Mapoly0022s0028



Description

TELOMERIC REPEAT BINDING PROTEIN

Reference DB

Database ID Description
GO GO:0000786 Nucleosome
GO GO:0003677 DNA binding
GO GO:0003682 Chromatin binding
GO GO:0005634 Nucleus
GO GO:0006334 Nucleosome assembly
OrthoMCL OG5_146829
PFAM PF00249 Myb-like DNA-binding domain
PFAM PF00538 Linker histone H1 and H5 family
PANTHER PTHR21717 TELOMERIC REPEAT BINDING PROTEIN
PANTHER PTHR21717:SF15

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB8 transcription factor, MYB Mapoly0022s0028.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0022s0028.1 scaffold_22:238050..244120  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0022s0028.1  

Gene structure:

mRNA scaffold_22:238050..244120  ( + strand )
five_prime_UTR scaffold_22:238050..238380  ( + strand )
CDS scaffold_22:238381..238530  ( + strand )
CDS scaffold_22:240304..240533  ( + strand )
CDS scaffold_22:240939..241023  ( + strand )
CDS scaffold_22:241335..241418  ( + strand )
CDS scaffold_22:241769..242195  ( + strand )
CDS scaffold_22:243478..243527  ( + strand )
three_prime_UTR scaffold_22:243528..244120  ( + strand )

Sequences:

