Mapoly0023s0090



Description

RNA POLYMERASE III TRANSCRIPTION INITIATION FACTOR B

Reference DB

Database ID Description
GO GO:0003682 Chromatin binding
OrthoMCL OG5_129948
PFAM PF00249 Myb-like DNA-binding domain
PANTHER PTHR22929 RNA POLYMERASE III TRANSCRIPTION INITIATION FACTOR B
PANTHER PTHR22929:SF0 SUBFAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
Mp1R-MYB9 transcription factor, MYB Mapoly0023s0090.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0023s0090.1 scaffold_23:930473..937434  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0023s0090.1  

Gene structure:

mRNA scaffold_23:930473..937434  ( - strand )
three_prime_UTR scaffold_23:930473..932091  ( - strand )
three_prime_UTR scaffold_23:932222..932275  ( - strand )
CDS scaffold_23:932276..932311  ( - strand )
CDS scaffold_23:932590..933097  ( - strand )
CDS scaffold_23:933314..933408  ( - strand )
CDS scaffold_23:933544..933659  ( - strand )
CDS scaffold_23:934019..934421  ( - strand )
CDS scaffold_23:934934..935430  ( - strand )
CDS scaffold_23:936656..936710  ( - strand )
five_prime_UTR scaffold_23:936711..937434  ( - strand )

Sequences:

