Mapoly0022s0095



Description

CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
OrthoMCL OG5_149839
PFAM PF00170 BZIP transcription factor
PANTHER PTHR22952 CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED
PANTHER PTHR22952:SF114

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP7 transcription factor, bZIP Mapoly0022s0095.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0022s0095.1 scaffold_22:869908..873684  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0022s0095.2 scaffold_22:869908..873806  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0022s0095.1  

Gene structure:

mRNA scaffold_22:869908..873684  ( + strand )
five_prime_UTR scaffold_22:869908..870091  ( + strand )
CDS scaffold_22:870092..870711  ( + strand )
CDS scaffold_22:870969..871201  ( + strand )
CDS scaffold_22:871833..872244  ( + strand )
CDS scaffold_22:872715..872778  ( + strand )
three_prime_UTR scaffold_22:872779..873684  ( + strand )

Sequences:

Gene

>Mapoly0022s0095.1
GATCGGTTTCGTGTGTTTGCTGGCGGTGAAAGCAGCGTTTGCGTCTGTGGCGCGTGGTGGCGTGGGGATTGTTCGTTCGTCCGAAGCGTCTGCTTTAATCTGCGCTCGGAGGAAAGCTTCCGTGATCAAAGTTACCGTCTTCTATGCTGTGTTCGAGAAAGGGGTTGTTTCTTCTTCCCCGTCGATGGAGGTGACAAACGAGCTTCCTTGTCGAGAATTGGATTTGAGTCTCGAGGACGTCTTGGAGTTGTTCGTGGATTCCGAGGAGCCTTTCGATTCTGAGCCATGGGATTTCTCGCAGTCTCTTCTGCCTCCTTCGCCTGGATTTTTCTCTTTTGACGAGGCAAATGGTTGGGAGATCAAGGACAGATCTGAGATTTGTCCAGAGTCCGGCGGCTGTGAGAGCCTGGAGGCGACACAAATCATCGCTAGTGATGAGTTTCTTGTCGACGATGGGCGTTTGGGAGTTTCGAGTCCTGTATCTTGTAGCGGGGCCGAATTGGGAAGTAACCTAGTTGCGACCTCTCAAGTCGAGACCAGACCGTACTGTTCCAACAGTTCCGAAGGAACAAGCCACTCGGAACTGAATCAAGGGGCTCTGGATCTTGGCCGCTCAAATAGCAATCTGCATTGTGACAGCTTTCTAGAGCTGAAGTCGCTTAGCCCCGAGTCGGGCTGTACCAGTTCTGACGAGCAAGTGCAAGGCAGAAGCTGCAATAACTGTCCAACTCAGTCTGGAGATGCGACAGCAAGTGGGGAGGATGTTACGGGCACTGTGGACGAAGACACGAAGAAAAGAATAAGGTTTGTGGCCTTTTCGAGACTTTTTTGTACCGCACGCAAGCGTGTATGTATTTTGAGTTAATCATTCAATCGATCGGAAGTCTAGTTTCTGGTGTTTGTATGACTTATTTTCGACCGAAGGGTGCAAGACTGATGACACTCTCCGAGACATTTCCACATGCTGCACCAAAGTAGAATGTACTGCATCATTGTAATGTTAATTGTAATGTCAATATGATCTTAGTTTGGGTTTCTAATAAGTTGGTTTGAATGTTCAGACTCATGAGAAATCGAGAGTCAGCTACGCAATCACGATTGAGAAAGAAATCGTATGTAAAGGAGTTGGAAATGAGGTACCGGATGTTGGAAAGCCATTGCTCAATTCTTCAGCAAACGGTCGCCTTCACTTCTCAGGAAAATATCTTATTGAAAGAAGAGCTTAACAAGATTAAATGCTCAAACTTGAATGGATCCAAGTCTGGCGTGGTGGAGCCTGCAGCGCTACCAAGTGGTAAGTTCACTGACATGCTTACCTTGATCATGGTTGTCGAGAAGGTCCAGCTAAATGCATGTCACTGCTCAACTTGTAGTGTGCTTAGGCCCAATCATTCACAGAAGATTAGGATTATGCGTACACCCTCACCATCAAAATCGTGAAAATTATGACTAGTTTACACTGAACGAAGAATCTCCTCTGTTGAGTATCATATTTGCTCTGTGCGACTATATAGTATATGTTTCACAATATACCAACACTTCTCTTTGAACCGTATGTATCGCATTTGTCAAGACTATTTGGGTCATCAATAGATTGGGTCAAACTGTTATGATTTACATCCTAATCAGTGTGTACAGTTGGAGTAGCCGTGTGAATACTAAGGTCAATCTAGTGAATATATCATACGCTCCCCACACTTGTCCACAGTTCTCAGTCCAATAAGTATGTTTCCAGCATAGACTCAACCCAGTGTAAATTTTACTGAATGAGAATGTATTAATTACTTAAGATAGTGTGGGCTACCTAAAAATAATGGTCGGGGCCCTACATTTTGGCCTTCCCAGTCAGTGTGAAGCACATTAGCGGTCGTGTGTGAAGAAAAGGTTTTTTTGATTTTAACATGTTTCGGTGTTTTGTTTTCCAGACTCCCTGCCGTCGGAGTCCCCACCCTGCCTTACTGCATCGGCCCCATTTCGTTTGGACAACTGGGAGCTTCTCGCGTGCCTTTACCACGTCTTGCTTCTCACTCTGTTGGAAACCAAGGCACAAAGCCGAGCAAGAAGAGGAGACGGCGAGAGGCGACCGTGGGTCCGGATTAGGAGATGTCAAGTCCTATGGTTATCACCTATTTTGATCAATCTTGTTAGCCTGGGAAGGCTTAGGTCGCAAATGATGTCGGTGACAAGAAAATTGTCTTACTTCTCCACCCGAGCTAAAAGGAGAAACTTACTCGATATCACCCATATAAAATCACAATTCTCCACGTGTGTTCGACAACACCAGCACTGCGCGAAGAGCAGTAAGAAGTTGAGAAAGAGTGGTAGGCATCCGAGGAGGTATGGTTATCACATCCGGTAGGGGAAGCTTTCCTCTTTGTATACTTATTCAACCTAGCAGAATAGCATTCTTTCAAGCCCCACTCGAGGGACTGACTTGAGTAGTCTCGTAGATCTTCAGAGGTTTCGTGTTTTTACCACTGTAATAAACCAGGACATGCGTCCTTATACTAATACAGCAGCAGGTTAAGGAGAGTAATGAGTTGCGCTGTGACCACTCGTTGCTCCTCAGGTAGGTTTTAGCACTGGAAATCTTATTGGTCTCTTCATCTCATTTCTTGTCTCGAATTTGATGTCGAAGGTAGCTCTCATCATGGTGTCCGGTGAGTGACTTTTTTGCCTATGTACAGATGGAATGACTTGGTAAGAAGGTAAGTAACCTGGACGTCGAGATATTGCGTGGAATGTTAGGGAGTGAAGACTGTTGGAATACGGGATGGTGATTTTCGGAGATAATTTGCATTTTGCAGAACACAAAGTGATTATTCAGTATGGGGGGAAATCGCTATGCGAGGGTTAGTTTTCTTCCCTTGAGTTCATCCTCTTAAGTGGAGTGTATTTTGAGAGACTTTGTGTGAGAATTTCACACCAGGTCTCTCGAAATGCATTTCATTCAACTCGGGTTGAGGAAAGGTACGAGGTTTGAAGTTTACAGAGGCCACAAGAACGTGTAATTGATTTTTACACAAAGTTTTAAATTGGAGCGATGCGTGAGACATTTTCTTGTCACTGCGATTTCGAAGTATACTTAAACGATCCTATGTTTACAGGTTGCAGTTAAAATAGCTGAACTCTAAACCTGTACAGAACCACGGGAAGGAGAAAAGTGTACATACGGAGTAACACGGGAGGTAAATTGATGTATTGGGAAACTGATTATGATGAGTTTTTGGAGAATGCTATCATATCAGTGGTATGTGTGAGGTGAAAGAGGTAAACCAGACGGTTCTCATGTGAGGTGGAGTTTTATCAAAGCCATCCTTACTTCAAAGTTGTGACTATGCTTGAGATTGTATTTGGAGGACATAATTAAAATGTGAAGGAGTTATGTTTGGGTTGAAGAAGGTCAGAAAAGAAAAAACGAACTCAAGCTTGTTCTTCGACCCACTCACTTTGAGAAGTCCAGTGCGGATGAAGAAGTGAGGGACCGTCTTGGAGGAAGTGGTAACGGAGGAAAGCTACGTATGCGGCACGTTGATGACAAAGCAGAATTATTCAAACCAAAAGTTGAATCTGCGGAAGAAGTGAGGTCCTTTTTCTTGCGGACGTTGACACGCAGTCACGAGTAATGTTGAGACTCTTAATACATGAAGAGAGTCTTTTGTTCAAAAAGTTAGTTGAATCATCGCTTCATATAAATATGTAATTGTGATACAAATGTAAATAGTCAAGCTGAAATTCTAGAAAAACGAAAGCATACACATGGTCTTACCTAGCCAG

