTTCAAGGATATGAAGCATCAGTGTCAGACCTGGACTTGTGTAGCAAGCAGGCGTATAGCTTGTGTGCAGTCTAAGTGAATGAAAGGTATACACGCTGTTTCTTGCGAGTGTTTCAAGACCGAGCCTCGAAGGTCAAGAGCAGTTATAGGAGGAAGCACTTAAGCTGTTCTAGCGACGTAAAGTTCGATATGCAACCTGCCACCGAATAATGACAAATATATGTCCAGTTGCGAACATTCTACATCTTAAGGAGTGACAAGACGAGATGCACTCAAATAAGATGTAAACAGTCTATTAGCTAACTCCACCTTGAGAAACTATGCGAGGAGCTTCAAGTTTGAGCTGGAAGCGGTCATGTTGTGGTGCATCTGTTACTTCTGTTCATCTGTATCTGGAGCCATGCTGTTGGTATGAGATTAGTTGCCCTGGTTTACTATGGTAATGGTGTGTTACTTGATGATCTTGCGCTGTTCACCTGCGAACATATTTTTTGATTTCCGTTTTTACACTATTGTCAAATATGATATTATTCAGTTCCAGTGCTAAGCAGCGACAAGAAGAAGAGAGAATATAGGAGTACATCGTGAATATATTGCAAATAGTAGGGATATGAAGCTTCGCAGTTCAACTTTATCGGGGAAGGTTAACCAAAAATTTATCGAAACTGTGGAAGGCACGCGAATAATAAAGAACTTTATTTTTAGTGAACATCTGATCTGGTAAAGCAATTGTTTTGTGCTGGTGTCTGTTGCACCTATATGTCGATTCTCCGCTGTAAGACAGTTCGAGGGCTAACTCGGTCCTAAATCTGTTTCCCTTTTCTGCAGGTGACTGTTATACCGACTCAAGAAGTCTTTTCGCCTCGACTTGTAGTCGTGACTGCGTGACGCTCCCCACCCCTCTGAACAACTTGGTTTGGAGGAGCTCCGCGTTGCTGTTCTTAGTGGACGTTCCTTTCTTGTTTGCGTCATTGCACTAGTGGGCAATAATTTCTACCTTTCGGAGTGCAGAAAGGCGGAGACAACGATCAAACTAAAGCAAAATCTCACGTGAAAGAAGTGAAACTTCTTGATGCAGAGGAGAGTATGGTCATGCGCAAACTTTTGGTGAGTCACTTCTTCGACCAAAATGCATAATTTCATCTACTACTTGGCTATTAGTTAGAGCTTTTGAGGGTTCTAGACGAAGAATCTAGAGGCACTTGTGCAGGAAGGGCACTTCTGAATCATCACTCGTATTCCTACTCACGGCTTAACCGTCCATCAGCTGGGATTATGGTCATGCTTGTCTGTAAGGTCTTTAGCTTAGGGGTGTAGGAACTTTTGAATGGCGACAAGGTGGTTCCGCTGTTGTGCAGGGTGTGTCTGACGGGTGATAGTATGTGTTGTGTAGAGGGTGTGTCTGACGGGTGATAGTATGTGTTGTGTAGAATGTAGTGTCGAACGCAGGACTGAAGTTAGATCGTCTTCTCGAGTTAATCTGTTTTAAGTGCAGGGAAACAGGAATCGCGCAGATCTGTTGATTACTTTTAAACTGGAGGGATTGCCGCCCCTCTATATAATGTTATTTAAAACCATCACAAGTTGTTTGGATCCATTTCCTTTGGCTGGTTTAGAAAATAGATTATACACGACCCTAACGTGCATTGTGTTTCCAGCGTGGACCACGTTATTTCGATCCTCCAGAAGAGCAGGATCAGTCGTGCTATAATTGTGGCAAAGTTGGTCATCTGGCCGTCGATTGTGCCGAAGGTCGCCGACTCAAGCCTTGCTATGTCTGTGGAACTTTTGGACACGATGGAAGGGACTGTCCTCAGGTATTTTTGGCAAACCGTTTCGTTATTACATACACCTAAGTGTGAGAAGGATCTCTTCTCAAAGTACTGAAGTCAAGAAGAATACATGCCATTGTAAATGTAATTTTATGTAGAAATATTCTCAGAACAGACGTGTCACCCCGTGCTTGCAGAAAACAGATTGTTACATCTGCGGGAAAGTAGGCCATATTGCAAAGAACTGTCCCAACAAGGGATTACGGACTCCGACAAGTAGAGGAGATGAGTTTATCTGTCTCCTGTGTGGACGCTCTGGTCACGAAGCTCCAACGTGTTATTATGAGTACGACGAACAGGACTTGGAGGTATAATTGTTAACTGGAGCATTATGGTTCAGTTGGTATTTTATCACGAAGATTGACATTTTATGAATTGACCGTAGTGTGTTGATCGTGACGCAGCAAGTGCAATGCTACATCTGCAAGGAGTTCGGACACCTGTCGTGTGTTGATATTGTGGACACTTCTCCTGTACCTGTCTCGTGTTTCATGTGTGGCGAAATGGGTCATACTGGAACGGTGCGTTATGGATTACTTGGTATTGTTGTTGCTTTCGAAGGTTCGAAATTTTAGAAGATTGATGTGACCTGAAACATCGGGTGCGTATGTTTGTGTTGCACATTTTGAAAATTTTATGAGCCCCAAGTTTATGTAGAAGTTTTTTGTTCCATGACAGGGTTGTACGCGGACTCGCAGAGCAGATAGAGATAGAGATAGAGCAGGAGGTGACAAGGACAGAACCGCCTCGTTATGTTTTAAGTGTGGCGAAGAAGGGCATTTCGCTCGAGAATGCAGCAAGGTTAGTTGCTTTATTGTCCTGTCACCTGTGTGAGTAGCGATAGTAAAGGCTTCTTTGTTTCTTTGTTTGTTTCAAATCTGGTCATCCAGGCGTTTGCTCTTTTGAAAAGAACAAGCTGAGTTTTATTCCCTGCGTTCGGACCATAGCTACCGCGGGTTGGAGAAAACTTCCAAAATTTTGGGCTTGGGATTAGGCAGTGTCATTCTTACGACAAAATGGATGTGGCTAATCGGTGTCATTGAATTTGGTCGTAATTTTTTATTCTTGGATTTTTGGTGGAAAGCAGCAGCGTCGTCCATGGCCCGCTCCATGGCCACTTGAAGAGCAAGGTTTGTCCCCCGCGGACTTTTCTACTCCTGGTTCGAAACACCAAAGACGTAACGGAGGGGTGCCCCGATGGATGGACTTGCAGTCACGGGAAGGGAGATGGACGCCTCCAGCAAGGGCTCACCAATCAGATTTGTACGCCGGTTACAGCCGGGGATATGGCTCGTCTTCTAAACGACAAGACAATACAGCCCTTGCAGAAAACAACGACGATGATTATATGGGGCCTATTGACAACTTTGTTACAAGTTCAAAAGAGAACTTCAAGTCACGTCGTAGGAAAAGTTGGACCGCTGGTGGAGGTGGACGAAAGCGACCATAGATCAAAGAACCAATTTTATAACCGTGCGATGCTGATTTGCAGCGAGCGCCGTAGAAATAAACTTCTTGATGGGTTTTCATCTCAAAAAGTGAAGCGTTTCGAAGTGTACTTTTTTCTCGTGATTTTTGGTCACAGGTGAAGAAGGATTCACAGGTGCACAGTTTGTAGAACCATGAGGTATCTGTAAAGAAGGCCATGTTTGAAATTCTTCCTTTGTTTCGAAGAGGTGGAGCACATTTTGTACTTGCCAGTGGAAATTAAACGTAAGCTCAGATGACCGTGTCTACCAAGGTCTGCAGTCTTTCAAAATC