Gene

>Mapoly0023s0090.1
TCACTGATGCGCCAATCAGCGCCTACTCTATTCTGAGGAGGTTCTTGGAGGTACATGATGCCTAATCCTGTCCTCGCCCGGTGGACATTACTAAAATCCATTCCACGACAAACGACGAGACCTCAAGCTTCGGCGAAAATCCGATAACAGGGAGACAGTGAGAGGAGACAGTGGAGTTTAATCTCCATCTTTATGCCTTCGCCCGTACTTCCGTCGACCCCGGGGCTGGGGCTTTCTTCATTGGCTTTTACCCGCATTTTACGAAATGATGTTGTTTGTCTCAATTTCTGGACTTTAGAATATAGAGGATTTTGGAGTGCTCCTGTATAAGTGGACCCGAGCATATGCAATGGATTTCGCGGGGCCTTCGGTGGAAGGTTTTGATGGTAGTGGGGAGACAAATTAGCGAACATTAGGGTTTAGCGGGAGGAAGATCGTAGTCCGCTAGTGCAAAACCACTCCACTGTGCTCTGACACAAGAAGCCGGGAGCGTGAGAGTGCGGGACGGGAGGAGAGGAAGAGCGCGGCAAGGACGGACAATCAGGAATGAGAGGGCCTGATAGCGGTGACAGGAATTTTCTTGCCGTTTGCACATGTTGATCACGGGAACTTTAATGCGTAGAAGATGTGACTGTGCAGCTGAGCTGACTCTCGGACAGATTAGCTCTAGAAGGCCAGGAGATTGGAACAAGACCTTCGCTCCCTGCCTGGAAGCTAGGGAGCAATGTCGATGCTTTCTACGCTGGTGGATGCACTAGATGTGCCAGAAGGTGCTTCAGGTAGTTCTTGATTTCTTGCCATGCCTGGATTTGTCATTCAAGTGGAGTTTGTTTGGCATTGGTTTGTCCAAATTATTTAAAAAAAAAATTCTTGTCACGGTTTCGGAGGGAAATAATATTCGAAAGAAACGCAATCACTGACCGCTGGCGAGTAAGAGAGAAGCTCCTGGACAAATTTATTTTGTCTTTTTAAATAGTTCGCAATGCCACGGGAACAGGCGACAAACATTTACTTTCGATCGCTTCTGTGGGATTTAATCATCCTGAAGTCCACAATTTTCAATGTTTATATTTTTGGGCTTACTTCTCTCTTCTACCGAATTTCTACTCGTAACGAAGATTATTCTTGTTCGGTTCGTTTGGAAGACATAAAACTAAGAAGTAAAGGACCGAACGTAGTCGGCATTTCCGATTGTTACAACCTTTAGCAGATGGTTTGAAGCTCATGATGAAAGAGCCAATTTTGCCTAGTAGCGGTCTGGATGGTGGTAATGTAGCAGAAGCTTTGCCGCAATTTCAGTCAAAGTAGGTGTACCGAGACTTTAATTTACGCAAAGCTTGCATTTTTGTGGTAGGAAACGTTCTTGTTCTATGATCTTGGTAATCGGGACATGTCGGAGGTCATTCGAAACTTCTATGAAAGCCATATGGGGGAATGGGCTTAGTTACAACGAGAATGAAGTATACATCACTCTGTGAATGGCGGAAGAAACACAAACATGAAGAAATTTCGTGTCGACAGACATTTCAATGTAGTCATGTCTGTACACAGTAAGATGTCAATTTCTCGTTGTTTATGTCGATCACCTTTTAAGGAAATCAAAGTCGAATTTTACGGTGAATCAACCCTTGAAATTTTCAGTTCAGTTTCTGGGCCAGGTGACGTGTATCTTCCAATTGATTATCTTTTGCAGTTGGTGAAGATGCCGTCCTTTTATTGGCCATCGCACAATTGCCATTATTGATCTTGGTTCATACATTCTCGTTAGCAAAACAGTTGTGGGTGTGCCAGGCTTTTTATCCAGTTCAAATATAATGGAATAGTCCGAGGAAGACAGTCACGGAATCCTTTGATTTTGAAGATCAAACCATTCCCTATTGATGGTAGAAATTCGAAAGTGGGAGTCTTTCCTTGAGGATATGAATGCTCTGTGCATTGTTATTGAGTGTTGGAATATATGTGTAATAGCCAGCGATAGACTGATGCATTGTCTCTCGTTTGCAGTACCAAGAGCAGGAGTTTTTCAGCCCAAAGTCAAAGCTCGGGTCAGGAAGGGTGGAGGTCGTGGTGATGCCGGTGCTAGCGTAGCTGTCAAAGCTCCTCCAGCTGCGCCGGCAGCAGAAAAGCCTGTTTCCGCATTGCCTGTCGCGAGCGATACCGAGCCTCTTGATGGCAACCAAAACAATGCGGAAGAAAACGAGATTTCGCAACCGGATTTTAAAGTTCCCGATGCTCCACTGTCGATAGAGGAAAATTGTGTCCCTGAACCATTACTCCCGATAACGTCTTCTACGACTACATTAGAAGAAACTGTCGGTGTGATCGATAGTGTATCCACGGAGGTAACAAAAGTGACATCTCCTAGCCGAACTTCGTCGATCGAACCTGCAATTCACTCGTCGCCTGCTGCCGAGGACGGCAGTCTTCTCTTACAGGCTGAAGATGATGTCATTGCTGCCATTAACGCTCCAGAAGTTTCCCCTCCCGTTGCTGTGAGATCAGTAAGTCCTGATGTACATTCTACACCCTTTGTATAAGTTTCTTGTGACACCAACTTTCTTTTAGTCGGAGTGAAATAGTCTGATCGATATTGGCTGTTTGCCTAGGATGACCCTTTTTCGTTCGGTCGCACTATGAATCCCTATGACTCGTGACTTGTGAGACTATCGTGTCACAAGTCATAGAGATTCATTTGAACATGCCGAACTTCGATTTTGCACTCTTCACTTATTATTTGGAGTTCAGGTGTACTCGGTGGCTGTGCTTTCTCTCGGCTTTTGTTGGATATTTAGATGTTGATAATATCCGAAACTCTGAGATCATGTGATCTTTGATACTGGTCAACATCTAGACTTTTATGCATCTCACCCTCAGCATACATGCTGCTACAGCTCTTTGTATGCTGAATTAAAAACGTTGTTTGATTGTTATCTAGACCGCCGTTATTATATCCACACATCAGAAATCTGTTTTGTGATGCCGTCGTCTTATCAGTTGTCATTTCATGTCTCAGAATTTTCCTCTGCCGTCTTTCACTACGGCAACTGAAGAAAATGAGGACACACAAGGAGACGCCTTGCCCAGGTCTGGGGAACCTTCCAGCAAGGGCATAGTGCAACCTACAAATGATGAAGAAGGTGGCCCAAATGGGGTCATTGAGCGGGCAAGAGAGAATAAGTTCAAAAAGTCTGCCAGGAAAGTCAGGAAAACAGAGGTTGCCACTCCCACTACAAGCTCCAAAGAAGCAGAAGTGGTTGATGATGACCTGGAAGAAACTCTGGTGACTCTCGACGATGAACTAATGGCGGAACTTGGCTTGCAAGAGGAAGATCCTCCACTAGACCCAGCCGTACAGAGAAGGAAGCGGAAGAGAGCATTTCCGCATGCTTCTAGTCGGCCGAGACGAGTTCAAGAGGGTGCGGATTCTGTCAAGATTACACGTGCTTACTTAGCCAAGGAATTGAAGATAGTGCGTTTATCGCCTCTCGGGGGATGCCATGTTTGAGTTTGTTGGCATTTTGTCGCTTTCCAACTGAATTTACCTGCAACATGTCGCCTGTTTTTATGTTTACCTTGATGGTATATTTCTGAGTTGGTAATCGTATACCACAACGTTGATTGTGAGACGCATAGAACGCATCCAACTCTGGCGGGTGCTCTCCTTGGTGCGATTATTGAGGTCATTTCTTTGGTCTGACAGTGTATTTTCCTTACTGGAGATCTTGGTCAAGCACCAACTTTTTCAGGTTAATAAAAAATATGTGCTTTGGCTCAGATGTTGGTGGTTCGAGTAAAGGCGGACAGTCGAGCAAAACAAACTATGACCTTTCAAACCCCGGCACACTGCCATTGCGCGAAGTGATAAGAAGAGCCGAGAATATTGAGCGGAAGGTAATGTCCTTTTAAGTTTTGTTAGACTTGAAGGAAATCTGATCAAAGCGCTGGAAATTAGTTGTGTTTGCTTGAATGGTTTTGGTATTAAGCCACTTGGTGTGTATAATGTGCCCTTATTTCTGATCTTTGCAGAAAGCGAAGGATGAGTTGGCTAAGAAGTCTTTACTAGACATTTCGAAACCTCGAGAACGAGAAGTAGTTAGAGAGGCCGAACCTCAGAGAGATGTGTAAGTATTTCTACTCCTTTTTACGTGAAGATATTGACTTTGTCGAATGATCTTCTTATTAGTTACAAATACCCGTACGTTGTGAAACTGCTAATGTCATTGAACGCCTGCAACCTTTTCTATCGTGCGACCAACCAGCAAGGCCATTTGGCTAGTGTGTTGTCATTTTTGTTTGTCAGGGTTTGATTTTTGTCTCCTACGTATTCATACTTGCAGCCTTTCTCTTGCGCCACAAGTACAAGTGATCAATGGGCGCATTGTGGTAAACGAACAGAGTCTTACAGTTGGTGCCTACGCCACATCTGCTCAAGATACAGACAAGTACACGAGGGTTGAAGAGAACGCTTCTAGACTCAACTACCATACTTACTCTAATCGGACAGTTACGGAAAGATGGAAAGCGGAGGAAACCGACATTTTTTATAGAGCTATTAGACAGTTTGGTACCGACTTTGATCTGATAAAGAACCTTTTCCCAAACCGAACACGGCGGCAGATCAAAGCGAAGTACAAGAAAGAGGAGAATTCGAATCCACGACGTGTGTCAGATGCTTTAACATATCGACCGAAAGATCAATCTCATTACGAGGATTTGCTTGTTCGTATGAAGTGCGATGATCTTATCCAAGACAATTCCGACCCTTTTGCAAGTATTCTCGCTTACACTGCAGATAAGGTTGAGAAGACAGATGTAACCGACAAGGTCGAAGTCGAAGAAACTCAGGTATACTAGCCTATCTACCTTCTATGTATACATGCATAAGATGCTGCTGTAATTGAGATTTGATGAATTTAGACCGAACCCTCGTATCTCGTAACTTCACACCCATTTGCTTACGTGTGAGTTTTTCATAGTCACTCCCATGTCATCCATCTCTTCTTTGCAACAGAAAAATAGCCTCAAGATTTTCAGCACAGGTTTAACTGGGAAGATTAACGTCATGCAGTTGCCTTTGCTATGGATTGTTTTATTAACTGTTGCGTGTGCTCCGTGTTGTGCAGACCGAGGAAGAAATTCCGGCCAGTATCGTGGAGTAGTTTACAGGGATACTGAGCACGTGAACTGGTCGCTCCCTGACGGAAAGAAACAAGGTAAGTTCATCACTAATCGAAGCCTAGCCAGAGCGTAATTATTTTCTTTTCATCGTGGATCTTCAGGCAGTTAATCGCTCTTTGTTCTGGATGGTGGTTTTAATCTACGTTGATCACCGGTGATATGCAGAAAGGTCGATCTGTACAACAAAACTACTCCAGAGTGCCCGTTCACGGCATCATGCCTTCATTGTGCCCACTTTGGGAAAAGGTGGAGCCACTTATCGAATACGGCATGGAGCTTGGTCGCTACTCCGTGTACTGAGAACGGGGAGCTTCTTTTGATCCGTGCAACTTGAAGATAAACGAAGATCGCGGTTATCAGGGTCTCTAGCTGAGAAGGTAAGAGGACTACGTATCGTGTAGAGTGGAAATGGTCGAAATCAAAGTCCTAGTGAGAAGGACAAACGCTCTTTCTTCTTGGGACCTTGCTATGCGACGGTGAATGGGACCCGCTGCTATCTCTGAGATTGAAGCTAGCACTTCCTGGTCAAGCTAGCAAGGGGTGTTCGTGGGGTCGATCTTCAATCTTACAGTGGACTAACCAATGGATAAAAGTCCAACGGCTGAACGACTGACTGACTCATGATTAGCTCAACACTCACAACTATTCATTTCCCATGAACCTGAGAAGACGAAGGAATGGATAGTTGCGATTCTATTTGGACGTGCTAAAACAAGTTCATTTCACCGGATCAACGGACTGCGGAGGATAATCGGCAGTGATGTCTCGTGGTTTTCGATTCAAGTTTGGGAACCCAAACCTGGAGGTGAAAATAGATGTGCACAGTGCTACTCTTGCAGATGCAGAGAGAACTGAGTCTAGGGATGAACACGAAAATCGTGATGGGAGCTGCTAACGACATTGCATTTGGATATATGTGCCCCAGCCTTGGATGCAAGACCGTTGAAAGCATTCACAACGGATTCAGAACATGTTTTACAAATGGTGTACCGCGAGGAAACAAACCAGCAGCGTTCATGTAGCGACCATGCAGGTGTAGATAGAAGGGTACTCATACCCTTCTATCAAATGAGCAATGTATGAAGGCTAGACACAGGAATTGGGTTCTGAGGAAGGTTTTATTTTTCTAGAGTTGTTTTTTCATCACTGGTCCCGGATCAGGGGTTAAACCCCCAATCCGAGTTGACAAGGGATGTGTCTCTACAAAGGGATACAACCCCTACAGTGGGTCACACCCATTGAACATCTCAGTCCTAACTATAAGGACTCTAACTGCACTAGTCCGCACAGACAGGAAGTAGGGAGTATAACTGTATTCTAACACTCCCACTTACTACCTACTTACTTCTCTCTTCCTCATTTTCAACGAACAAACCCAAATTCTGACTGATACCAATGCCTCTCTTTAGCTAATGATTTTGTCATATCGTCGTTGGAAGATGAACTAACTTCACTAAATTATTTGCGACTAGGTCCTTGACAAAATGATATCTAACATCAATGCGCTTTGATCATTCATGATTCTTCTGGTTCTCAATTTGTGCAATAACACTTTGATTATCTCAGAATAGTTTTGTCGACTCCACGTCAAAGCCCAGATCATTCAACAATCCTCTCAACCACAAAGCTTCAGCTCCAGACTTGGACAACGCCTTATACTCTGCTTTTGTATAAGAAAGTGCTACTGACAAAGATTCTGTGATAATCAAAGTATTATTGCACAAAAAGGAAATCAAAAGAGTCATGAGAGATCAAAATTGATATCAGATATCATTTTATCACGA