mRNA

>Mapoly0022s0095.1
GATCGGTTTCGTGTGTTTGCTGGCGGTGAAAGCAGCGTTTGCGTCTGTGGCGCGTGGTGGCGTGGGGATTGTTCGTTCGTCCGAAGCGTCTGCTTTAATCTGCGCTCGGAGGAAAGCTTCCGTGATCAAAGTTACCGTCTTCTATGCTGTGTTCGAGAAAGGGGTTGTTTCTTCTTCCCCGTCGATGGAGGTGACAAACGAGCTTCCTTGTCGAGAATTGGATTTGAGTCTCGAGGACGTCTTGGAGTTGTTCGTGGATTCCGAGGAGCCTTTCGATTCTGAGCCATGGGATTTCTCGCAGTCTCTTCTGCCTCCTTCGCCTGGATTTTTCTCTTTTGACGAGGCAAATGGTTGGGAGATCAAGGACAGATCTGAGATTTGTCCAGAGTCCGGCGGCTGTGAGAGCCTGGAGGCGACACAAATCATCGCTAGTGATGAGTTTCTTGTCGACGATGGGCGTTTGGGAGTTTCGAGTCCTGTATCTTGTAGCGGGGCCGAATTGGGAAGTAACCTAGTTGCGACCTCTCAAGTCGAGACCAGACCGTACTGTTCCAACAGTTCCGAAGGAACAAGCCACTCGGAACTGAATCAAGGGGCTCTGGATCTTGGCCGCTCAAATAGCAATCTGCATTGTGACAGCTTTCTAGAGCTGAAGTCGCTTAGCCCCGAGTCGGGCTGTACCAGTTCTGACGAGCAAGTGCAAGGCAGAAGCTGCAATAACTGTCCAACTCAGTCTGGAGATGCGACAGCAAGTGGGGAGGATGTTACGGGCACTGTGGACGAAGACACGAAGAAAAGAATAAGACTCATGAGAAATCGAGAGTCAGCTACGCAATCACGATTGAGAAAGAAATCGTATGTAAAGGAGTTGGAAATGAGGTACCGGATGTTGGAAAGCCATTGCTCAATTCTTCAGCAAACGGTCGCCTTCACTTCTCAGGAAAATATCTTATTGAAAGAAGAGCTTAACAAGATTAAATGCTCAAACTTGAATGGATCCAAGTCTGGCGTGGTGGAGCCTGCAGCGCTACCAAGTGACTCCCTGCCGTCGGAGTCCCCACCCTGCCTTACTGCATCGGCCCCATTTCGTTTGGACAACTGGGAGCTTCTCGCGTGCCTTTACCACGTCTTGCTTCTCACTCTGTTGGAAACCAAGGCACAAAGCCGAGCAAGAAGAGGAGACGGCGAGAGGCGACCGTGGGTCCGGATTAGGAGATGTCAAGTCCTATGGTTATCACCTATTTTGATCAATCTTGTTAGCCTGGGAAGGCTTAGGTCGCAAATGATGTCGGTGACAAGAAAATTGTCTTACTTCTCCACCCGAGCTAAAAGGAGAAACTTACTCGATATCACCCATATAAAATCACAATTCTCCACGTGTGTTCGACAACACCAGCACTGCGCGAAGAGCAGTAAGAAGTTGAGAAAGAGTGGTAGGCATCCGAGGAGAACACAAAGTGATTATTCAGTATGGGGGGAAATCGCTATGCGAGGGTTAGTTTTCTTCCCTTGAGTTCATCCTCTTAAGTGGAGTGTATTTTGAGAGACTTTGTGTGAGAATTTCACACCAGGTCTCTCGAAATGCATTTCATTCAACTCGGGTTGAGGAAAGGTACGAGGTTTGAAGTTTACAGAGGCCACAAGAACGTGTAATTGATTTTTACACAAAGTTTTAAATTGGAGCGATGCGTGAGACATTTTCTTGTCACTGCGATTTCGAAGTATACTTAAACGATCCTATGTTTACAGGTTGCAGTTAAAATAGCTGAACTCTAAACCTGTACAGAACCACGGGAAGGAGAAAAGTGTACATACGGAGTAACACGGGAGGTAAATTGATGTATTGGGAAACTGATTATGATGAGTTTTTGGAGAATGCTATCATATCAGTGGTATGTGTGAGGTGAAAGAGGTAAACCAGACGGTTCTCATGTGAGGTGGAGTTTTATCAAAGCCATCCTTACTTCAAAGTTGTGACTATGCTTGAGATTGTATTTGGAGGACATAATTAAAATGTGAAGGAGTTATGTTTGGGTTGAAGAAGGTCAGAAAAGAAAAAACGAACTCAAGCTTGTTCTTCGACCCACTCACTTTGAGAAGTCCAGTGCGGATGAAGAAGTGAGGGACCGTCTTGGAGGAAGTGGTAACGGAGGAAAGCTACGTATGCGGCACGTTGATGACAAAGCAGAATTATTCAAACCAAAAGTTGAATCTGCGGAAGAAGTGAGGTCCTTTTTCTTGCGGACGTTGACACGCAGTCACGAGTAATGTTGAGACTCTTAATACATGAAGAGAGTCTTTTGTTCAAAAAGTTAGTTGAATCATCGCTTCATATAAATATGTAATTGTGATACAAATGTAAATAGTCAAGCTGAAATTCTAGAAAAACGAAAGCATACACATGGTCTTACCTAGCCAG

