Mapoly0021s0100



Description

MYC

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_141651
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR11514 MYC
PANTHER PTHR11514:SF29

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH8 transcription factor, bHLH Mapoly0021s0100.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0021s0100.1 scaffold_21:1050858..1054843  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0021s0100.1  

Gene structure:

mRNA scaffold_21:1050858..1054843  ( + strand )
five_prime_UTR scaffold_21:1050858..1051093  ( + strand )
five_prime_UTR scaffold_21:1051701..1051726  ( + strand )
CDS scaffold_21:1051727..1053175  ( + strand )
CDS scaffold_21:1053799..1054176  ( + strand )
CDS scaffold_21:1054473..1054547  ( + strand )
three_prime_UTR scaffold_21:1054548..1054843  ( + strand )

Sequences:

Gene

>Mapoly0021s0100.1
TGTGTGTATATAAAGGGTGGGGCCGGGTCCATCTAGGTGCAGTACTCAATTCAGCTTGGTGGAACTGAATTCATTGCCAGATGAGAGTGTGTGACCGTCCAGACTTGAAAACCTTGAAAACAGCTTAAAGAAAGCAAAATTTGAGGGCATTTTTAAAATCGCATGTGGTCGCTGAGAATCGCACAAGGCAGCTTACATTACAGTCTGACTGTCCTGCTCCAACGACAGCCATTCTTGTGAGTCCCCTTAGATTCTGCTTGCTGTTCTTACTACTACTCTGATGAACAACTCGTGCTTTTAAATCTGTACTATAAGATTTATACGATGAAGACTGTCAGAGGATTCATTGAGTTTACAGATGTGTTTTACAGTGGTAATAGCACTTGCCCTGTAGTTTACATATCATTGGTCTAACCGCAAAGCATGATCCAGATGCAACGAGTTCTACACCTGCATTTGATTTACTTCTTCCAGTGAAAGTTCGAAAGTTCGAAAAAATAAATTTCATTCTGAGTTGAACTTTTCTACGACGAGAAATGAATGGATAGGGGTCTAATCTCATAGTTCACTCTGCTCTCGACTCAAGGCACTGCTTTGGAAATGAAGCAGGCCATGAGTTTTAATAATGTGGTTGTCTAGAGTGATAATTTTGAGAACCTAGTCTTATTGTCTTAGAGACGGGTGACGAGTAGGGATTAATTATGTATGCAGGCAAAAGAGATGATAAATTGCGACCAGTGATACCTATCAGTGATCAATGATAGTTATCAGTCGGTTAATTGCAGTCACCAACGTCGAGAAATCATTGTGTGGGACTGACATTGAACGATTTCCTTTTGTCAGAGAGCGTGGAGAAGGGTTTGGATCTCATGCTCAACTGTGACATGTCCAGAAAAAAGAGTCGCGCAGAAGGGTCGTCATCGTTGACATATGATCGACATGGGTTTTCGGCGCGAGCTGGAATTTGTTGTCCAGATGAACTATACAACGAGCATCTGGCTCTTCTAAACTGGGGGCGTCGAAGTGAACCACCACTGGACATGGCTGTTTCAATGTTTCCAATTCCTCTCCAATCATTGGAGTGCGAGGACGCGAATCCACAGAATAAGGACGTCACTGTTTCACCAATGTGCATCATGAGGCCTGAGTTCTCACTCGAAAATTTTCCTGACCCAGACAACAGGTACAACCAATTTCGAGAAGTTCAGGAGCACGTACAGCAAGAGGACTTCTCTAACATTTCTAGCAGTTTTCCTGAGACTTTCACGGATGGTACTCGATTTTGTGTTCCTCAGTATCCTGTCCAGGAAGGGATAAACAACGCAAGCGGAGATTCTATAGCAAGTGCTGCAGCTCAAGAGCAGGTAGATGCCCTCGGTGGACTGACACTTACACCGTACTCCAACAACTTCTTAGATCAGATGTTTCGTGAGCCAGCAGCTGTCCATGTTCATGGGCATCATCCTATCAATCTTGGGAGTAACTCACAACTTCGGGACGGTATCGACCCTTGCATTCGGTCAAAGCATAACTCTTGTTCCACCTTGGAGGCCTCCTATCCAAGTCCCGCATCGCAGTCAGCCCGGGAATCTATCTTGAGAACGACAGTTCCACCTTCACCTGGAGAGTTGTCATGTCAAGACCATGCTCTCATGCAGCTGCAGCTGAACTTTGCTCTGAACGACGAGTTCATACGACTCCAGGGTGCCCAAGGCAAGTCACGCTCTCACGATCCGATACTGTCTCTTTTGCCAGCCGTGGATACGTATTTCCCTGAACGTGATGGGAAAAGTGGTTTGGAATCTTCTGGAGAGATAATGAAGTTCGAGGCGAATTTGGACACGGACGTGGACACAAGTTGCGGACTCAAGATGCCCCAGCTGCATGTTTTGCATGGGAAGGCTCCAACTAATCTGCCACCCTTGAATGGGGCTCATCTGGCAGCTCCAAGTCCCATGCGATATCCAGAAGGAGGTTCAGAGGCGGGGCTGATCTGTGCAGGTGGTAGACAGAAGAAGGACATACTTGCTGCGCCTGTTGCAGAAGCCCCACACTTCCATAAACGGGCATCTTTCAGCAGAGTGAACTCTGATCCAGCACCCCTCGCTCCGCAACATGGGTCGGCCAGCATGGATACCAGCAAGGCCAGAAATGCTCAGAACAGGGATCGAGTTCCATCCAACAAGTGTGTCGCTCAAACACCTTCACACTTGGACGCTGGCCCTGTTTCATCGACATTTGCCAGGGAAAAACTACGCCGTGAGAAGCTGACCGAGAACTACAACACCTTAAAATCTATGCTCCCAAAACATACCAAGGTAACTCGCTTCGCCTTTCTTCCTTTGTTAGTTATAGCGTGACAGATTTAAATTTGGGAATTTTGACATAGCTTTCTTTGATTGACCCGAGTGACCTGTATACACAAGTTGATGTCTTTGGTAATTATATAAATAAGTGGCACTGGGTATCTCTGACAATGAATTCTGAATTCTGAAAATTATTATAAATTAAAGGCCAATGATGCTAAGGAAGTAGAGGCGCATACTGAATATATCTTAAACTTCACCCAGTCATCATATGCATAGCCTTATTGAAAACGATCTACCAAAAGACATGTGAAGTAGACATGAGTTCATATGTCTCATTAAAAAATGAGATATTCAATAAGACATTGTTGGAAGTTGGAGACCCCTTCACTAAGAATTTGAGTTCTCAAGGAGAATCTTTCACCTTCAAAAGCAAGCAATATACATTTGGGCGAGGTGTTTTGTGGTGCATGTATAGACTATTCCCGTATTATTTCCTAAGAATTAATGCTTAGTTGCTCTCCACAAAAGTCGACTCTAGCAGAAATGTCAATTTGAATTTCAGTATTGAAGCATGGTGAAGATACGAGGAGCACGGGAAGTTTTAACGAGAAAGAATTGGCCTTTTGATGTAGGTAGATCGAGCGTCAATTTTGCAGGCAACAATAGCCCGTGTGAAGCTTCTAGAAAGTGAAAAATCCTATCTTGAGAATATGAAACAAAAGAGGTCGATCATGAAAAACCTTCAAGCACAGGAAAAGGCAGCTGAAGGTCAGATATCAGAGCAAAGCGGCGAAGTCGACTGTCATTGGCTTAAGAGGACTTCTCGTCATGGCACACGCGTGGACATGCGCATAGTCCATGATGAAATGTATGTCAACATAGTCCAGCAGCATCTGCCGATGTTCTTGTTGCGGATAATGTCGTTTCTCGAAACCAAGTTGAAACTTGATATCCTGAATGCGACAGGGAGCGTCATCAATGGTTTCGATGTCTACAACTTTGAACTTAAGGTGATATGTGATTTCCAACATGCACATGCTGTCATTCATTTCGTTATAAGTTCTTGTCTTTTCCTGCTTCAACGCTCTATTTCTAGAGCTTGAGCTGCATTGATAGCTTCTGAATCCCTACCTTTCTTACATCTGTCATTTGAACACACAATACTCTTATCAGCCACAGCTGTGCTATAAATTTGTATTGTTCATGAAAAGTAATTCCACAATCTCTACAGAACTTTAGAGATCATTGCTGCACTTGAGTCTCACAGTCATCTTGTCACTTGTCATCATTTGTCGTTTATTTGCAGATCAAAGGAGAATTATGTGGAGATGCGAGTGAGGTGATGAGAAACATTATGGATACATTGGACTCAGTGATTTGAGCAAACATATACATCAGCTTACTTCATATTCCAACATTTTTACTGCAACATGTATTCTATTTGTCCTTGTATAACAAATTAAAATATGCTAAGCTACAATTGACGAATTTTGAATTCCATTTTCATAGTATAGTCACTGTTCGAATGATTGTATCAGTAATGTATCATACTCTGATCTAGACGTGGATCCATGTAGCGCGAAGTGACTAGCTTCTGTCTTGGTCATATTGGTGATTTGACGTTCACAGTGGATTTCCTTTTCTTAGAAGGTTTTCATATACTACGTACATAATCAA