mRNA

>Mapoly0023s0090.1
TCACTGATGCGCCAATCAGCGCCTACTCTATTCTGAGGAGGTTCTTGGAGGTACATGATGCCTAATCCTGTCCTCGCCCGGTGGACATTACTAAAATCCATTCCACGACAAACGACGAGACCTCAAGCTTCGGCGAAAATCCGATAACAGGGAGACAGTGAGAGGAGACAGTGGAGTTTAATCTCCATCTTTATGCCTTCGCCCGTACTTCCGTCGACCCCGGGGCTGGGGCTTTCTTCATTGGCTTTTACCCGCATTTTACGAAATGATGTTGTTTGTCTCAATTTCTGGACTTTAGAATATAGAGGATTTTGGAGTGCTCCTGTATAAGTGGACCCGAGCATATGCAATGGATTTCGCGGGGCCTTCGGTGGAAGGTTTTGATGGTAGTGGGGAGACAAATTAGCGAACATTAGGGTTTAGCGGGAGGAAGATCGTAGTCCGCTAGTGCAAAACCACTCCACTGTGCTCTGACACAAGAAGCCGGGAGCGTGAGAGTGCGGGACGGGAGGAGAGGAAGAGCGCGGCAAGGACGGACAATCAGGAATGAGAGGGCCTGATAGCGGTGACAGGAATTTTCTTGCCGTTTGCACATGTTGATCACGGGAACTTTAATGCGTAGAAGATGTGACTGTGCAGCTGAGCTGACTCTCGGACAGATTAGCTCTAGAAGGCCAGGAGATTGGAACAAGACCTTCGCTCCCTGCCTGGAAGCTAGGGAGCAATGTCGATGCTTTCTACGCTGGTGGATGCACTAGATGTGCCAGAAGGTGCTTCAGTACCAAGAGCAGGAGTTTTTCAGCCCAAAGTCAAAGCTCGGGTCAGGAAGGGTGGAGGTCGTGGTGATGCCGGTGCTAGCGTAGCTGTCAAAGCTCCTCCAGCTGCGCCGGCAGCAGAAAAGCCTGTTTCCGCATTGCCTGTCGCGAGCGATACCGAGCCTCTTGATGGCAACCAAAACAATGCGGAAGAAAACGAGATTTCGCAACCGGATTTTAAAGTTCCCGATGCTCCACTGTCGATAGAGGAAAATTGTGTCCCTGAACCATTACTCCCGATAACGTCTTCTACGACTACATTAGAAGAAACTGTCGGTGTGATCGATAGTGTATCCACGGAGGTAACAAAAGTGACATCTCCTAGCCGAACTTCGTCGATCGAACCTGCAATTCACTCGTCGCCTGCTGCCGAGGACGGCAGTCTTCTCTTACAGGCTGAAGATGATGTCATTGCTGCCATTAACGCTCCAGAAGTTTCCCCTCCCGTTGCTGTGAGATCAAATTTTCCTCTGCCGTCTTTCACTACGGCAACTGAAGAAAATGAGGACACACAAGGAGACGCCTTGCCCAGGTCTGGGGAACCTTCCAGCAAGGGCATAGTGCAACCTACAAATGATGAAGAAGGTGGCCCAAATGGGGTCATTGAGCGGGCAAGAGAGAATAAGTTCAAAAAGTCTGCCAGGAAAGTCAGGAAAACAGAGGTTGCCACTCCCACTACAAGCTCCAAAGAAGCAGAAGTGGTTGATGATGACCTGGAAGAAACTCTGGTGACTCTCGACGATGAACTAATGGCGGAACTTGGCTTGCAAGAGGAAGATCCTCCACTAGACCCAGCCGTACAGAGAAGGAAGCGGAAGAGAGCATTTCCGCATGCTTCTAGTCGGCCGAGACGAGTTCAAGAGGATGTTGGTGGTTCGAGTAAAGGCGGACAGTCGAGCAAAACAAACTATGACCTTTCAAACCCCGGCACACTGCCATTGCGCGAAGTGATAAGAAGAGCCGAGAATATTGAGCGGAAGAAAGCGAAGGATGAGTTGGCTAAGAAGTCTTTACTAGACATTTCGAAACCTCGAGAACGAGAAGTAGTTAGAGAGGCCGAACCTCAGAGAGATGTCCTTTCTCTTGCGCCACAAGTACAAGTGATCAATGGGCGCATTGTGGTAAACGAACAGAGTCTTACAGTTGGTGCCTACGCCACATCTGCTCAAGATACAGACAAGTACACGAGGGTTGAAGAGAACGCTTCTAGACTCAACTACCATACTTACTCTAATCGGACAGTTACGGAAAGATGGAAAGCGGAGGAAACCGACATTTTTTATAGAGCTATTAGACAGTTTGGTACCGACTTTGATCTGATAAAGAACCTTTTCCCAAACCGAACACGGCGGCAGATCAAAGCGAAGTACAAGAAAGAGGAGAATTCGAATCCACGACGTGTGTCAGATGCTTTAACATATCGACCGAAAGATCAATCTCATTACGAGGATTTGCTTGTTCGTATGAAGTGCGATGATCTTATCCAAGACAATTCCGACCCTTTTGCAAGTATTCTCGCTTACACTGCAGATAAGGTTGAGAAGACAGATGTAACCGACAAGGTCGAAGTCGAAGAAACTCAGACCGAGGAAGAAATTCCGGCCAGTATCGTGGAGTAGTTTACAGGGATACTGAGCACGTGAACTGGTCGCTCCCTGACGGAAAGAAACAAGAAAGGTCGATCTGTACAACAAAACTACTCCAGAGTGCCCGTTCACGGCATCATGCCTTCATTGTGCCCACTTTGGGAAAAGGTGGAGCCACTTATCGAATACGGCATGGAGCTTGGTCGCTACTCCGTGTACTGAGAACGGGGAGCTTCTTTTGATCCGTGCAACTTGAAGATAAACGAAGATCGCGGTTATCAGGGTCTCTAGCTGAGAAGGTAAGAGGACTACGTATCGTGTAGAGTGGAAATGGTCGAAATCAAAGTCCTAGTGAGAAGGACAAACGCTCTTTCTTCTTGGGACCTTGCTATGCGACGGTGAATGGGACCCGCTGCTATCTCTGAGATTGAAGCTAGCACTTCCTGGTCAAGCTAGCAAGGGGTGTTCGTGGGGTCGATCTTCAATCTTACAGTGGACTAACCAATGGATAAAAGTCCAACGGCTGAACGACTGACTGACTCATGATTAGCTCAACACTCACAACTATTCATTTCCCATGAACCTGAGAAGACGAAGGAATGGATAGTTGCGATTCTATTTGGACGTGCTAAAACAAGTTCATTTCACCGGATCAACGGACTGCGGAGGATAATCGGCAGTGATGTCTCGTGGTTTTCGATTCAAGTTTGGGAACCCAAACCTGGAGGTGAAAATAGATGTGCACAGTGCTACTCTTGCAGATGCAGAGAGAACTGAGTCTAGGGATGAACACGAAAATCGTGATGGGAGCTGCTAACGACATTGCATTTGGATATATGTGCCCCAGCCTTGGATGCAAGACCGTTGAAAGCATTCACAACGGATTCAGAACATGTTTTACAAATGGTGTACCGCGAGGAAACAAACCAGCAGCGTTCATGTAGCGACCATGCAGGTGTAGATAGAAGGGTACTCATACCCTTCTATCAAATGAGCAATGTATGAAGGCTAGACACAGGAATTGGGTTCTGAGGAAGGTTTTATTTTTCTAGAGTTGTTTTTTCATCACTGGTCCCGGATCAGGGGTTAAACCCCCAATCCGAGTTGACAAGGGATGTGTCTCTACAAAGGGATACAACCCCTACAGTGGGTCACACCCATTGAACATCTCAGTCCTAACTATAAGGACTCTAACTGCACTAGTCCGCACAGACAGGAAGTAGGGAGTATAACTGTATTCTAACACTCCCACTTACTACCTACTTACTTCTCTCTTCCTCATTTTCAACGAACAAACCCAAATTCTGACTGATACCAATGCCTCTCTTTAGCTAATGATTTTGTCATATCGTCGTTGGAAGATGAACTAACTTCACTAAATTATTTGCGACTAGGTCCTTGACAAAATGATATCTAACATCAATGCGCTTTGATCATTCATGATTCTTCTGGTTCTCAATTTGTGCAATAACACTTTGATTATCTCAGAATAGTTTTGTCGACTCCACGTCAAAGCCCAGATCATTCAACAATCCTCTCAACCACAAAGCTTCAGCTCCAGACTTGGACAACGCCTTATACTCTGCTTTTGTATAAGAAAGTGCTACTGACAAAGATTCTGTGATAATCAAAGTATTATTGCACAAAAAGGAAATCAAAAGAGTCATGAGAGATCAAAATTGATATCAGATATCATTTTATCACGA

