Mapoly0025s0025



Description

coronatine-insensitive protein 1

Reference DB

Database ID Description
KEGGORTH K13463 Coronatine-insensitive protein 1
KOG KOG1947 Leucine rich repeat proteins, some proteins contain F-box
OrthoMCL OG5_156629
PANTHER PTHR23125 F-BOX/LEUCINE RICH REPEAT PROTEIN
PANTHER PTHR23125:SF257

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpCOI1 Receptor of OPDA-derived ligand Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0025s0025.1 scaffold_25:505971..510163  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0025s0025.1  

Gene structure:

mRNA scaffold_25:505971..510163  ( - strand )
three_prime_UTR scaffold_25:505971..506704  ( - strand )
CDS scaffold_25:506705..507478  ( - strand )
CDS scaffold_25:507814..508303  ( - strand )
CDS scaffold_25:509669..510150  ( - strand )
five_prime_UTR scaffold_25:510151..510163  ( - strand )

Sequences:

Gene

>Mapoly0025s0025.1
TGGGAGGTAAGCGATGGAGGTGAGGGGTCCGGCCGGGGCGAATAGAGTTTCGGATGAGACACTCGGGTGCATATTTGCGCATCTCGACAGCCCTGGCGACCGAAAAGCCGTCTCGCAGGTCTGCCGTCAGTGGCGGCGTGTGGATGCGAATACGAGGAAGCATGTGTCCATAGCTAACTGTTACAGCGTCGCTCCTGCTGCTCTGTCCCGGAGGTTCCCGAACTTACAATCACTGAAGATTAAGGGCAAGCCTCGAGCTTTCGAGTATGAGCTGCTCGTTCCGAACTGGGGTGGATATGCCAGGCCCTGGGTGGCAGAGGTTGCTCGAGGCTACGCGCAGAGGTTGCAGAGTTTGTGGTTGCGTCGTATGCATGTTACCGATGCTGATCTCACATTGCTCGCCCAGTCTTGCTCGGAGTCGCTACAAGTTCTCAAGCTGCACAAATGCTCGGGTTTTTCCACTTCCGGCATACATGACATCACCACATATTGCAGGTACACTTTGACAGCAGCGTATTTATTTATATCCCGCTTTCGGTCCTTTTGGTCTTTTGCTATTTTCAGTCTCCTTCAGTCTCCTTTCACATATCCTAAAACGACTTAAACGCGCAGCTCCATTTTGCATTCTGTGACCTGGGATATCAATAAGTCTTAAGCTGGATACGTCCATGAGTTCTCTCGATAGCGGTCACTCTGGTGCTGGAGGCATGACTGTTTCTGAGAAGCAGGCCGTGGACAGAACGTTCCCTGGTAGTCGAGCAAATAGGGAGTATTTCCCAGCTGGACGTAGCCTCTTCAACACCGACTTACTGACGTATTCTCTCAGTCGACACGAGTGAGAGAATACGTCAGTAAGTCGGTGTGGCTGTGGACTGTGAAAACTGTTTTTTTTTTTTTGACAGTGCTATGGTCATAAGCTGTTAAATAAATGGTTGACAGCCAGAGGTAAATCTCCGACTGGGAACCACTTGCACGCACCGAAACACATGAATGCAATGAAGATTCACATCCTCCTGGCTAGTGTGAACTGCTTATAGGAGCCAATGTGATGACCCTAAGCTTCAGGTTCATCCAATATTCTCGTCTGCACCTTGTTCAACAATGTAGATCCCTCAGCATTGTGAAGGTTTGGAAGTACGTAATTTTCCCTGTTGATGTGGCCAACAGGTTGACCAATACGTGGATCTCGAACCGTTCCATAATTTAAACAGAACTGTAATTTTAAGAGAACTGGTGTGCTTCTTCCCATGTAGTGTCAGGAAAGTTGACCTCAGGCCGTATCAACCGAGGCTATGATATCGAATGAGTAACGTTTTGGTTTCCTGATCAGATGGCCACCAATGTTTGTCGACATGTCTTAGATTCTGTGGTTATAACTAAAATGAGGTTGCTTTCACGAAGGTGTCGTCGTTTCATCTCATTTAGTGTCATTCGTGAATGTTAAATCAGTCAACCAACTTGATGTTATTTAAAGAAGTAATTTGTTTTGGACGTCGGTAGATGGCTGCTATTATGTCTTGGTAAGTGAAGTGAAGGTTCTTCAGAGCTTATAGGATGTACCTTTATGTCGTGTACGAACATATCTGACACGTGTATCCGCAGTAATGTTTCGGTATATGATCATTCTCAACTTAAGTGTGACTTCAGTGCTCTTTTTTTTCTATAGGCGTATTCTAGCATAGTCAGTGTTATCCCATACTGCTGCTGCTGTAAGTAAAGTTTTGGTCGATTCAATGTCGGCTATACATTCTGGAATTTTATTGCTTACAGTATCATAGGATCGGGAAACAAGATCAGAGTTTCATATCGAACTAGAGCTTGTGAACACTCTTCTAACTCAGCCTACTTCTTGGATTTCAGATCTCTCAGGGTGTTATATTTGGAAGAGAGTGCTATCAGTCCCTCGGAAAGAGGCGGTGAATGGTTACATGAGCTGGCTCTCAATAATACAACGTTGGAGGATTTGAACTTTCAGTACTTGCATGAGTTCGATGACATCAGCATTACTGATTTAGAGGGCGTCGTAGAGAACTGCAGATCCTTGAGATCTCTCAAAGTCAGCGAGATCGACATTTTGGATATGAGGGGTGTCTTGAGCAAAGCCCATAATTTGAGAGAACATGGAACAGGATGTTGTGCCAGTATCGGAGACCCCCTAAGGGCGGGAGGTGTTGACTTGCCTAGAACTATCATCGCTCTTTCAGGACTTTATGAGTTGAATGAGATTGGACTTCCCATGGTGGCCAATCTTCTCCCAAATCTGAAGAAGCTGGATCTCAAGTACACTCTTCTGAGTGCTCAGGGTCACGTTCAGATTCTTAGTCATTGCGTCAGTTTGGAGGAATTGGAGGCATGTAACTTAAGCTTGAGATCTTTAGTCTTTTGCAGCAAGTATAGAATAATATATTATGACTTGTATGAGTTCAGATGTCTTTAAGATTTTGGATTTTGGATGTGGATCTTGTCTATTCTGGTAGAGTTTCAAGCCAGCGCTGAGGAGAAAGCCCTGTAGGGACCGTCAATCTGACTTGAAGTAGGACCTTGGCCGCTTTTATACGTGGCGTCTCTCATCGTTCCATGGTTGCAATTAAATAATTATTTGTGTCCTTGCTTGAGAGAGTCTCTTTCTTGTTCTTTCCCTTTTATATTTAGCTGACTATCTAATTTTATCTCTCCTGAATGCAGGTGAGAAATGTGCTTGGAGATGACGGACTCATAATGGTTGCTAGAACCTGCAGGCAGTTGAGGCGAATCCGAGTTGATGAGAGTGATGGGGAAGGTTTCCTCTCCCCGTTAGGCATGATCCCCATCGCGCAAAATTGCACTAAGCTCGAGTTTCTTGTAATGTATGTTGTGGACATCAACAATGCTACCCTCAGAGCATTCGGTGAAAACTGCCCAAATATGAAGGATTGCCGTTTCGTTCTACTCTCGACCTTGGGAACGGTGGATGATTTACCTCTGGACCAAGGTGTAAGATGTTTGTTAAAAGGGTGTCGGAAATTAACCCGATTTGCGTTGTATGTCCGGCATGGGGGACTCACTGACGAAGGCATGGGTTACATCGGGGAGTATGGAGGCAATCTCAAGTGGATCTTACTTGGCTGTGCCGGAGAAACCGATCAGGGTTTACTTCGTTTAGCGGTGGGTTGTCAGTCATTGGAGAGGCTGGAGATGAGAGATTGTCCCGTAACTGAGGCTGGACTTGCAACTGCAGCTGTGAGCATGAAGAACAGTCTGAAATACATGTGGGTGCAAGGGTACCAGGCAACTGATGCTGGTGGTAGACTTTTGGCGAGGGCTCGCCCTTTCTGGAATGTTGAAATCTGTTCCGGATCGTCTCAGTTGCCAGGCCAGCTTCTGGCGTACTGCACTCTAGCTGGGCCTCGAACGGATTGTCCACCAGAAGTGGATTTGTTATCTGAGATTGCACCAGCGCGGGAAAATTGGGAACTATGATGTGAGCGCTGTGGGCGAGAACTTCATGAAACTTGTCAGCTGCAGGCGCTATAGCATCTTTTTTATTGCTTGTCTGGATCTAGGCTGTGTTTTCACTGATGTACACACCATTTTAACCGTATGCTTAACTCGCTGCTAGAATCAGCATCCTTGGACGGCCGCCACAGTAAAATTAGTAAGTCCTCGCAGCTCAACAGCACTGTAACATAGTTTGTCTTCGCAGACTATTAAGTATTTATGTGGCCTCTGTAGTTTCAACACTGACAGCAGATTATGGTTCTTGTCATTCTGGAGTTTCATTTTCCCTCACCATGTCAAGGTCAGTTTTGGGCAAGATATTCAGGTTGAGTACATTCATACTTAGCAGCTAAAATAGATATCAAAGTCATCAAAGTTATTATCTATATTATATATAGGTTGTGGTACTAAATGTTTCTGTTATCCATGTCAGTCTGCTTGGTGGTTTTTTGTAGTTAGTAAGTGGAGAGGGATTTGTGTAGTCCTTCGATTTTATGCTAGCGGATGTCAGAAAGGTGGTTGACTTCGTGCTCTTGTCAGTCCACCAACTGTTTTGTGCTGTGTTGGTCCCAGAAGTAAAGCGGCACGTTACATGACGTTGTTTATCTGGCACACCAATTCCTGAGATGCCTATCTAACTCCGAGTTTGATTTCTGTGTCGAATCATTAGTGTCAGGTCGATGTTTTTGCATTGGCGTTGTTTGACCTGATGTTTG

