Mapoly0024s0106



Description

(UnKnown)

Reference DB

Database ID Description
OrthoMCL OG5_244115

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH20 transcription factor, bHLH Mapoly0024s0106.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0024s0106.1 scaffold_24:1401959..1403827  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0024s0106.1  

Gene structure:

mRNA scaffold_24:1401959..1403827  ( + strand )
CDS scaffold_24:1401959..1403827  ( + strand )

Sequences:

Gene

>Mapoly0024s0106.1
ATGGAATACCAACCTTACGGCCTGCAAGAGATCGTTGTGGATGCGCCCTACTTCGAAGAGAGGGGATTTGGGTCATTTGGGCACCTGGGCGGTGAGAGTAATCATCTGCACTTGCCTATGGCCATCTCTCAGTGGTCGACGACCGATCCTGCCATATTCCAAGTAAATGACCAAGCAGCATGGAACTCCAATAGAGTGAGGACGCACTTCCAGCCCACAGGCACCGCCGGGGGACTTTACGATATGTGCGTTCAGTCGTCAACGTCGTCGCAACATGTAGTAAATGTTGCTCAGAGCAACAATTGCCAACAGCTCATTTCCATGGACACGCAGCAGGTGCAGCCGCATGCGACCGGCCCCGTCAACAGCTCGGGGGACCCGAACTTTCCAGTCGGCGGGGATATTTTGCCGCTGATGCATCAAATGCTCTTCAATCACTTCATGATACAAGACCACCGCTGCACCGGCGATCAAATGCCACAACTGATCAGCGACTTTTCAGCTCAGCAGCCGTGCTTGTATTCTTCGTCTAGTGAATGCCTGCATGATGCAGACTCGTCCGGCAGTTCTGGAGCCCGAGATTACGCGTTCCCGAGCTCGGCCATCACCGGCTGCTCGTCCGAAGAAATCAACTGGCGGAATTCAGATGTAGTACACGGCAATTTTGCGGCGTCTTCTGCAGGGTTCCACATTGAGGAGCTTTACGACGAGTCTTCTTCGGTCCCCGCGATTGGCCAAGTTGATATGGCCGACTCGAACGGCCACGGGCAGTCGTCGCCTCTGAGTCTTGTAATGCAACGCAACAATGCCAACCCTCTGATCAGGCGCACGCCGAACGTTTCTTGGGCCATGACGGGCGCTGAATCTGATAGCAGCGCAGCGGCAATGACCGTGAATCATTGCTCAACCCTAGATCCGCTCTTGAATGTTGCGAGCTTTCAAGACATAAGCCCGTCGCCGTGCCCGCCCCCTTACAAGCGCGCTAGACTCAGCTATAACTCAGCTTCGGCGGTGGAGCCCAACAGCAGCAGCATGCTCAGTATTCCGCCCGCCAGCAACACCGCCGCGAGCACCACCGTCGGCACGAGCAGGCCCCTCGTCTCGTCGTCGGGCTCCTCGTTCGGCCACCATCGCAACATGGTGGCGGTGGGCAGCTCCGACTATCCGATGACCACATTGAATGTGGCCGATGCTCTCTACCGAGATCTCCACTTTCCCAACAGACAACAACTGTCCGCCAGCAGCCTCCATCACCAGCAACCCAGCAGCTGCATCATTCAGGAAATTTCCACCGGAGGCGCCGTAAGATATGTGTCTCGCAAGGACTCGGCCTTGGTGGATCATGATATGTCGAGGGCGACGTCGAACCGAAAGCATAATGCTACGTCGATAGAGCCTCAGAGCGTGGCGGCTCGCCATCGGCGTAAGAAGATCAGCGAGAGGGTCAGGGTCTTGGAGAAGCTTATTCCTGGAGGAAATAAGATGGACACGGCTTCGATGCTGGATGAAGCGATTGAGTACGTGAAGTTCCTGCAGCTGCAGGTGGGTCTTCTTGAAAAATTGGGCGAGTTGCCCGACGGCACTAACGTGAACAACCACGGGGGAAACAGAAGTCAGATGCAGCAGGGCTCTACGTCATCCTGTCTGATAACGAATGGAACCAGTGGAGGAGGAGCAGGAGTGAGTTCGTCCAACTATCATGGATCATCGAATGTCTCCCGACCCACCCCGACAATGCCCGCAAGACCGACGACTAGCCCACTGATTCTGTCGGAAATCTTACAACAACAGCTCTTCAAGCAGAAGCTCTGCCTTGTGTCCATCAGGCAGTACCCTTCCGGAGGTTCGCCATCGGGATCATACGCGTGA