mRNA

>Mapoly0019s0115.1
GAGAGCTTTGAATTGGCAACAGATCAAATTGCTTGCAGCTCAAAATCCAGTAGCCATGTGGCAGAAATTGTTTGCCAATGAGTAGCAGTCCTGGAATTCCTCATTGAAGCAGATCTGTGTCAGGAAACGACCAGATTCGAACAAGAGCAGCAAACTGAAACTATGTCATTCGACGAGGACCCATTCGGAGAGAAGGAAAGGATGATGGGAGGGAAGAGAAATCAAATGAAGTAGGGTTTGAACGGACGCGCGAAGAATCCAGACAGGAGTGCAAATTGCAGGAGACTCGAAAGCACGAGCACGGAATTGTGGGAATGCGGGATTTGCTGGAATGATCGAATGCTCGATTGGATGGAGGAATTTTGACTTCAGACAGTCAGACTGACCGCCGCGATGGCACGGGAAGTGGAAGCGGAGGAGGACGAAGAGGAGAGTGGAGAGTTGGGCCAGGAGACGCCGAGAAGCTCCGAAGGTGTGGCGAAAGGGAGCCGTGGTTATGGTGGAGGCGGCGGAGGAGCCGACGAGGACGAAGGAAGCGTGGAGGATGAGGGGTATGGGCTGAATTTGGAGACCCGGAGGTATTCGGTTGTCCAGCGAGGTGAGCAGGAGGATGGCGAAGCTGATGATGATGATATTGGAGATGAAGATGACAGTCATGCGAATGAAGATTTGAGTTTGCACATTGTCGAGAAAGCCAAGAAGAGGCGGAAGCTAGAGCCTCGGGCGGCAGATGAGGGTGTTGTCATTATAGATGGTCGTGCAGAGGAGGAGCTGATTGTTGAGAAGCGCAGCAGTGAGGGAAATTCTGTTGCTGCAGACGAGTGCAAAGAACCGTTGTCCAGGAGCGATACTCCGGAGGAAGGCGAGCTACAGGAGGACGGCGAAGGAAACCTTGTGCTTGCCGCAGACCTTTTCGAAGCAGAGGACGCCCCAGATGAAGGTGGAGGAAAGAAGAGGAAAAAGAGGAAGAAAGAAAAGAAAGAAAAGAAGAAGAAGAAGAAAGGCGGAGACAACGATCAAACTAAAGCAAAATCTCACGTGAAAGAAGTGAAACTTCTTGATGCAGAGGAGAGTATGGTCATGCGCAAACTTTTGCGTGGACCACGTTATTTCGATCCTCCAGAAGAGCAGGATCAGTCGTGCTATAATTGTGGCAAAGTTGGTCATCTGGCCGTCGATTGTGCCGAAGGTCGCCGACTCAAGCCTTGCTATGTCTGTGGAACTTTTGGACACGATGGAAGGGACTGTCCTCAGAAAACAGATTGTTACATCTGCGGGAAAGTAGGCCATATTGCAAAGAACTGTCCCAACAAGGGATTACGGACTCCGACAAGTAGAGGAGATGAGTTTATCTGTCTCCTGTGTGGACGCTCTGGTCACGAAGCTCCAACGTGTTATTATGAGTACGACGAACAGGACTTGGAGCAAGTGCAATGCTACATCTGCAAGGAGTTCGGACACCTGTCGTGTGTTGATATTGTGGACACTTCTCCTGTACCTGTCTCGTGTTTCATGTGTGGCGAAATGGGTCATACTGGAACGGGTTGTACGCGGACTCGCAGAGCAGATAGAGATAGAGATAGAGCAGGAGGTGACAAGGACAGAACCGCCTCGTTATGTTTTAAGTGTGGCGAAGAAGGGCATTTCGCTCGAGAATGCAGCAAGCAGCGTCGTCCATGGCCCGCTCCATGGCCACTTGAAGAGCAAGGTTTGTCCCCCGCGGACTTTTCTACTCCTGGTTCGAAACACCAAAGACGTAACGGAGGGGTGCCCCGATGGATGGACTTGCAGTCACGGGAAGGGAGATGGACGCCTCCAGCAAGGGCTCACCAATCAGATTTGTACGCCGGTTACAGCCGGGGATATGGCTCGTCTTCTAAACGACAAGACAATACAGCCCTTGCAGAAAACAACGACGATGATTATATGGGGCCTATTGACAACTTTGTTACAAGTTCAAAAGAGAACTTCAAGTCACGTCGTAGGAAAAGTTGGACCGCTGGTGGAGGTGGACGAAAGCGACCATAGATCAAAGAACCAATTTTATAACCGTGCGATGCTGATTTGCAGCGAGCGCCGTAGAAATAAACTTCTTGATGGGTTTTCATCTCAAAAAGTGAAGCGTTTCGAAGTGTACTTTTTTCTCGTGATTTTTGGTCACAGGTGAAGAAGGATTCACAGGTGCACAGTTTGTAGAACCATGAGGTATCTGTAAAGAAGGCCATGTTTGAAATTCTTCCTTTGTTTCGAAGAGGTGGAGCACATTTTGTACTTGCCAGTGGAAATTAAACGTAAGCTCAGATGACCGTGTCTACCAAGGTCTGCAGTCTTTCAAAATC