Gene

>Mapoly0022s0028.1
CTACCCAATTCAGCTTTGTGCTTCGGGGTTTCGACCCTTCCTCGCCAGTTAATGTCTCACGTCTGCAGGGGGTTTCTTTTGCACCACGAAGTATGTACACAACATGATGACTCAGTCGAAGTAATATCGAGCGGTAGAGTTTCGGATGCTTCACGAAGGACAGCAATGGAGACGCTCAAGCCTTAGTACAGTGTTAATGTAGACGCTGTGGATTTTTTCGGGGGGAGTTCCATGTGTATCTTGGTGACATGAAAAGAGTTCAGACTGAACACGTGATTGGGATCTTACGAAGCTAGCTCTAAATCGAAAGAGGAAGGGTGTATTCAAGGCAATGGGTGCTCCCAAGCAAAAGTGGACGGCCGAAGAGGAGGCTGCCCTCCGGGCCGGAGTTGAGAAGTACGGACCTGGAAAATGGAGAGCGATTCAGAAGGATTCAAAATTTGGGCCTTGCCTAACATCTCGATCAAACGTAGACCTAAAGGTACATGATTATTCACTCCTGCGTTGAAACATATCTTTTGTTACATGATTTGACTTCACACTGCGGCCTAGAATGCGAGCGATTGTGAAACAGTGCTGTAATTCGTAGGAGTCTCGAGGGCGGCATTTTGGACAGAGACCTGACTCTTTTCGTGCACAGGGGTCGAGCATATGTCACTGCGCGTTTCTTGCTTTACTGAGTTTATTTTTTCCACGACTCTTTCCCTCTTGCATGACGATGTTCGCTCTCACGCTTACAGAGCCTCAACGTGCATCATGTATAACGTGTTCAGTGCCTCCTTGCTTCTGTATCCCCACGTCTGTTATCCTCATGTTTAGTATGAATCGGAGACCTTCCAGATCTTCTTTGTATTGAGTTTTGTGACCTTGACCGGATGGGTTCTTACGGGAACAGCTGGTTATATCTTAAAGGCCTCCCTGGCGTCCCTGTGCCTATGGATTCAGTTACCGAGTCGAGAGTGTCTCTCAAGTTCTTTCTAATCTCCTGACCGGCTATTTAGTGCACGGGTAACCGAAGATGCGTGGCAAGGTTGCACCCGTGTACCCTAATTGCTTACTTGTGATCATCATCAAATTTAAATTGGAGGTAGTGGGGATGAAGAATTCACGGTGATCTAGCTTGTGCTAGAGCAATCCTGAAGCGAACTTTTCTATATGAGGTTAGGGGAAGTAACATTTGTAACGTATCGTTGCTCTTTAGGTCGATGTAAATGATCGGCGAGGCCGAAGGTTACTGATCCTCGTGCGCAAGGATGTATAATTGTTGGCTTCTGAATTAAAATTTGAAGCAACGATGCATATTTAGCACACGTGCCCTAGTTTTTTTACACAGATGAATTCGACGATCCTCCTAGTTATTCCTTAATTGCACGAGGGGCTCACAATGCGCGCTGCAGTACTAGGCTTGAACTTCCAGAGCTTTGGCTTGGCCCTGGTTAGCAGCTATGCTAGGTAGCAGTGCAGTGTGCATCCTGTTTATGAACACTGTACTTTTACCTCGCTCGACTACGTGGTAAAGATTCGTAGGTGGGGTACTCTTTGATGACCCCGTGGAATTTTGTCACTGGAGGGTGATGGATATTGCGCCTCGGATTGCACCTCTCGATGCATCCTGCACTGGTGGTCTGCTCAGTCTGTTGTAGCCTCGTTTGGGGCACTTTTTTCATGTCATGCCGCCGTTGATGTCTTTCCCAATCTGATACGAATTGAAAGTAGAATTTGTCTCATGGAAAACTTTTAGGTTGGCTTTTACGGTCAAAGCTTAAAAAAACTTTCAATTTTCTCTTAACCTTGCCTCGAATTCCACCCGAACGTCAAAAACTTTCAAACCTTTCACTTTCAGACTAGTAGTTTACTTTCTGTCACTAGTTCACTGACACAAACTTGAGTCCAAACAAGGAAACTAAATTTCCGAAAAACTGTCTCCTTAACCGGGACTTCTGTCTGAAAACCGTCACAGAATCTGTCATAACTGTCAATAACTGTTAGAAAAAACGCTCTGACAGCATCAGCAAGTATGATCATTCATTTTGGGGTTTACCCGTGATCTGTTCTTCTGTTCTCGCGTGCGAAGCACTACGGTTTATTGCTTGCAACCTGAATATAAGACTAACAGAAAGCAACAACGACTCGTAGCTGTCCATTGACGTTTTTGGAAATCGGAGATTCTAGGGTAGAAACTTTTGATTTCTGACCTCTAAGAGTTCCTCGTGTCATCTCACGCGAACCTGCTGTGTGGTTTGGATGTTTGCAGGACAAATGGCGAAATATGAGTGTAAGTGCCAATGGCCTGGGGTCCACAAGGGAAAGGAAGTCCTTGGCCTTGACAGCTGGGTCAGGTCTGGTGACTTTGATGGAGGAAGCTGTTGCCGTCAGCCCTTTGCAATCCGTGTCTCCAGATGGAGTGTCAGATTCCAAGCCTCTGCTTGTCACAATGTCGGGGCCGGGTCACAAAACAGCGGATCGAAAGTCACTTGGACCAAGGTAATCTACATGACGGAAGACTTTGGGGACAAGCTGATTGTGATGGACCTGGGAGACTGACATTTGGGGATTTCTTCAAGAATAGTGTTCGAGTATACTTTGTGTTTCTGATCGTGTATATTTCTACGTTTTCCACGTTAGTGGACTGCTTTGCTTTCGTAACTCTGTTTTGTTATCGTGCATTTTCATCGATTTGAGCAACTCATAGGAAGACGTTGCGTGATGTGGGAAGAAATTTTTTACCCATGGTAGCTCGTGTATATGTGCCGCATTGTATGCACTTGATATCTACCTGTAGTAACGTCTCATATATATTATATACCATACCTACCTATATACATATATATACCATACCTACCATGTAGTAACATATGGCAGTATATGTTAACACACCTGTGTTTGCAGATATGATGATATAGTTGTGGAGGCTGTGCTGGGATTGAAGGATCCCAATGGTTCGAGCAATGCCTCAATTGCCAGCTATATTGAGGTAGAGTATGAAGCTGGTCGGGTGTACCGTTCGCGCTAATTTAATCCAAGATATACGATGTGCACATTCTTTACGAGTGATACGATTTGTGTATATTCTGTTTCATGAAATCTGAAGTTGTTGTACTGCATGTACTTCATCATCCAGAAGAATCTTAATACCAAATGAATTTGACAGCTAGTCAGTCATTTGAGTCAGAGGTGGTTTGATTTCTAGTGTACTTGTTAGTGGCTAGGGATAGGGGAGTGAGTGAGAGAGCTGTATACTTAGAGAAAGATGGTCTACATTATGACCGGGGGACTGTTTTGCAGGAACGCCATCCAGTGCCTTCCAACTTCCGAAGACTACTAACTTCAAAATTGAAGGCATTAGCAATGCAGGGGAAGCTTACAAAGGTTGGCCCTCATTTGGGACTCACATGGCCCCATATAGCTCTATGCTTGATTGGTTGGTCTGTGAAATAGTCACACCTTTTTAGAACTAATTTCATTAGAATGATCTAGGAGAGACGATGGCCACCCTACTTTACGCATGTGACATTTCATAGCTGGCTACATTTGGTAACGAATCCAGTTGAGCAATGTTTTAGGCATTATCCACTCGTTACGAATGCTGTTCTCCTGTAAGTTGGGCTGTAGTTTGCAAGTAAATAATGGTAGAATTCCTTGGTTCATGGTCTTCCTGTATCCGAGGAGATCTTTATGTTTTTTCCGAGCCGTTGATTGTTGTTGGCATATGATAACAGGTGAAGCAAAATTACAAAGTCAGCAATGGCAACGTTAGTGACTCTCCATCAGATGGAAGGCCAGTCAAGAACACTAGACCAAGAAGACCGGAAGGTGCTCCTCCTCCTCCTCCTCCACCACCTCCTCCCCCTCCCGCTGCTGATGAAACTCGACGAACTCCTCGGTATCCTCGAGATCCAGCAAAGACCATGAGAGGTGCAGTTGGGATCAAGAAGCCAAAAATAGTTGATGCCGAATTTGCTCGAACGAAGATGAAAACAGCGGAAGAAGCTGCACGTGCTGCAGTTCAAGCGGTTGCAGAGGCTGAGGCGGCTGCAGCAGCTGCAGAGCAAGCAGCTCGCGAAGCAGAACAAGCAGAAGCTGACGCAGAGGCAGCGGAAGCCGCAGCGGAAGCGGCAGCTGCAGCCATCAGACCACCCAAGAAGTGTAAGTCTGGTTGTCTAACCAGTCCTTTGTATGCCAGTTGTGCGACTCGGTGATCATTTCTAGTATATCGGTGTTGGCTGTAAGCCCTGTCAATAAGGGTTGAAGGGAATACACAGATGGGAAGGAAAGGGGATTCAATTTGTGCATGAAGTTTACCAGCCAGCAAGTTATAAGTCTCGTTGATCTGCAGAGCAAGCATTGCAGAATTCTTGTGTTTCACTTAATTGGAAGTGAGGTATATATTTTCATGTCTTATCCAGTCTGTATTCTTGGAAATATGAGTTGTACATATTTCAGGATGCTGCTCTCCAGTAGTTGCTCATTCAGTTGAGAGACTTGTTTCGCAACAAATCACAAGTTACTTTTACCCTTCATTTTACTGCTCCCACCTCCAGAATTGGGATTATTCGCCTACAGAGAGCCGTTTCTCTGGCGGTTAGTTCGTTAAAACAGAATAGTTGTAAGCGAGCTTGTAGATGACATGTAGTGGCCTAAAGTATGTCCTGATCTAATTGAATGCTTGTTTTCCTGGGCTGTCCGCCGGATTTCTTGGTTGCTGAGTCATGATAACGGACGAGATTCTTCTGGTACTAGTTGCGATATGAAATATCCTCCATTATGCAGAGTTAGTTTGTCTTGACTTTCTGCTATCTACGGGACTGCTGGCTTGTTTATGCAAGAACGTAGGCCGGGTATTGGTGGAACCCATGTCCACCTTTTTATAAGGTTTACATGGTTCATTTTCACCCAGTTGGATTGTGTTCTGTTGACGGTCAAACTGTTGAAATTTTGAACTTGTTCTTACAACTTATAACGTTTGATGCCCTTTCTTGGTGATCTTCAAGTCACATGGGCAAATCTGTTTGTCGTGAGACGGATACGTATCAATCGACGTGGTGGCGAGGGTGTGAGGTGCTAGGTTCTTGTTAGCTTTAGTGCAGTGAAAGTTGAATGGACATAACGGTATATATTTATGGACCTTGTTGTCCTTCATGATATTACATATTGCTTCCTGTTTAATTTCTTTCAAGAGTTCTTCCAGTTTAATTTTGGCGGCTGTTAACTCCAGTAGAGTCATGAGATGGCACGACATGTTGGTTGCTGACCACCTGCTATACATGCTTTTTAGGGTATTTTTTCCTTGTTAAGGGTAACTATGAACACATACATGGTGCATCTGATGGGTGGTGACTCTCAGATTTTGCTTGCTGGTATCCAAGAAAGCCGTGGCAATAGCTGATACGATTGGGTGCTAATCATTTGGCTGGGTGATGTGCAGCAGTTAGAGCAATGGCTATGGCTCGGGCAGAAGAAGTGTCTGTCAAAGGGTAGTTCCCTCAGCTCCTTCATAAGAATGGGGTCACATCCATCGGCATCAATTGCTCATTTTGGGAAAAGAATCAAAAGGCCCAAAACTGTATTGTAGCACTACACCTGGACCTGTGTCAATATAGATTCTTCAAAGCTCCTAGGAAAGAGAAATTCATTCTATTTTCGTAGACCCTGATGCGGAAGGGTTCCCTTTGATGCTCTGATTGTATCATTACTGATAATATCTGTAAAATCTAAGCTCCTCTCCCTCACGTTCTCCATAGCAAAGCCACCACAGTTTCTGGGAATACTTGCCGTCATGGTGGTTTTGAGGTTTACGAGATTTACGATGCTCAGCATATCTCCTCTCCGCCAGGTAATGATCGAATCCAAAGGTTTGCTCCTATCATTGTTTCACGTGTGCCCAGGCGTTGATCCATTTGTATGGAGACCGCTGCATGGCCACACCGTGTGAAAGCAAACGAGGGTTCTCGGGGCGTGCGAAATTAGTGTATAGATCAATGTACAAAATCTTGCCGTGAAACGTGTAGGAATCACCGAGATCGTTTCCACGAATAGCAAGAAGTTTAACAAATGCGTCCTGTCTCAAACTT