mRNA

>Mapoly0024s0106.1
ATGGAATACCAACCTTACGGCCTGCAAGAGATCGTTGTGGATGCGCCCTACTTCGAAGAGAGGGGATTTGGGTCATTTGGGCACCTGGGCGGTGAGAGTAATCATCTGCACTTGCCTATGGCCATCTCTCAGTGGTCGACGACCGATCCTGCCATATTCCAAGTAAATGACCAAGCAGCATGGAACTCCAATAGAGTGAGGACGCACTTCCAGCCCACAGGCACCGCCGGGGGACTTTACGATATGTGCGTTCAGTCGTCAACGTCGTCGCAACATGTAGTAAATGTTGCTCAGAGCAACAATTGCCAACAGCTCATTTCCATGGACACGCAGCAGGTGCAGCCGCATGCGACCGGCCCCGTCAACAGCTCGGGGGACCCGAACTTTCCAGTCGGCGGGGATATTTTGCCGCTGATGCATCAAATGCTCTTCAATCACTTCATGATACAAGACCACCGCTGCACCGGCGATCAAATGCCACAACTGATCAGCGACTTTTCAGCTCAGCAGCCGTGCTTGTATTCTTCGTCTAGTGAATGCCTGCATGATGCAGACTCGTCCGGCAGTTCTGGAGCCCGAGATTACGCGTTCCCGAGCTCGGCCATCACCGGCTGCTCGTCCGAAGAAATCAACTGGCGGAATTCAGATGTAGTACACGGCAATTTTGCGGCGTCTTCTGCAGGGTTCCACATTGAGGAGCTTTACGACGAGTCTTCTTCGGTCCCCGCGATTGGCCAAGTTGATATGGCCGACTCGAACGGCCACGGGCAGTCGTCGCCTCTGAGTCTTGTAATGCAACGCAACAATGCCAACCCTCTGATCAGGCGCACGCCGAACGTTTCTTGGGCCATGACGGGCGCTGAATCTGATAGCAGCGCAGCGGCAATGACCGTGAATCATTGCTCAACCCTAGATCCGCTCTTGAATGTTGCGAGCTTTCAAGACATAAGCCCGTCGCCGTGCCCGCCCCCTTACAAGCGCGCTAGACTCAGCTATAACTCAGCTTCGGCGGTGGAGCCCAACAGCAGCAGCATGCTCAGTATTCCGCCCGCCAGCAACACCGCCGCGAGCACCACCGTCGGCACGAGCAGGCCCCTCGTCTCGTCGTCGGGCTCCTCGTTCGGCCACCATCGCAACATGGTGGCGGTGGGCAGCTCCGACTATCCGATGACCACATTGAATGTGGCCGATGCTCTCTACCGAGATCTCCACTTTCCCAACAGACAACAACTGTCCGCCAGCAGCCTCCATCACCAGCAACCCAGCAGCTGCATCATTCAGGAAATTTCCACCGGAGGCGCCGTAAGATATGTGTCTCGCAAGGACTCGGCCTTGGTGGATCATGATATGTCGAGGGCGACGTCGAACCGAAAGCATAATGCTACGTCGATAGAGCCTCAGAGCGTGGCGGCTCGCCATCGGCGTAAGAAGATCAGCGAGAGGGTCAGGGTCTTGGAGAAGCTTATTCCTGGAGGAAATAAGATGGACACGGCTTCGATGCTGGATGAAGCGATTGAGTACGTGAAGTTCCTGCAGCTGCAGGTGGGTCTTCTTGAAAAATTGGGCGAGTTGCCCGACGGCACTAACGTGAACAACCACGGGGGAAACAGAAGTCAGATGCAGCAGGGCTCTACGTCATCCTGTCTGATAACGAATGGAACCAGTGGAGGAGGAGCAGGAGTGAGTTCGTCCAACTATCATGGATCATCGAATGTCTCCCGACCCACCCCGACAATGCCCGCAAGACCGACGACTAGCCCACTGATTCTGTCGGAAATCTTACAACAACAGCTCTTCAAGCAGAAGCTCTGCCTTGTGTCCATCAGGCAGTACCCTTCCGGAGGTTCGCCATCGGGATCATACGCGTGA

