Mapoly0021s0101



Description

(UnKnown)

Reference DB

Database ID Description
OrthoMCL OG5_170445

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH9 transcription factor, bHLH Mapoly0021s0101.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0021s0101.1 scaffold_21:1056755..1060869  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0021s0101.1  

Gene structure:

mRNA scaffold_21:1056755..1060869  ( + strand )
five_prime_UTR scaffold_21:1056755..1057004  ( + strand )
five_prime_UTR scaffold_21:1057206..1057291  ( + strand )
five_prime_UTR scaffold_21:1057520..1057895  ( + strand )
five_prime_UTR scaffold_21:1058126..1058127  ( + strand )
CDS scaffold_21:1058128..1058388  ( + strand )
CDS scaffold_21:1058482..1058877  ( + strand )
CDS scaffold_21:1059863..1060237  ( + strand )
CDS scaffold_21:1060547..1060633  ( + strand )
three_prime_UTR scaffold_21:1060634..1060869  ( + strand )

Sequences:

Gene

>Mapoly0021s0101.1
TCGTGCAATGCATGGTAGAAGCATGGACAGCTCACGGACATGTCTTAGAATTGCGGGTGTGACCAGCACACGTCGGTCTTGTAGCGGTCAGTATGAAATTAATTGGCGTTTTCATCCGGTCATGATTTATTTATATCCTTGAGGTTGCATCAGGATTTAAAAAAATGCTGGGAAACTTGTGGCCCCAAACCATTGCGCTCTCAGCTAAGAAGAATTACATTCCCACAAAGTGGCCACTTTGGATCCCAGAGTAAGCTGGCTGACACGGCCATTGTTTTCATCTTGATGAATTTACATAATCTGTTTCCTGTCAGCACTGCATTTCTTTGAAAGTAACTATCTTCGTTTAGGCTATCAAACTAAATTGAAATCACATAGTGAAGTGTTGTGAGGGGGCATTAAATCACCTTTGGCTTGAAAATCGAATCTTACGAATGAAATATATTGCAAGGTCTATGCCAAAATTCCATATCTGGCTTACTACCTTTCAAGTTCAGAACTACTACAATAACATGAAGCAGTCAAGAAAATAAAGAGGTATGGATCATATGTTATACACTGCTCGACTCTAGTTAGTTAGGAAAACGACTTTCTTTTGTGCTATAGCACAAAACGAATGCTTCGGCCTTGTGAAGTACTTTATCCAGGAGATCTTAGTTGTCGTTTATAGCTTCGCTTTGGTGATCTTCAGGGTTTGCAACTTGTTTGCGACTCAAAAAGTAGGTCTCTGCCGTCACCAGATATTTAATATACATGAATCAGCAGTGCAGACGAGCAACAAATGCATCCCATGATCCTTGGATGTTTAAGAACTCTCAAGGAACGAAGACTATTTTCGAGGCGCAGTCAAACTCTCAAGCAATCCAAGTTTTTGGATCTGGAACTGAAACTCAAGGGCTTCTATTCACCGGTTTACTTTGGATCAAAGTCCAAGTCCCTTTCGTGAGATGTCGATGCTGGACCACAAAGAAACTGAAATTACGGGTGACAGAAGACATCAGTAGCACCACAATATTGTTGAAGGAGCTTGAATGATTTTGTCACCTACTGTATGAACCGGGAGATTCCAGAGAGCGAGAAGTGCAGGACCAGTATCATCAACTAGCACTCCATCTGCGAGACCCTTCATTCAGCTTTTTTGGTATTGGTATTTCTGATCATATAATCCAAGTAGGAATGAAAAATATACTTACAAAAAATGGCACGATGATATATGAAATGGATATTGACCTTCTTCATCATCTACAGCTAACTCCACACTCTTAACACATTCTCATCTCAAATATATACCATTTTTTGTCTTCAAATAGCTGGGTGGAGGATATAGTTTCCCTACTCCTCTAGCTCATTTTGACCCAACTTCTCATGCAGACATGAACTACGCTTCCATATTCGAAGAACATGCGGCTCATACTCCAGCAGCCATGCCAACAATGCGAACACCAGGAACATACTTAAGGACTGATTCCGTTGTAGTGCCTGGAGGACAGATAGCTCACTTTAAAGATATCATGGAGCATTCTTCAGTCCGGACAACTGAGTTCACACCAATACAGGGTACGATGGTCAGAATATCGTCACAGGAGTCGTCGCTTCCGCCATCGGCACAGCTTACTAGGCTTCAGAATTCTCAGGTCAGTTCGGAATCCTGTGGTGAGACTCAGCAGGTTTTTCCAGACATGCATGTGCTTATAACTTGCCGATGCCACAATATGAATACTGTGCAGGGAGAAGCTGTGAGGGAGAATAGTTTTCCTCCCTTGGGGGCGATGAACGCTCTCATGAAAACTGCATCAGACAACTCATACGAGGGCATGACTCATGCACAGGAGATACTCTGCAGGCCGAAGCCTGTTTTATCAGGCCCATCCTTCGCTAAGGTGGGAAGTCGTTGGAGACTAAATTCTTCTCCCATTCCAGTCTCTCCGAGCCCTTCTGACTTGGCCTCGAGCTTGAACATGGACAACACTAAAATAGATATTCCGCCAAAAAAGAGGACTGCGTCGAGACGGTCAAAATTTGACCCTCCATACGTCTACAAGTGCGTCAAAGGGAAACTTAGACGCGAGGAAACGGCCGAAAACTATAAAATTTTGAAATCCCTGATTCCGCGACCCATCAAAGTATGCTCCTTTACTATTCCTCATTTGACTTGTGCTTTGGACTTTTAATCTGTCTCTGGTCTTGTAGATTTTTAAATTCTTCTGGTGTGACTTAAATTATAAGGTCTGTGAACCCTCTTCACTTTACTGGTGGTTACATTTTCTGAGTAAGATATTTGAGCCTCAATGTACTTTCAGGTATGGAGTCGCGTAGTTTTAGTTGCACATAGGTAAGGAGCATTTATTCCAGGAAAAGGTACAATTCAGGAAGAAGTCAATCTTTAATTAATTTACTCGTGATCTGGCTGTCAAAGTCGAATATCAGTTATGTGCATACTTTTCGAGTACTGAAACAGCCACAGTTTTGAAACATCTGTAACACTTCCAGCTGTCACGTGCTTGGACAACAACAACTGACCAGATGGTTTCAGCATTAGATCGTACTCACTTGCGCTGTAGGTTCAAAGCTGACCATATGTGAGATTTTTTAAGCATTAAGATGTAGTCTGTAGAGGCACATATCATGCGCATCTCATTTTTTTTTCATGCACAGCGTTGTAAGTGTCCTCCAATCTCAGTTTAACACGCATCTTTAGATTCAACAATAACTTCGTATGTTCACGAGTCTCAAACGTACAGAAGGCTTGCATATTTATAACTCGCTACCCTCGAAAGATCCGACAATCTCTTCACAAGTTTCTCATTCACAAGAGCGCCCGGTCGAGCTCCATGAGTTCAATCATGATTCAATCCAGACTCCATACTTCTTTAATATAAATGAGTGACTTGATGTTTAACGATATCGAGGTGTTGTGTATCATCTCTCTAGACTTGAAGTGGTCTCACAGCTCATATATCCTGAGGGCAATACTGTTCGCCAATCAGCTCTCTTGTAAGCTTATATCAAGAGTATAGCCTGTCGGTCTTGGGTCCGAGATTCTCACTCATGGAGTCCCAGAATGACGACTGTTCAACTGTGAACGAAGAGATTCTGTTTTTCATGCAGGCAGATCGAGCGTCCATTTTGGAGGAGACCATAGCTCACGTGAAGAATTTGGGAGATCAGAAAGCAAGTCTCGAGAAAATAAAGCACGAAAAATTGAAGGAACTGTGTCAGCAGAGAGCGGAAAAGGGACAGTGTCAGGAATGGGAGATGAGTGGAGAGGCGAACTGTCTATGGATGAAGAGAACTTCTCGTGGAGGGACACAAGTGGATATCCGCATAGTTCAGAACGAGATCAGCGTCAGCGTAGTTCAGAAGCATCTGCCGAGGTTTCTCCTGCGCATGGTGACGGCTCTAGAATCAAAGCTCAAACTTGAAATTCTCAACGTCACAGGTCATGTCATTGACGATTTTGACGTTTACAACTTCAGAGTTGAGGTGAGATCTACTCCTTAAATTTCAGCCAAATTTTCTTTCTGTTCCACTCACTAAAAGAGTCGTAATCTGGGCCCGCTGACCTTCAAACAAATTGAACGATTCTACATACCATAGTTGGGAATTGAGCTTTGGCTGGTCTCATTTCACGTGTTACTCAAATCTAGGCCTAATCGATCAAAATATGGAGTTCATATCAATCTTGTTGCTCTCATGATGACCTTTGCTTATTCCTTCCCTTATTTCTTGAGGTTCGTAGAGATCTTATTCCATTTCTTTTCTCTCACTTGGTCCTTTGTCTCTTAACTACAGATCAAAGGCAGTTCATGCCCTCAAGCAAATGAGATTATGGCAAATATCATGGAGACCTTGGATTCAGTGTTTCTGAACCACGGCTGATTTTCACCAGAATTATGCGGTTGTCATAATCTTATCAGTCAGAAGCTATCAGCTGAAATGGAACTGCAGCTGATATTCCATTGCAGCAAACCTTAATATGGACTCGGATAGGTCACAAGATCTTTGGCATTTTCATATAACTAGAGTTTGAAATGTTTTCATGAAACATGTACGTAGTAATATGTTGAGAATTGGACAGAAAACCACAAGAAAACATATATTGATAGCTTGACAGG