CDS

>Mapoly0022s0095.1
ATGGAGGTGACAAACGAGCTTCCTTGTCGAGAATTGGATTTGAGTCTCGAGGACGTCTTGGAGTTGTTCGTGGATTCCGAGGAGCCTTTCGATTCTGAGCCATGGGATTTCTCGCAGTCTCTTCTGCCTCCTTCGCCTGGATTTTTCTCTTTTGACGAGGCAAATGGTTGGGAGATCAAGGACAGATCTGAGATTTGTCCAGAGTCCGGCGGCTGTGAGAGCCTGGAGGCGACACAAATCATCGCTAGTGATGAGTTTCTTGTCGACGATGGGCGTTTGGGAGTTTCGAGTCCTGTATCTTGTAGCGGGGCCGAATTGGGAAGTAACCTAGTTGCGACCTCTCAAGTCGAGACCAGACCGTACTGTTCCAACAGTTCCGAAGGAACAAGCCACTCGGAACTGAATCAAGGGGCTCTGGATCTTGGCCGCTCAAATAGCAATCTGCATTGTGACAGCTTTCTAGAGCTGAAGTCGCTTAGCCCCGAGTCGGGCTGTACCAGTTCTGACGAGCAAGTGCAAGGCAGAAGCTGCAATAACTGTCCAACTCAGTCTGGAGATGCGACAGCAAGTGGGGAGGATGTTACGGGCACTGTGGACGAAGACACGAAGAAAAGAATAAGACTCATGAGAAATCGAGAGTCAGCTACGCAATCACGATTGAGAAAGAAATCGTATGTAAAGGAGTTGGAAATGAGGTACCGGATGTTGGAAAGCCATTGCTCAATTCTTCAGCAAACGGTCGCCTTCACTTCTCAGGAAAATATCTTATTGAAAGAAGAGCTTAACAAGATTAAATGCTCAAACTTGAATGGATCCAAGTCTGGCGTGGTGGAGCCTGCAGCGCTACCAAGTGACTCCCTGCCGTCGGAGTCCCCACCCTGCCTTACTGCATCGGCCCCATTTCGTTTGGACAACTGGGAGCTTCTCGCGTGCCTTTACCACGTCTTGCTTCTCACTCTGTTGGAAACCAAGGCACAAAGCCGAGCAAGAAGAGGAGACGGCGAGAGGCGACCGTGGGTCCGGATTAGGAGATGTCAAGTCCTATGGTTATCACCTATTTTGATCAATCTTGTTAGCCTGGGAAGGCTTAGGTCGCAAATGATGTCGGTGACAAGAAAATTGTCTTACTTCTCCACCCGAGCTAAAAGGAGAAACTTACTCGATATCACCCATATAAAATCACAATTCTCCACGTGTGTTCGACAACACCAGCACTGCGCGAAGAGCAGTAAGAAGTTGAGAAAGAGTGGTAGGCATCCGAGGAGAACACAAAGTGATTATTCAGTATGGGGGGAAATCGCTATGCGAGGGTTAGTTTTCTTCCCTTGA

Protein

>Mapoly0022s0095.1
MEVTNELPCRELDLSLEDVLELFVDSEEPFDSEPWDFSQSLLPPSPGFFSFDEANGWEIKDRSEICPESGGCESLEATQIIASDEFLVDDGRLGVSSPVSCSGAELGSNLVATSQVETRPYCSNSSEGTSHSELNQGALDLGRSNSNLHCDSFLELKSLSPESGCTSSDEQVQGRSCNNCPTQSGDATASGEDVTGTVDEDTKKRIRLMRNRESATQSRLRKKSYVKELEMRYRMLESHCSILQQTVAFTSQENILLKEELNKIKCSNLNGSKSGVVEPAALPSDSLPSESPPCLTASAPFRLDNWELLACLYHVLLLTLLETKAQSRARRGDGERRPWVRIRRCQVLWLSPILINLVSLGRLRSQMMSVTRKLSYFSTRAKRRNLLDITHIKSQFSTCVRQHQHCAKSSKKLRKSGRHPRRTQSDYSVWGEIAMRGLVFFP