mRNA

>Mapoly0021s0100.1
TGTGTGTATATAAAGGGTGGGGCCGGGTCCATCTAGGTGCAGTACTCAATTCAGCTTGGTGGAACTGAATTCATTGCCAGATGAGAGTGTGTGACCGTCCAGACTTGAAAACCTTGAAAACAGCTTAAAGAAAGCAAAATTTGAGGGCATTTTTAAAATCGCATGTGGTCGCTGAGAATCGCACAAGGCAGCTTACATTACAGTCTGACTGTCCTGCTCCAACGACAGCCATTCTTAGAGCGTGGAGAAGGGTTTGGATCTCATGCTCAACTGTGACATGTCCAGAAAAAAGAGTCGCGCAGAAGGGTCGTCATCGTTGACATATGATCGACATGGGTTTTCGGCGCGAGCTGGAATTTGTTGTCCAGATGAACTATACAACGAGCATCTGGCTCTTCTAAACTGGGGGCGTCGAAGTGAACCACCACTGGACATGGCTGTTTCAATGTTTCCAATTCCTCTCCAATCATTGGAGTGCGAGGACGCGAATCCACAGAATAAGGACGTCACTGTTTCACCAATGTGCATCATGAGGCCTGAGTTCTCACTCGAAAATTTTCCTGACCCAGACAACAGGTACAACCAATTTCGAGAAGTTCAGGAGCACGTACAGCAAGAGGACTTCTCTAACATTTCTAGCAGTTTTCCTGAGACTTTCACGGATGGTACTCGATTTTGTGTTCCTCAGTATCCTGTCCAGGAAGGGATAAACAACGCAAGCGGAGATTCTATAGCAAGTGCTGCAGCTCAAGAGCAGGTAGATGCCCTCGGTGGACTGACACTTACACCGTACTCCAACAACTTCTTAGATCAGATGTTTCGTGAGCCAGCAGCTGTCCATGTTCATGGGCATCATCCTATCAATCTTGGGAGTAACTCACAACTTCGGGACGGTATCGACCCTTGCATTCGGTCAAAGCATAACTCTTGTTCCACCTTGGAGGCCTCCTATCCAAGTCCCGCATCGCAGTCAGCCCGGGAATCTATCTTGAGAACGACAGTTCCACCTTCACCTGGAGAGTTGTCATGTCAAGACCATGCTCTCATGCAGCTGCAGCTGAACTTTGCTCTGAACGACGAGTTCATACGACTCCAGGGTGCCCAAGGCAAGTCACGCTCTCACGATCCGATACTGTCTCTTTTGCCAGCCGTGGATACGTATTTCCCTGAACGTGATGGGAAAAGTGGTTTGGAATCTTCTGGAGAGATAATGAAGTTCGAGGCGAATTTGGACACGGACGTGGACACAAGTTGCGGACTCAAGATGCCCCAGCTGCATGTTTTGCATGGGAAGGCTCCAACTAATCTGCCACCCTTGAATGGGGCTCATCTGGCAGCTCCAAGTCCCATGCGATATCCAGAAGGAGGTTCAGAGGCGGGGCTGATCTGTGCAGGTGGTAGACAGAAGAAGGACATACTTGCTGCGCCTGTTGCAGAAGCCCCACACTTCCATAAACGGGCATCTTTCAGCAGAGTGAACTCTGATCCAGCACCCCTCGCTCCGCAACATGGGTCGGCCAGCATGGATACCAGCAAGGCCAGAAATGCTCAGAACAGGGATCGAGTTCCATCCAACAAGTGTGTCGCTCAAACACCTTCACACTTGGACGCTGGCCCTGTTTCATCGACATTTGCCAGGGAAAAACTACGCCGTGAGAAGCTGACCGAGAACTACAACACCTTAAAATCTATGCTCCCAAAACATACCAAGGTAGATCGAGCGTCAATTTTGCAGGCAACAATAGCCCGTGTGAAGCTTCTAGAAAGTGAAAAATCCTATCTTGAGAATATGAAACAAAAGAGGTCGATCATGAAAAACCTTCAAGCACAGGAAAAGGCAGCTGAAGGTCAGATATCAGAGCAAAGCGGCGAAGTCGACTGTCATTGGCTTAAGAGGACTTCTCGTCATGGCACACGCGTGGACATGCGCATAGTCCATGATGAAATGTATGTCAACATAGTCCAGCAGCATCTGCCGATGTTCTTGTTGCGGATAATGTCGTTTCTCGAAACCAAGTTGAAACTTGATATCCTGAATGCGACAGGGAGCGTCATCAATGGTTTCGATGTCTACAACTTTGAACTTAAGATCAAAGGAGAATTATGTGGAGATGCGAGTGAGGTGATGAGAAACATTATGGATACATTGGACTCAGTGATTTGAGCAAACATATACATCAGCTTACTTCATATTCCAACATTTTTACTGCAACATGTATTCTATTTGTCCTTGTATAACAAATTAAAATATGCTAAGCTACAATTGACGAATTTTGAATTCCATTTTCATAGTATAGTCACTGTTCGAATGATTGTATCAGTAATGTATCATACTCTGATCTAGACGTGGATCCATGTAGCGCGAAGTGACTAGCTTCTGTCTTGGTCATATTGGTGATTTGACGTTCACAGTGGATTTCCTTTTCTTAGAAGGTTTTCATATACTACGTACATAATCAA