mRNA

>Mapoly0025s0025.1
TGGGAGGTAAGCGATGGAGGTGAGGGGTCCGGCCGGGGCGAATAGAGTTTCGGATGAGACACTCGGGTGCATATTTGCGCATCTCGACAGCCCTGGCGACCGAAAAGCCGTCTCGCAGGTCTGCCGTCAGTGGCGGCGTGTGGATGCGAATACGAGGAAGCATGTGTCCATAGCTAACTGTTACAGCGTCGCTCCTGCTGCTCTGTCCCGGAGGTTCCCGAACTTACAATCACTGAAGATTAAGGGCAAGCCTCGAGCTTTCGAGTATGAGCTGCTCGTTCCGAACTGGGGTGGATATGCCAGGCCCTGGGTGGCAGAGGTTGCTCGAGGCTACGCGCAGAGGTTGCAGAGTTTGTGGTTGCGTCGTATGCATGTTACCGATGCTGATCTCACATTGCTCGCCCAGTCTTGCTCGGAGTCGCTACAAGTTCTCAAGCTGCACAAATGCTCGGGTTTTTCCACTTCCGGCATACATGACATCACCACATATTGCAGATCTCTCAGGGTGTTATATTTGGAAGAGAGTGCTATCAGTCCCTCGGAAAGAGGCGGTGAATGGTTACATGAGCTGGCTCTCAATAATACAACGTTGGAGGATTTGAACTTTCAGTACTTGCATGAGTTCGATGACATCAGCATTACTGATTTAGAGGGCGTCGTAGAGAACTGCAGATCCTTGAGATCTCTCAAAGTCAGCGAGATCGACATTTTGGATATGAGGGGTGTCTTGAGCAAAGCCCATAATTTGAGAGAACATGGAACAGGATGTTGTGCCAGTATCGGAGACCCCCTAAGGGCGGGAGGTGTTGACTTGCCTAGAACTATCATCGCTCTTTCAGGACTTTATGAGTTGAATGAGATTGGACTTCCCATGGTGGCCAATCTTCTCCCAAATCTGAAGAAGCTGGATCTCAAGTACACTCTTCTGAGTGCTCAGGGTCACGTTCAGATTCTTAGTCATTGCGTCAGTTTGGAGGAATTGGAGGTGAGAAATGTGCTTGGAGATGACGGACTCATAATGGTTGCTAGAACCTGCAGGCAGTTGAGGCGAATCCGAGTTGATGAGAGTGATGGGGAAGGTTTCCTCTCCCCGTTAGGCATGATCCCCATCGCGCAAAATTGCACTAAGCTCGAGTTTCTTGTAATGTATGTTGTGGACATCAACAATGCTACCCTCAGAGCATTCGGTGAAAACTGCCCAAATATGAAGGATTGCCGTTTCGTTCTACTCTCGACCTTGGGAACGGTGGATGATTTACCTCTGGACCAAGGTGTAAGATGTTTGTTAAAAGGGTGTCGGAAATTAACCCGATTTGCGTTGTATGTCCGGCATGGGGGACTCACTGACGAAGGCATGGGTTACATCGGGGAGTATGGAGGCAATCTCAAGTGGATCTTACTTGGCTGTGCCGGAGAAACCGATCAGGGTTTACTTCGTTTAGCGGTGGGTTGTCAGTCATTGGAGAGGCTGGAGATGAGAGATTGTCCCGTAACTGAGGCTGGACTTGCAACTGCAGCTGTGAGCATGAAGAACAGTCTGAAATACATGTGGGTGCAAGGGTACCAGGCAACTGATGCTGGTGGTAGACTTTTGGCGAGGGCTCGCCCTTTCTGGAATGTTGAAATCTGTTCCGGATCGTCTCAGTTGCCAGGCCAGCTTCTGGCGTACTGCACTCTAGCTGGGCCTCGAACGGATTGTCCACCAGAAGTGGATTTGTTATCTGAGATTGCACCAGCGCGGGAAAATTGGGAACTATGATGTGAGCGCTGTGGGCGAGAACTTCATGAAACTTGTCAGCTGCAGGCGCTATAGCATCTTTTTTATTGCTTGTCTGGATCTAGGCTGTGTTTTCACTGATGTACACACCATTTTAACCGTATGCTTAACTCGCTGCTAGAATCAGCATCCTTGGACGGCCGCCACAGTAAAATTAGTAAGTCCTCGCAGCTCAACAGCACTGTAACATAGTTTGTCTTCGCAGACTATTAAGTATTTATGTGGCCTCTGTAGTTTCAACACTGACAGCAGATTATGGTTCTTGTCATTCTGGAGTTTCATTTTCCCTCACCATGTCAAGGTCAGTTTTGGGCAAGATATTCAGGTTGAGTACATTCATACTTAGCAGCTAAAATAGATATCAAAGTCATCAAAGTTATTATCTATATTATATATAGGTTGTGGTACTAAATGTTTCTGTTATCCATGTCAGTCTGCTTGGTGGTTTTTTGTAGTTAGTAAGTGGAGAGGGATTTGTGTAGTCCTTCGATTTTATGCTAGCGGATGTCAGAAAGGTGGTTGACTTCGTGCTCTTGTCAGTCCACCAACTGTTTTGTGCTGTGTTGGTCCCAGAAGTAAAGCGGCACGTTACATGACGTTGTTTATCTGGCACACCAATTCCTGAGATGCCTATCTAACTCCGAGTTTGATTTCTGTGTCGAATCATTAGTGTCAGGTCGATGTTTTTGCATTGGCGTTGTTTGACCTGATGTTTG