Mapoly0022s0095.2  

Gene structure:

mRNA scaffold_22:869908..873806  ( + strand )
five_prime_UTR scaffold_22:869908..870091  ( + strand )
CDS scaffold_22:870092..870711  ( + strand )
CDS scaffold_22:870969..871201  ( + strand )
CDS scaffold_22:871833..872244  ( + strand )
CDS scaffold_22:872595..872619  ( + strand )
three_prime_UTR scaffold_22:872620..872877  ( + strand )
three_prime_UTR scaffold_22:873015..873806  ( + strand )

Sequences:

Gene

>Mapoly0022s0095.2
GATCGGTTTCGTGTGTTTGCTGGCGGTGAAAGCAGCGTTTGCGTCTGTGGCGCGTGGTGGCGTGGGGATTGTTCGTTCGTCCGAAGCGTCTGCTTTAATCTGCGCTCGGAGGAAAGCTTCCGTGATCAAAGTTACCGTCTTCTATGCTGTGTTCGAGAAAGGGGTTGTTTCTTCTTCCCCGTCGATGGAGGTGACAAACGAGCTTCCTTGTCGAGAATTGGATTTGAGTCTCGAGGACGTCTTGGAGTTGTTCGTGGATTCCGAGGAGCCTTTCGATTCTGAGCCATGGGATTTCTCGCAGTCTCTTCTGCCTCCTTCGCCTGGATTTTTCTCTTTTGACGAGGCAAATGGTTGGGAGATCAAGGACAGATCTGAGATTTGTCCAGAGTCCGGCGGCTGTGAGAGCCTGGAGGCGACACAAATCATCGCTAGTGATGAGTTTCTTGTCGACGATGGGCGTTTGGGAGTTTCGAGTCCTGTATCTTGTAGCGGGGCCGAATTGGGAAGTAACCTAGTTGCGACCTCTCAAGTCGAGACCAGACCGTACTGTTCCAACAGTTCCGAAGGAACAAGCCACTCGGAACTGAATCAAGGGGCTCTGGATCTTGGCCGCTCAAATAGCAATCTGCATTGTGACAGCTTTCTAGAGCTGAAGTCGCTTAGCCCCGAGTCGGGCTGTACCAGTTCTGACGAGCAAGTGCAAGGCAGAAGCTGCAATAACTGTCCAACTCAGTCTGGAGATGCGACAGCAAGTGGGGAGGATGTTACGGGCACTGTGGACGAAGACACGAAGAAAAGAATAAGGTTTGTGGCCTTTTCGAGACTTTTTTGTACCGCACGCAAGCGTGTATGTATTTTGAGTTAATCATTCAATCGATCGGAAGTCTAGTTTCTGGTGTTTGTATGACTTATTTTCGACCGAAGGGTGCAAGACTGATGACACTCTCCGAGACATTTCCACATGCTGCACCAAAGTAGAATGTACTGCATCATTGTAATGTTAATTGTAATGTCAATATGATCTTAGTTTGGGTTTCTAATAAGTTGGTTTGAATGTTCAGACTCATGAGAAATCGAGAGTCAGCTACGCAATCACGATTGAGAAAGAAATCGTATGTAAAGGAGTTGGAAATGAGGTACCGGATGTTGGAAAGCCATTGCTCAATTCTTCAGCAAACGGTCGCCTTCACTTCTCAGGAAAATATCTTATTGAAAGAAGAGCTTAACAAGATTAAATGCTCAAACTTGAATGGATCCAAGTCTGGCGTGGTGGAGCCTGCAGCGCTACCAAGTGGTAAGTTCACTGACATGCTTACCTTGATCATGGTTGTCGAGAAGGTCCAGCTAAATGCATGTCACTGCTCAACTTGTAGTGTGCTTAGGCCCAATCATTCACAGAAGATTAGGATTATGCGTACACCCTCACCATCAAAATCGTGAAAATTATGACTAGTTTACACTGAACGAAGAATCTCCTCTGTTGAGTATCATATTTGCTCTGTGCGACTATATAGTATATGTTTCACAATATACCAACACTTCTCTTTGAACCGTATGTATCGCATTTGTCAAGACTATTTGGGTCATCAATAGATTGGGTCAAACTGTTATGATTTACATCCTAATCAGTGTGTACAGTTGGAGTAGCCGTGTGAATACTAAGGTCAATCTAGTGAATATATCATACGCTCCCCACACTTGTCCACAGTTCTCAGTCCAATAAGTATGTTTCCAGCATAGACTCAACCCAGTGTAAATTTTACTGAATGAGAATGTATTAATTACTTAAGATAGTGTGGGCTACCTAAAAATAATGGTCGGGGCCCTACATTTTGGCCTTCCCAGTCAGTGTGAAGCACATTAGCGGTCGTGTGTGAAGAAAAGGTTTTTTTGATTTTAACATGTTTCGGTGTTTTGTTTTCCAGACTCCCTGCCGTCGGAGTCCCCACCCTGCCTTACTGCATCGGCCCCATTTCGTTTGGACAACTGGGAGCTTCTCGCGTGCCTTTACCACGTCTTGCTTCTCACTCTGTTGGAAACCAAGGCACAAAGCCGAGCAAGAAGAGGAGACGGCGAGAGGCGACCGTGGGTCCGGATTAGGAGATGTCAAGTCCTATGGTTATCACCTATTTTGATCAATCTTGTTAGCCTGGGAAGGCTTAGGTCGCAAATGATGTCGGTGACAAGAAAATTGTCTTACTTCTCCACCCGAGCTAAAAGGAGAAACTTACTCGATATCACCCATATAAAATCACAATTCTCCACGTGTGTTCGACAACACCAGCACTGCGCGAAGAGCAGTAAGAAGTTGAGAAAGAGTGGTAGGCATCCGAGGAGGTATGGTTATCACATCCGGTAGGGGAAGCTTTCCTCTTTGTATACTTATTCAACCTAGCAGAATAGCATTCTTTCAAGCCCCACTCGAGGGACTGACTTGAGTAGTCTCGTAGATCTTCAGAGGTTTCGTGTTTTTACCACTGTAATAAACCAGGACATGCGTCCTTATACTAATACAGCAGCAGGTTAAGGAGAGTAATGAGTTGCGCTGTGACCACTCGTTGCTCCTCAGGTAGGTTTTAGCACTGGAAATCTTATTGGTCTCTTCATCTCATTTCTTGTCTCGAATTTGATGTCGAAGGTAGCTCTCATCATGGTGTCCGGTGAGTGACTTTTTTGCCTATGTACAGATGGAATGACTTGGTAAGAAGGTAAGTAACCTGGACGTCGAGATATTGCGTGGAATGTTAGGGAGTGAAGACTGTTGGAATACGGGATGGTGATTTTCGGAGATAATTTGCATTTTGCAGAACACAAAGTGATTATTCAGTATGGGGGGAAATCGCTATGCGAGGGTTAGTTTTCTTCCCTTGAGTTCATCCTCTTAAGTGGAGTGTATTTTGAGAGACTTTGTGTGAGAATTTCACACCAGGTCTCTCGAAATGCATTTCATTCAACTCGGGTTGAGGAAAGGTACGAGGTTTGAAGTTTACAGAGGCCACAAGAACGTGTAATTGATTTTTACACAAAGTTTTAAATTGGAGCGATGCGTGAGACATTTTCTTGTCACTGCGATTTCGAAGTATACTTAAACGATCCTATGTTTACAGGTTGCAGTTAAAATAGCTGAACTCTAAACCTGTACAGAACCACGGGAAGGAGAAAAGTGTACATACGGAGTAACACGGGAGGTAAATTGATGTATTGGGAAACTGATTATGATGAGTTTTTGGAGAATGCTATCATATCAGTGGTATGTGTGAGGTGAAAGAGGTAAACCAGACGGTTCTCATGTGAGGTGGAGTTTTATCAAAGCCATCCTTACTTCAAAGTTGTGACTATGCTTGAGATTGTATTTGGAGGACATAATTAAAATGTGAAGGAGTTATGTTTGGGTTGAAGAAGGTCAGAAAAGAAAAAACGAACTCAAGCTTGTTCTTCGACCCACTCACTTTGAGAAGTCCAGTGCGGATGAAGAAGTGAGGGACCGTCTTGGAGGAAGTGGTAACGGAGGAAAGCTACGTATGCGGCACGTTGATGACAAAGCAGAATTATTCAAACCAAAAGTTGAATCTGCGGAAGAAGTGAGGTCCTTTTTCTTGCGGACGTTGACACGCAGTCACGAGTAATGTTGAGACTCTTAATACATGAAGAGAGTCTTTTGTTCAAAAAGTTAGTTGAATCATCGCTTCATATAAATATGTAATTGTGATACAAATGTAAATAGTCAAGCTGAAATTCTAGAAAAACGAAAGCATACACATGGTCTTACCTAGCCAGCTTCACCTGTAGAGTATCGAATAGATAAGATAAATAGATAAATAACTAAGATAAATATTGATTACTTGACAAAGTAATCAGTATCTATCACTTTACATATGCATTGAAACTTATTCTCTCGA

mRNA

>Mapoly0022s0095.2
GATCGGTTTCGTGTGTTTGCTGGCGGTGAAAGCAGCGTTTGCGTCTGTGGCGCGTGGTGGCGTGGGGATTGTTCGTTCGTCCGAAGCGTCTGCTTTAATCTGCGCTCGGAGGAAAGCTTCCGTGATCAAAGTTACCGTCTTCTATGCTGTGTTCGAGAAAGGGGTTGTTTCTTCTTCCCCGTCGATGGAGGTGACAAACGAGCTTCCTTGTCGAGAATTGGATTTGAGTCTCGAGGACGTCTTGGAGTTGTTCGTGGATTCCGAGGAGCCTTTCGATTCTGAGCCATGGGATTTCTCGCAGTCTCTTCTGCCTCCTTCGCCTGGATTTTTCTCTTTTGACGAGGCAAATGGTTGGGAGATCAAGGACAGATCTGAGATTTGTCCAGAGTCCGGCGGCTGTGAGAGCCTGGAGGCGACACAAATCATCGCTAGTGATGAGTTTCTTGTCGACGATGGGCGTTTGGGAGTTTCGAGTCCTGTATCTTGTAGCGGGGCCGAATTGGGAAGTAACCTAGTTGCGACCTCTCAAGTCGAGACCAGACCGTACTGTTCCAACAGTTCCGAAGGAACAAGCCACTCGGAACTGAATCAAGGGGCTCTGGATCTTGGCCGCTCAAATAGCAATCTGCATTGTGACAGCTTTCTAGAGCTGAAGTCGCTTAGCCCCGAGTCGGGCTGTACCAGTTCTGACGAGCAAGTGCAAGGCAGAAGCTGCAATAACTGTCCAACTCAGTCTGGAGATGCGACAGCAAGTGGGGAGGATGTTACGGGCACTGTGGACGAAGACACGAAGAAAAGAATAAGACTCATGAGAAATCGAGAGTCAGCTACGCAATCACGATTGAGAAAGAAATCGTATGTAAAGGAGTTGGAAATGAGGTACCGGATGTTGGAAAGCCATTGCTCAATTCTTCAGCAAACGGTCGCCTTCACTTCTCAGGAAAATATCTTATTGAAAGAAGAGCTTAACAAGATTAAATGCTCAAACTTGAATGGATCCAAGTCTGGCGTGGTGGAGCCTGCAGCGCTACCAAGTGACTCCCTGCCGTCGGAGTCCCCACCCTGCCTTACTGCATCGGCCCCATTTCGTTTGGACAACTGGGAGCTTCTCGCGTGCCTTTACCACGTCTTGCTTCTCACTCTGTTGGAAACCAAGGCACAAAGCCGAGCAAGAAGAGGAGACGGCGAGAGGCGACCGTGGGTCCGGATTAGGAGATGTCAAGTCCTATGGTTATCACCTATTTTGATCAATCTTGTTAGCCTGGGAAGGCTTAGGTCGCAAATGATGTCGGTGACAAGAAAATTGTCTTACTTCTCCACCCGAGCTAAAAGGAGAAACTTACTCGATATCACCCATATAAAATCACAATTCTCCACGTGTGTTCGACAACACCAGCACTGCGCGAAGAGCAGTAAGAAGTTGAGAAAGAGTGGTAGGCATCCGAGGAGATGGAATGACTTGGTAAGAAGGTAAGTAACCTGGACGTCGAGATATTGCGTGGAATGTTAGGGAGTGAAGACTGTTGGAATACGGGATGGTGATTTTCGGAGATAATTTGCATTTTGCAGAACACAAAGTGATTATTCAGTATGGGGGGAAATCGCTATGCGAGGGTTAGTTTTCTTCCCTTGAGTTCATCCTCTTAAGTGGAGTGTATTTTGAGAGACTTTGTGTGAGAATTTCACACCAGGTCTCTCGAAATGCATTTCATTCAACTCGGGTTGAGGAAAGGTTGCAGTTAAAATAGCTGAACTCTAAACCTGTACAGAACCACGGGAAGGAGAAAAGTGTACATACGGAGTAACACGGGAGGTAAATTGATGTATTGGGAAACTGATTATGATGAGTTTTTGGAGAATGCTATCATATCAGTGGTATGTGTGAGGTGAAAGAGGTAAACCAGACGGTTCTCATGTGAGGTGGAGTTTTATCAAAGCCATCCTTACTTCAAAGTTGTGACTATGCTTGAGATTGTATTTGGAGGACATAATTAAAATGTGAAGGAGTTATGTTTGGGTTGAAGAAGGTCAGAAAAGAAAAAACGAACTCAAGCTTGTTCTTCGACCCACTCACTTTGAGAAGTCCAGTGCGGATGAAGAAGTGAGGGACCGTCTTGGAGGAAGTGGTAACGGAGGAAAGCTACGTATGCGGCACGTTGATGACAAAGCAGAATTATTCAAACCAAAAGTTGAATCTGCGGAAGAAGTGAGGTCCTTTTTCTTGCGGACGTTGACACGCAGTCACGAGTAATGTTGAGACTCTTAATACATGAAGAGAGTCTTTTGTTCAAAAAGTTAGTTGAATCATCGCTTCATATAAATATGTAATTGTGATACAAATGTAAATAGTCAAGCTGAAATTCTAGAAAAACGAAAGCATACACATGGTCTTACCTAGCCAGCTTCACCTGTAGAGTATCGAATAGATAAGATAAATAGATAAATAACTAAGATAAATATTGATTACTTGACAAAGTAATCAGTATCTATCACTTTACATATGCATTGAAACTTATTCTCTCGA