mRNA

>Mapoly0022s0028.1
CTACCCAATTCAGCTTTGTGCTTCGGGGTTTCGACCCTTCCTCGCCAGTTAATGTCTCACGTCTGCAGGGGGTTTCTTTTGCACCACGAAGTATGTACACAACATGATGACTCAGTCGAAGTAATATCGAGCGGTAGAGTTTCGGATGCTTCACGAAGGACAGCAATGGAGACGCTCAAGCCTTAGTACAGTGTTAATGTAGACGCTGTGGATTTTTTCGGGGGGAGTTCCATGTGTATCTTGGTGACATGAAAAGAGTTCAGACTGAACACGTGATTGGGATCTTACGAAGCTAGCTCTAAATCGAAAGAGGAAGGGTGTATTCAAGGCAATGGGTGCTCCCAAGCAAAAGTGGACGGCCGAAGAGGAGGCTGCCCTCCGGGCCGGAGTTGAGAAGTACGGACCTGGAAAATGGAGAGCGATTCAGAAGGATTCAAAATTTGGGCCTTGCCTAACATCTCGATCAAACGTAGACCTAAAGGACAAATGGCGAAATATGAGTGTAAGTGCCAATGGCCTGGGGTCCACAAGGGAAAGGAAGTCCTTGGCCTTGACAGCTGGGTCAGGTCTGGTGACTTTGATGGAGGAAGCTGTTGCCGTCAGCCCTTTGCAATCCGTGTCTCCAGATGGAGTGTCAGATTCCAAGCCTCTGCTTGTCACAATGTCGGGGCCGGGTCACAAAACAGCGGATCGAAAGTCACTTGGACCAAGATATGATGATATAGTTGTGGAGGCTGTGCTGGGATTGAAGGATCCCAATGGTTCGAGCAATGCCTCAATTGCCAGCTATATTGAGGAACGCCATCCAGTGCCTTCCAACTTCCGAAGACTACTAACTTCAAAATTGAAGGCATTAGCAATGCAGGGGAAGCTTACAAAGGTGAAGCAAAATTACAAAGTCAGCAATGGCAACGTTAGTGACTCTCCATCAGATGGAAGGCCAGTCAAGAACACTAGACCAAGAAGACCGGAAGGTGCTCCTCCTCCTCCTCCTCCACCACCTCCTCCCCCTCCCGCTGCTGATGAAACTCGACGAACTCCTCGGTATCCTCGAGATCCAGCAAAGACCATGAGAGGTGCAGTTGGGATCAAGAAGCCAAAAATAGTTGATGCCGAATTTGCTCGAACGAAGATGAAAACAGCGGAAGAAGCTGCACGTGCTGCAGTTCAAGCGGTTGCAGAGGCTGAGGCGGCTGCAGCAGCTGCAGAGCAAGCAGCTCGCGAAGCAGAACAAGCAGAAGCTGACGCAGAGGCAGCGGAAGCCGCAGCGGAAGCGGCAGCTGCAGCCATCAGACCACCCAAGAAGTTTAGAGCAATGGCTATGGCTCGGGCAGAAGAAGTGTCTGTCAAAGGGTAGTTCCCTCAGCTCCTTCATAAGAATGGGGTCACATCCATCGGCATCAATTGCTCATTTTGGGAAAAGAATCAAAAGGCCCAAAACTGTATTGTAGCACTACACCTGGACCTGTGTCAATATAGATTCTTCAAAGCTCCTAGGAAAGAGAAATTCATTCTATTTTCGTAGACCCTGATGCGGAAGGGTTCCCTTTGATGCTCTGATTGTATCATTACTGATAATATCTGTAAAATCTAAGCTCCTCTCCCTCACGTTCTCCATAGCAAAGCCACCACAGTTTCTGGGAATACTTGCCGTCATGGTGGTTTTGAGGTTTACGAGATTTACGATGCTCAGCATATCTCCTCTCCGCCAGGTAATGATCGAATCCAAAGGTTTGCTCCTATCATTGTTTCACGTGTGCCCAGGCGTTGATCCATTTGTATGGAGACCGCTGCATGGCCACACCGTGTGAAAGCAAACGAGGGTTCTCGGGGCGTGCGAAATTAGTGTATAGATCAATGTACAAAATCTTGCCGTGAAACGTGTAGGAATCACCGAGATCGTTTCCACGAATAGCAAGAAGTTTAACAAATGCGTCCTGTCTCAAACTT