CDS

>Mapoly0021s0100.1
ATGCTCAACTGTGACATGTCCAGAAAAAAGAGTCGCGCAGAAGGGTCGTCATCGTTGACATATGATCGACATGGGTTTTCGGCGCGAGCTGGAATTTGTTGTCCAGATGAACTATACAACGAGCATCTGGCTCTTCTAAACTGGGGGCGTCGAAGTGAACCACCACTGGACATGGCTGTTTCAATGTTTCCAATTCCTCTCCAATCATTGGAGTGCGAGGACGCGAATCCACAGAATAAGGACGTCACTGTTTCACCAATGTGCATCATGAGGCCTGAGTTCTCACTCGAAAATTTTCCTGACCCAGACAACAGGTACAACCAATTTCGAGAAGTTCAGGAGCACGTACAGCAAGAGGACTTCTCTAACATTTCTAGCAGTTTTCCTGAGACTTTCACGGATGGTACTCGATTTTGTGTTCCTCAGTATCCTGTCCAGGAAGGGATAAACAACGCAAGCGGAGATTCTATAGCAAGTGCTGCAGCTCAAGAGCAGGTAGATGCCCTCGGTGGACTGACACTTACACCGTACTCCAACAACTTCTTAGATCAGATGTTTCGTGAGCCAGCAGCTGTCCATGTTCATGGGCATCATCCTATCAATCTTGGGAGTAACTCACAACTTCGGGACGGTATCGACCCTTGCATTCGGTCAAAGCATAACTCTTGTTCCACCTTGGAGGCCTCCTATCCAAGTCCCGCATCGCAGTCAGCCCGGGAATCTATCTTGAGAACGACAGTTCCACCTTCACCTGGAGAGTTGTCATGTCAAGACCATGCTCTCATGCAGCTGCAGCTGAACTTTGCTCTGAACGACGAGTTCATACGACTCCAGGGTGCCCAAGGCAAGTCACGCTCTCACGATCCGATACTGTCTCTTTTGCCAGCCGTGGATACGTATTTCCCTGAACGTGATGGGAAAAGTGGTTTGGAATCTTCTGGAGAGATAATGAAGTTCGAGGCGAATTTGGACACGGACGTGGACACAAGTTGCGGACTCAAGATGCCCCAGCTGCATGTTTTGCATGGGAAGGCTCCAACTAATCTGCCACCCTTGAATGGGGCTCATCTGGCAGCTCCAAGTCCCATGCGATATCCAGAAGGAGGTTCAGAGGCGGGGCTGATCTGTGCAGGTGGTAGACAGAAGAAGGACATACTTGCTGCGCCTGTTGCAGAAGCCCCACACTTCCATAAACGGGCATCTTTCAGCAGAGTGAACTCTGATCCAGCACCCCTCGCTCCGCAACATGGGTCGGCCAGCATGGATACCAGCAAGGCCAGAAATGCTCAGAACAGGGATCGAGTTCCATCCAACAAGTGTGTCGCTCAAACACCTTCACACTTGGACGCTGGCCCTGTTTCATCGACATTTGCCAGGGAAAAACTACGCCGTGAGAAGCTGACCGAGAACTACAACACCTTAAAATCTATGCTCCCAAAACATACCAAGGTAGATCGAGCGTCAATTTTGCAGGCAACAATAGCCCGTGTGAAGCTTCTAGAAAGTGAAAAATCCTATCTTGAGAATATGAAACAAAAGAGGTCGATCATGAAAAACCTTCAAGCACAGGAAAAGGCAGCTGAAGGTCAGATATCAGAGCAAAGCGGCGAAGTCGACTGTCATTGGCTTAAGAGGACTTCTCGTCATGGCACACGCGTGGACATGCGCATAGTCCATGATGAAATGTATGTCAACATAGTCCAGCAGCATCTGCCGATGTTCTTGTTGCGGATAATGTCGTTTCTCGAAACCAAGTTGAAACTTGATATCCTGAATGCGACAGGGAGCGTCATCAATGGTTTCGATGTCTACAACTTTGAACTTAAGATCAAAGGAGAATTATGTGGAGATGCGAGTGAGGTGATGAGAAACATTATGGATACATTGGACTCAGTGATTTGA

Protein

>Mapoly0021s0100.1
MLNCDMSRKKSRAEGSSSLTYDRHGFSARAGICCPDELYNEHLALLNWGRRSEPPLDMAVSMFPIPLQSLECEDANPQNKDVTVSPMCIMRPEFSLENFPDPDNRYNQFREVQEHVQQEDFSNISSSFPETFTDGTRFCVPQYPVQEGINNASGDSIASAAAQEQVDALGGLTLTPYSNNFLDQMFREPAAVHVHGHHPINLGSNSQLRDGIDPCIRSKHNSCSTLEASYPSPASQSARESILRTTVPPSPGELSCQDHALMQLQLNFALNDEFIRLQGAQGKSRSHDPILSLLPAVDTYFPERDGKSGLESSGEIMKFEANLDTDVDTSCGLKMPQLHVLHGKAPTNLPPLNGAHLAAPSPMRYPEGGSEAGLICAGGRQKKDILAAPVAEAPHFHKRASFSRVNSDPAPLAPQHGSASMDTSKARNAQNRDRVPSNKCVAQTPSHLDAGPVSSTFAREKLRREKLTENYNTLKSMLPKHTKVDRASILQATIARVKLLESEKSYLENMKQKRSIMKNLQAQEKAAEGQISEQSGEVDCHWLKRTSRHGTRVDMRIVHDEMYVNIVQQHLPMFLLRIMSFLETKLKLDILNATGSVINGFDVYNFELKIKGELCGDASEVMRNIMDTLDSVI

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>