CDS

>Mapoly0022s0095.2
ATGGAGGTGACAAACGAGCTTCCTTGTCGAGAATTGGATTTGAGTCTCGAGGACGTCTTGGAGTTGTTCGTGGATTCCGAGGAGCCTTTCGATTCTGAGCCATGGGATTTCTCGCAGTCTCTTCTGCCTCCTTCGCCTGGATTTTTCTCTTTTGACGAGGCAAATGGTTGGGAGATCAAGGACAGATCTGAGATTTGTCCAGAGTCCGGCGGCTGTGAGAGCCTGGAGGCGACACAAATCATCGCTAGTGATGAGTTTCTTGTCGACGATGGGCGTTTGGGAGTTTCGAGTCCTGTATCTTGTAGCGGGGCCGAATTGGGAAGTAACCTAGTTGCGACCTCTCAAGTCGAGACCAGACCGTACTGTTCCAACAGTTCCGAAGGAACAAGCCACTCGGAACTGAATCAAGGGGCTCTGGATCTTGGCCGCTCAAATAGCAATCTGCATTGTGACAGCTTTCTAGAGCTGAAGTCGCTTAGCCCCGAGTCGGGCTGTACCAGTTCTGACGAGCAAGTGCAAGGCAGAAGCTGCAATAACTGTCCAACTCAGTCTGGAGATGCGACAGCAAGTGGGGAGGATGTTACGGGCACTGTGGACGAAGACACGAAGAAAAGAATAAGACTCATGAGAAATCGAGAGTCAGCTACGCAATCACGATTGAGAAAGAAATCGTATGTAAAGGAGTTGGAAATGAGGTACCGGATGTTGGAAAGCCATTGCTCAATTCTTCAGCAAACGGTCGCCTTCACTTCTCAGGAAAATATCTTATTGAAAGAAGAGCTTAACAAGATTAAATGCTCAAACTTGAATGGATCCAAGTCTGGCGTGGTGGAGCCTGCAGCGCTACCAAGTGACTCCCTGCCGTCGGAGTCCCCACCCTGCCTTACTGCATCGGCCCCATTTCGTTTGGACAACTGGGAGCTTCTCGCGTGCCTTTACCACGTCTTGCTTCTCACTCTGTTGGAAACCAAGGCACAAAGCCGAGCAAGAAGAGGAGACGGCGAGAGGCGACCGTGGGTCCGGATTAGGAGATGTCAAGTCCTATGGTTATCACCTATTTTGATCAATCTTGTTAGCCTGGGAAGGCTTAGGTCGCAAATGATGTCGGTGACAAGAAAATTGTCTTACTTCTCCACCCGAGCTAAAAGGAGAAACTTACTCGATATCACCCATATAAAATCACAATTCTCCACGTGTGTTCGACAACACCAGCACTGCGCGAAGAGCAGTAAGAAGTTGAGAAAGAGTGGTAGGCATCCGAGGAGATGGAATGACTTGGTAAGAAGGTAA

Protein

>Mapoly0022s0095.2
MEVTNELPCRELDLSLEDVLELFVDSEEPFDSEPWDFSQSLLPPSPGFFSFDEANGWEIKDRSEICPESGGCESLEATQIIASDEFLVDDGRLGVSSPVSCSGAELGSNLVATSQVETRPYCSNSSEGTSHSELNQGALDLGRSNSNLHCDSFLELKSLSPESGCTSSDEQVQGRSCNNCPTQSGDATASGEDVTGTVDEDTKKRIRLMRNRESATQSRLRKKSYVKELEMRYRMLESHCSILQQTVAFTSQENILLKEELNKIKCSNLNGSKSGVVEPAALPSDSLPSESPPCLTASAPFRLDNWELLACLYHVLLLTLLETKAQSRARRGDGERRPWVRIRRCQVLWLSPILINLVSLGRLRSQMMSVTRKLSYFSTRAKRRNLLDITHIKSQFSTCVRQHQHCAKSSKKLRKSGRHPRRWNDLVRR

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>