CDS

>Mapoly0024s0106.1
ATGGAATACCAACCTTACGGCCTGCAAGAGATCGTTGTGGATGCGCCCTACTTCGAAGAGAGGGGATTTGGGTCATTTGGGCACCTGGGCGGTGAGAGTAATCATCTGCACTTGCCTATGGCCATCTCTCAGTGGTCGACGACCGATCCTGCCATATTCCAAGTAAATGACCAAGCAGCATGGAACTCCAATAGAGTGAGGACGCACTTCCAGCCCACAGGCACCGCCGGGGGACTTTACGATATGTGCGTTCAGTCGTCAACGTCGTCGCAACATGTAGTAAATGTTGCTCAGAGCAACAATTGCCAACAGCTCATTTCCATGGACACGCAGCAGGTGCAGCCGCATGCGACCGGCCCCGTCAACAGCTCGGGGGACCCGAACTTTCCAGTCGGCGGGGATATTTTGCCGCTGATGCATCAAATGCTCTTCAATCACTTCATGATACAAGACCACCGCTGCACCGGCGATCAAATGCCACAACTGATCAGCGACTTTTCAGCTCAGCAGCCGTGCTTGTATTCTTCGTCTAGTGAATGCCTGCATGATGCAGACTCGTCCGGCAGTTCTGGAGCCCGAGATTACGCGTTCCCGAGCTCGGCCATCACCGGCTGCTCGTCCGAAGAAATCAACTGGCGGAATTCAGATGTAGTACACGGCAATTTTGCGGCGTCTTCTGCAGGGTTCCACATTGAGGAGCTTTACGACGAGTCTTCTTCGGTCCCCGCGATTGGCCAAGTTGATATGGCCGACTCGAACGGCCACGGGCAGTCGTCGCCTCTGAGTCTTGTAATGCAACGCAACAATGCCAACCCTCTGATCAGGCGCACGCCGAACGTTTCTTGGGCCATGACGGGCGCTGAATCTGATAGCAGCGCAGCGGCAATGACCGTGAATCATTGCTCAACCCTAGATCCGCTCTTGAATGTTGCGAGCTTTCAAGACATAAGCCCGTCGCCGTGCCCGCCCCCTTACAAGCGCGCTAGACTCAGCTATAACTCAGCTTCGGCGGTGGAGCCCAACAGCAGCAGCATGCTCAGTATTCCGCCCGCCAGCAACACCGCCGCGAGCACCACCGTCGGCACGAGCAGGCCCCTCGTCTCGTCGTCGGGCTCCTCGTTCGGCCACCATCGCAACATGGTGGCGGTGGGCAGCTCCGACTATCCGATGACCACATTGAATGTGGCCGATGCTCTCTACCGAGATCTCCACTTTCCCAACAGACAACAACTGTCCGCCAGCAGCCTCCATCACCAGCAACCCAGCAGCTGCATCATTCAGGAAATTTCCACCGGAGGCGCCGTAAGATATGTGTCTCGCAAGGACTCGGCCTTGGTGGATCATGATATGTCGAGGGCGACGTCGAACCGAAAGCATAATGCTACGTCGATAGAGCCTCAGAGCGTGGCGGCTCGCCATCGGCGTAAGAAGATCAGCGAGAGGGTCAGGGTCTTGGAGAAGCTTATTCCTGGAGGAAATAAGATGGACACGGCTTCGATGCTGGATGAAGCGATTGAGTACGTGAAGTTCCTGCAGCTGCAGGTGGGTCTTCTTGAAAAATTGGGCGAGTTGCCCGACGGCACTAACGTGAACAACCACGGGGGAAACAGAAGTCAGATGCAGCAGGGCTCTACGTCATCCTGTCTGATAACGAATGGAACCAGTGGAGGAGGAGCAGGAGTGAGTTCGTCCAACTATCATGGATCATCGAATGTCTCCCGACCCACCCCGACAATGCCCGCAAGACCGACGACTAGCCCACTGATTCTGTCGGAAATCTTACAACAACAGCTCTTCAAGCAGAAGCTCTGCCTTGTGTCCATCAGGCAGTACCCTTCCGGAGGTTCGCCATCGGGATCATACGCGTGA

Protein

>Mapoly0024s0106.1
MEYQPYGLQEIVVDAPYFEERGFGSFGHLGGESNHLHLPMAISQWSTTDPAIFQVNDQAAWNSNRVRTHFQPTGTAGGLYDMCVQSSTSSQHVVNVAQSNNCQQLISMDTQQVQPHATGPVNSSGDPNFPVGGDILPLMHQMLFNHFMIQDHRCTGDQMPQLISDFSAQQPCLYSSSSECLHDADSSGSSGARDYAFPSSAITGCSSEEINWRNSDVVHGNFAASSAGFHIEELYDESSSVPAIGQVDMADSNGHGQSSPLSLVMQRNNANPLIRRTPNVSWAMTGAESDSSAAAMTVNHCSTLDPLLNVASFQDISPSPCPPPYKRARLSYNSASAVEPNSSSMLSIPPASNTAASTTVGTSRPLVSSSGSSFGHHRNMVAVGSSDYPMTTLNVADALYRDLHFPNRQQLSASSLHHQQPSSCIIQEISTGGAVRYVSRKDSALVDHDMSRATSNRKHNATSIEPQSVAARHRRKKISERVRVLEKLIPGGNKMDTASMLDEAIEYVKFLQLQVGLLEKLGELPDGTNVNNHGGNRSQMQQGSTSSCLITNGTSGGGAGVSSSNYHGSSNVSRPTPTMPARPTTSPLILSEILQQQLFKQKLCLVSIRQYPSGGSPSGSYA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>