CDS

>Mapoly0022s0028.1
ATGGGTGCTCCCAAGCAAAAGTGGACGGCCGAAGAGGAGGCTGCCCTCCGGGCCGGAGTTGAGAAGTACGGACCTGGAAAATGGAGAGCGATTCAGAAGGATTCAAAATTTGGGCCTTGCCTAACATCTCGATCAAACGTAGACCTAAAGGACAAATGGCGAAATATGAGTGTAAGTGCCAATGGCCTGGGGTCCACAAGGGAAAGGAAGTCCTTGGCCTTGACAGCTGGGTCAGGTCTGGTGACTTTGATGGAGGAAGCTGTTGCCGTCAGCCCTTTGCAATCCGTGTCTCCAGATGGAGTGTCAGATTCCAAGCCTCTGCTTGTCACAATGTCGGGGCCGGGTCACAAAACAGCGGATCGAAAGTCACTTGGACCAAGATATGATGATATAGTTGTGGAGGCTGTGCTGGGATTGAAGGATCCCAATGGTTCGAGCAATGCCTCAATTGCCAGCTATATTGAGGAACGCCATCCAGTGCCTTCCAACTTCCGAAGACTACTAACTTCAAAATTGAAGGCATTAGCAATGCAGGGGAAGCTTACAAAGGTGAAGCAAAATTACAAAGTCAGCAATGGCAACGTTAGTGACTCTCCATCAGATGGAAGGCCAGTCAAGAACACTAGACCAAGAAGACCGGAAGGTGCTCCTCCTCCTCCTCCTCCACCACCTCCTCCCCCTCCCGCTGCTGATGAAACTCGACGAACTCCTCGGTATCCTCGAGATCCAGCAAAGACCATGAGAGGTGCAGTTGGGATCAAGAAGCCAAAAATAGTTGATGCCGAATTTGCTCGAACGAAGATGAAAACAGCGGAAGAAGCTGCACGTGCTGCAGTTCAAGCGGTTGCAGAGGCTGAGGCGGCTGCAGCAGCTGCAGAGCAAGCAGCTCGCGAAGCAGAACAAGCAGAAGCTGACGCAGAGGCAGCGGAAGCCGCAGCGGAAGCGGCAGCTGCAGCCATCAGACCACCCAAGAAGTTTAGAGCAATGGCTATGGCTCGGGCAGAAGAAGTGTCTGTCAAAGGGTAG

Protein

>Mapoly0022s0028.1
MGAPKQKWTAEEEAALRAGVEKYGPGKWRAIQKDSKFGPCLTSRSNVDLKDKWRNMSVSANGLGSTRERKSLALTAGSGLVTLMEEAVAVSPLQSVSPDGVSDSKPLLVTMSGPGHKTADRKSLGPRYDDIVVEAVLGLKDPNGSSNASIASYIEERHPVPSNFRRLLTSKLKALAMQGKLTKVKQNYKVSNGNVSDSPSDGRPVKNTRPRRPEGAPPPPPPPPPPPPAADETRRTPRYPRDPAKTMRGAVGIKKPKIVDAEFARTKMKTAEEAARAAVQAVAEAEAAAAAAEQAAREAEQAEADAEAAEAAAEAAAAAIRPPKKFRAMAMARAEEVSVKG

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>