CDS

>Mapoly0019s0115.1
ATGGCACGGGAAGTGGAAGCGGAGGAGGACGAAGAGGAGAGTGGAGAGTTGGGCCAGGAGACGCCGAGAAGCTCCGAAGGTGTGGCGAAAGGGAGCCGTGGTTATGGTGGAGGCGGCGGAGGAGCCGACGAGGACGAAGGAAGCGTGGAGGATGAGGGGTATGGGCTGAATTTGGAGACCCGGAGGTATTCGGTTGTCCAGCGAGGTGAGCAGGAGGATGGCGAAGCTGATGATGATGATATTGGAGATGAAGATGACAGTCATGCGAATGAAGATTTGAGTTTGCACATTGTCGAGAAAGCCAAGAAGAGGCGGAAGCTAGAGCCTCGGGCGGCAGATGAGGGTGTTGTCATTATAGATGGTCGTGCAGAGGAGGAGCTGATTGTTGAGAAGCGCAGCAGTGAGGGAAATTCTGTTGCTGCAGACGAGTGCAAAGAACCGTTGTCCAGGAGCGATACTCCGGAGGAAGGCGAGCTACAGGAGGACGGCGAAGGAAACCTTGTGCTTGCCGCAGACCTTTTCGAAGCAGAGGACGCCCCAGATGAAGGTGGAGGAAAGAAGAGGAAAAAGAGGAAGAAAGAAAAGAAAGAAAAGAAGAAGAAGAAGAAAGGCGGAGACAACGATCAAACTAAAGCAAAATCTCACGTGAAAGAAGTGAAACTTCTTGATGCAGAGGAGAGTATGGTCATGCGCAAACTTTTGCGTGGACCACGTTATTTCGATCCTCCAGAAGAGCAGGATCAGTCGTGCTATAATTGTGGCAAAGTTGGTCATCTGGCCGTCGATTGTGCCGAAGGTCGCCGACTCAAGCCTTGCTATGTCTGTGGAACTTTTGGACACGATGGAAGGGACTGTCCTCAGAAAACAGATTGTTACATCTGCGGGAAAGTAGGCCATATTGCAAAGAACTGTCCCAACAAGGGATTACGGACTCCGACAAGTAGAGGAGATGAGTTTATCTGTCTCCTGTGTGGACGCTCTGGTCACGAAGCTCCAACGTGTTATTATGAGTACGACGAACAGGACTTGGAGCAAGTGCAATGCTACATCTGCAAGGAGTTCGGACACCTGTCGTGTGTTGATATTGTGGACACTTCTCCTGTACCTGTCTCGTGTTTCATGTGTGGCGAAATGGGTCATACTGGAACGGGTTGTACGCGGACTCGCAGAGCAGATAGAGATAGAGATAGAGCAGGAGGTGACAAGGACAGAACCGCCTCGTTATGTTTTAAGTGTGGCGAAGAAGGGCATTTCGCTCGAGAATGCAGCAAGCAGCGTCGTCCATGGCCCGCTCCATGGCCACTTGAAGAGCAAGGTTTGTCCCCCGCGGACTTTTCTACTCCTGGTTCGAAACACCAAAGACGTAACGGAGGGGTGCCCCGATGGATGGACTTGCAGTCACGGGAAGGGAGATGGACGCCTCCAGCAAGGGCTCACCAATCAGATTTGTACGCCGGTTACAGCCGGGGATATGGCTCGTCTTCTAAACGACAAGACAATACAGCCCTTGCAGAAAACAACGACGATGATTATATGGGGCCTATTGACAACTTTGTTACAAGTTCAAAAGAGAACTTCAAGTCACGTCGTAGGAAAAGTTGGACCGCTGGTGGAGGTGGACGAAAGCGACCATAG

Protein

>Mapoly0019s0115.1
MAREVEAEEDEEESGELGQETPRSSEGVAKGSRGYGGGGGGADEDEGSVEDEGYGLNLETRRYSVVQRGEQEDGEADDDDIGDEDDSHANEDLSLHIVEKAKKRRKLEPRAADEGVVIIDGRAEEELIVEKRSSEGNSVAADECKEPLSRSDTPEEGELQEDGEGNLVLAADLFEAEDAPDEGGGKKRKKRKKEKKEKKKKKKGGDNDQTKAKSHVKEVKLLDAEESMVMRKLLRGPRYFDPPEEQDQSCYNCGKVGHLAVDCAEGRRLKPCYVCGTFGHDGRDCPQKTDCYICGKVGHIAKNCPNKGLRTPTSRGDEFICLLCGRSGHEAPTCYYEYDEQDLEQVQCYICKEFGHLSCVDIVDTSPVPVSCFMCGEMGHTGTGCTRTRRADRDRDRAGGDKDRTASLCFKCGEEGHFARECSKQRRPWPAPWPLEEQGLSPADFSTPGSKHQRRNGGVPRWMDLQSREGRWTPPARAHQSDLYAGYSRGYGSSSKRQDNTALAENNDDDYMGPIDNFVTSSKENFKSRRRKSWTAGGGGRKRP

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>