mRNA

>Mapoly0021s0101.1
TCGTGCAATGCATGGTAGAAGCATGGACAGCTCACGGACATGTCTTAGAATTGCGGGTGTGACCAGCACACGTCGGTCTTGTAGCGGTCAGTATGAAATTAATTGGCGTTTTCATCCGGTCATGATTTATTTATATCCTTGAGGTTGCATCAGGATTTAAAAAAATGCTGGGAAACTTGTGGCCCCAAACCATTGCGCTCTCAGCTAAGAAGAATTACATTCCCACAAAGTGGCCACTTTGGATCCCAGAGTCTATGCCAAAATTCCATATCTGGCTTACTACCTTTCAAGTTCAGAACTACTACAATAACATGAAGCAGTCAAGAAAATAAAGAGTGCAGACGAGCAACAAATGCATCCCATGATCCTTGGATGTTTAAGAACTCTCAAGGAACGAAGACTATTTTCGAGGCGCAGTCAAACTCTCAAGCAATCCAAGTTTTTGGATCTGGAACTGAAACTCAAGGGCTTCTATTCACCGGTTTACTTTGGATCAAAGTCCAAGTCCCTTTCGTGAGATGTCGATGCTGGACCACAAAGAAACTGAAATTACGGGTGACAGAAGACATCAGTAGCACCACAATATTGTTGAAGGAGCTTGAATGATTTTGTCACCTACTGTATGAACCGGGAGATTCCAGAGAGCGAGAAGTGCAGGACCAGTATCATCAACTAGCACTCCATCTGCGAGACCCTTCATTCAGCTTTTTTGACATGAACTACGCTTCCATATTCGAAGAACATGCGGCTCATACTCCAGCAGCCATGCCAACAATGCGAACACCAGGAACATACTTAAGGACTGATTCCGTTGTAGTGCCTGGAGGACAGATAGCTCACTTTAAAGATATCATGGAGCATTCTTCAGTCCGGACAACTGAGTTCACACCAATACAGGGTACGATGGTCAGAATATCGTCACAGGAGTCGTCGCTTCCGCCATCGGCACAGCTTACTAGGCTTCAGAATTCTCAGGGAGAAGCTGTGAGGGAGAATAGTTTTCCTCCCTTGGGGGCGATGAACGCTCTCATGAAAACTGCATCAGACAACTCATACGAGGGCATGACTCATGCACAGGAGATACTCTGCAGGCCGAAGCCTGTTTTATCAGGCCCATCCTTCGCTAAGGTGGGAAGTCGTTGGAGACTAAATTCTTCTCCCATTCCAGTCTCTCCGAGCCCTTCTGACTTGGCCTCGAGCTTGAACATGGACAACACTAAAATAGATATTCCGCCAAAAAAGAGGACTGCGTCGAGACGGTCAAAATTTGACCCTCCATACGTCTACAAGTGCGTCAAAGGGAAACTTAGACGCGAGGAAACGGCCGAAAACTATAAAATTTTGAAATCCCTGATTCCGCGACCCATCAAAGCAGATCGAGCGTCCATTTTGGAGGAGACCATAGCTCACGTGAAGAATTTGGGAGATCAGAAAGCAAGTCTCGAGAAAATAAAGCACGAAAAATTGAAGGAACTGTGTCAGCAGAGAGCGGAAAAGGGACAGTGTCAGGAATGGGAGATGAGTGGAGAGGCGAACTGTCTATGGATGAAGAGAACTTCTCGTGGAGGGACACAAGTGGATATCCGCATAGTTCAGAACGAGATCAGCGTCAGCGTAGTTCAGAAGCATCTGCCGAGGTTTCTCCTGCGCATGGTGACGGCTCTAGAATCAAAGCTCAAACTTGAAATTCTCAACGTCACAGGTCATGTCATTGACGATTTTGACGTTTACAACTTCAGAGTTGAGATCAAAGGCAGTTCATGCCCTCAAGCAAATGAGATTATGGCAAATATCATGGAGACCTTGGATTCAGTGTTTCTGAACCACGGCTGATTTTCACCAGAATTATGCGGTTGTCATAATCTTATCAGTCAGAAGCTATCAGCTGAAATGGAACTGCAGCTGATATTCCATTGCAGCAAACCTTAATATGGACTCGGATAGGTCACAAGATCTTTGGCATTTTCATATAACTAGAGTTTGAAATGTTTTCATGAAACATGTACGTAGTAATATGTTGAGAATTGGACAGAAAACCACAAGAAAACATATATTGATAGCTTGACAGG