CDS

>Mapoly0023s0090.1
ATGTCGATGCTTTCTACGCTGGTGGATGCACTAGATGTGCCAGAAGGTGCTTCAGTACCAAGAGCAGGAGTTTTTCAGCCCAAAGTCAAAGCTCGGGTCAGGAAGGGTGGAGGTCGTGGTGATGCCGGTGCTAGCGTAGCTGTCAAAGCTCCTCCAGCTGCGCCGGCAGCAGAAAAGCCTGTTTCCGCATTGCCTGTCGCGAGCGATACCGAGCCTCTTGATGGCAACCAAAACAATGCGGAAGAAAACGAGATTTCGCAACCGGATTTTAAAGTTCCCGATGCTCCACTGTCGATAGAGGAAAATTGTGTCCCTGAACCATTACTCCCGATAACGTCTTCTACGACTACATTAGAAGAAACTGTCGGTGTGATCGATAGTGTATCCACGGAGGTAACAAAAGTGACATCTCCTAGCCGAACTTCGTCGATCGAACCTGCAATTCACTCGTCGCCTGCTGCCGAGGACGGCAGTCTTCTCTTACAGGCTGAAGATGATGTCATTGCTGCCATTAACGCTCCAGAAGTTTCCCCTCCCGTTGCTGTGAGATCAAATTTTCCTCTGCCGTCTTTCACTACGGCAACTGAAGAAAATGAGGACACACAAGGAGACGCCTTGCCCAGGTCTGGGGAACCTTCCAGCAAGGGCATAGTGCAACCTACAAATGATGAAGAAGGTGGCCCAAATGGGGTCATTGAGCGGGCAAGAGAGAATAAGTTCAAAAAGTCTGCCAGGAAAGTCAGGAAAACAGAGGTTGCCACTCCCACTACAAGCTCCAAAGAAGCAGAAGTGGTTGATGATGACCTGGAAGAAACTCTGGTGACTCTCGACGATGAACTAATGGCGGAACTTGGCTTGCAAGAGGAAGATCCTCCACTAGACCCAGCCGTACAGAGAAGGAAGCGGAAGAGAGCATTTCCGCATGCTTCTAGTCGGCCGAGACGAGTTCAAGAGGATGTTGGTGGTTCGAGTAAAGGCGGACAGTCGAGCAAAACAAACTATGACCTTTCAAACCCCGGCACACTGCCATTGCGCGAAGTGATAAGAAGAGCCGAGAATATTGAGCGGAAGAAAGCGAAGGATGAGTTGGCTAAGAAGTCTTTACTAGACATTTCGAAACCTCGAGAACGAGAAGTAGTTAGAGAGGCCGAACCTCAGAGAGATGTCCTTTCTCTTGCGCCACAAGTACAAGTGATCAATGGGCGCATTGTGGTAAACGAACAGAGTCTTACAGTTGGTGCCTACGCCACATCTGCTCAAGATACAGACAAGTACACGAGGGTTGAAGAGAACGCTTCTAGACTCAACTACCATACTTACTCTAATCGGACAGTTACGGAAAGATGGAAAGCGGAGGAAACCGACATTTTTTATAGAGCTATTAGACAGTTTGGTACCGACTTTGATCTGATAAAGAACCTTTTCCCAAACCGAACACGGCGGCAGATCAAAGCGAAGTACAAGAAAGAGGAGAATTCGAATCCACGACGTGTGTCAGATGCTTTAACATATCGACCGAAAGATCAATCTCATTACGAGGATTTGCTTGTTCGTATGAAGTGCGATGATCTTATCCAAGACAATTCCGACCCTTTTGCAAGTATTCTCGCTTACACTGCAGATAAGGTTGAGAAGACAGATGTAACCGACAAGGTCGAAGTCGAAGAAACTCAGACCGAGGAAGAAATTCCGGCCAGTATCGTGGAGTAG

Protein

>Mapoly0023s0090.1
MSMLSTLVDALDVPEGASVPRAGVFQPKVKARVRKGGGRGDAGASVAVKAPPAAPAAEKPVSALPVASDTEPLDGNQNNAEENEISQPDFKVPDAPLSIEENCVPEPLLPITSSTTTLEETVGVIDSVSTEVTKVTSPSRTSSIEPAIHSSPAAEDGSLLLQAEDDVIAAINAPEVSPPVAVRSNFPLPSFTTATEENEDTQGDALPRSGEPSSKGIVQPTNDEEGGPNGVIERARENKFKKSARKVRKTEVATPTTSSKEAEVVDDDLEETLVTLDDELMAELGLQEEDPPLDPAVQRRKRKRAFPHASSRPRRVQEDVGGSSKGGQSSKTNYDLSNPGTLPLREVIRRAENIERKKAKDELAKKSLLDISKPREREVVREAEPQRDVLSLAPQVQVINGRIVVNEQSLTVGAYATSAQDTDKYTRVEENASRLNYHTYSNRTVTERWKAEETDIFYRAIRQFGTDFDLIKNLFPNRTRRQIKAKYKKEENSNPRRVSDALTYRPKDQSHYEDLLVRMKCDDLIQDNSDPFASILAYTADKVEKTDVTDKVEVEETQTEEEIPASIVE

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>