CDS

>Mapoly0021s0101.1
ATGAACTACGCTTCCATATTCGAAGAACATGCGGCTCATACTCCAGCAGCCATGCCAACAATGCGAACACCAGGAACATACTTAAGGACTGATTCCGTTGTAGTGCCTGGAGGACAGATAGCTCACTTTAAAGATATCATGGAGCATTCTTCAGTCCGGACAACTGAGTTCACACCAATACAGGGTACGATGGTCAGAATATCGTCACAGGAGTCGTCGCTTCCGCCATCGGCACAGCTTACTAGGCTTCAGAATTCTCAGGGAGAAGCTGTGAGGGAGAATAGTTTTCCTCCCTTGGGGGCGATGAACGCTCTCATGAAAACTGCATCAGACAACTCATACGAGGGCATGACTCATGCACAGGAGATACTCTGCAGGCCGAAGCCTGTTTTATCAGGCCCATCCTTCGCTAAGGTGGGAAGTCGTTGGAGACTAAATTCTTCTCCCATTCCAGTCTCTCCGAGCCCTTCTGACTTGGCCTCGAGCTTGAACATGGACAACACTAAAATAGATATTCCGCCAAAAAAGAGGACTGCGTCGAGACGGTCAAAATTTGACCCTCCATACGTCTACAAGTGCGTCAAAGGGAAACTTAGACGCGAGGAAACGGCCGAAAACTATAAAATTTTGAAATCCCTGATTCCGCGACCCATCAAAGCAGATCGAGCGTCCATTTTGGAGGAGACCATAGCTCACGTGAAGAATTTGGGAGATCAGAAAGCAAGTCTCGAGAAAATAAAGCACGAAAAATTGAAGGAACTGTGTCAGCAGAGAGCGGAAAAGGGACAGTGTCAGGAATGGGAGATGAGTGGAGAGGCGAACTGTCTATGGATGAAGAGAACTTCTCGTGGAGGGACACAAGTGGATATCCGCATAGTTCAGAACGAGATCAGCGTCAGCGTAGTTCAGAAGCATCTGCCGAGGTTTCTCCTGCGCATGGTGACGGCTCTAGAATCAAAGCTCAAACTTGAAATTCTCAACGTCACAGGTCATGTCATTGACGATTTTGACGTTTACAACTTCAGAGTTGAGATCAAAGGCAGTTCATGCCCTCAAGCAAATGAGATTATGGCAAATATCATGGAGACCTTGGATTCAGTGTTTCTGAACCACGGCTGA

Protein

>Mapoly0021s0101.1
MNYASIFEEHAAHTPAAMPTMRTPGTYLRTDSVVVPGGQIAHFKDIMEHSSVRTTEFTPIQGTMVRISSQESSLPPSAQLTRLQNSQGEAVRENSFPPLGAMNALMKTASDNSYEGMTHAQEILCRPKPVLSGPSFAKVGSRWRLNSSPIPVSPSPSDLASSLNMDNTKIDIPPKKRTASRRSKFDPPYVYKCVKGKLRREETAENYKILKSLIPRPIKADRASILEETIAHVKNLGDQKASLEKIKHEKLKELCQQRAEKGQCQEWEMSGEANCLWMKRTSRGGTQVDIRIVQNEISVSVVQKHLPRFLLRMVTALESKLKLEILNVTGHVIDDFDVYNFRVEIKGSSCPQANEIMANIMETLDSVFLNHG

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>