CDS

>Mapoly0025s0025.1
ATGGAGGTGAGGGGTCCGGCCGGGGCGAATAGAGTTTCGGATGAGACACTCGGGTGCATATTTGCGCATCTCGACAGCCCTGGCGACCGAAAAGCCGTCTCGCAGGTCTGCCGTCAGTGGCGGCGTGTGGATGCGAATACGAGGAAGCATGTGTCCATAGCTAACTGTTACAGCGTCGCTCCTGCTGCTCTGTCCCGGAGGTTCCCGAACTTACAATCACTGAAGATTAAGGGCAAGCCTCGAGCTTTCGAGTATGAGCTGCTCGTTCCGAACTGGGGTGGATATGCCAGGCCCTGGGTGGCAGAGGTTGCTCGAGGCTACGCGCAGAGGTTGCAGAGTTTGTGGTTGCGTCGTATGCATGTTACCGATGCTGATCTCACATTGCTCGCCCAGTCTTGCTCGGAGTCGCTACAAGTTCTCAAGCTGCACAAATGCTCGGGTTTTTCCACTTCCGGCATACATGACATCACCACATATTGCAGATCTCTCAGGGTGTTATATTTGGAAGAGAGTGCTATCAGTCCCTCGGAAAGAGGCGGTGAATGGTTACATGAGCTGGCTCTCAATAATACAACGTTGGAGGATTTGAACTTTCAGTACTTGCATGAGTTCGATGACATCAGCATTACTGATTTAGAGGGCGTCGTAGAGAACTGCAGATCCTTGAGATCTCTCAAAGTCAGCGAGATCGACATTTTGGATATGAGGGGTGTCTTGAGCAAAGCCCATAATTTGAGAGAACATGGAACAGGATGTTGTGCCAGTATCGGAGACCCCCTAAGGGCGGGAGGTGTTGACTTGCCTAGAACTATCATCGCTCTTTCAGGACTTTATGAGTTGAATGAGATTGGACTTCCCATGGTGGCCAATCTTCTCCCAAATCTGAAGAAGCTGGATCTCAAGTACACTCTTCTGAGTGCTCAGGGTCACGTTCAGATTCTTAGTCATTGCGTCAGTTTGGAGGAATTGGAGGTGAGAAATGTGCTTGGAGATGACGGACTCATAATGGTTGCTAGAACCTGCAGGCAGTTGAGGCGAATCCGAGTTGATGAGAGTGATGGGGAAGGTTTCCTCTCCCCGTTAGGCATGATCCCCATCGCGCAAAATTGCACTAAGCTCGAGTTTCTTGTAATGTATGTTGTGGACATCAACAATGCTACCCTCAGAGCATTCGGTGAAAACTGCCCAAATATGAAGGATTGCCGTTTCGTTCTACTCTCGACCTTGGGAACGGTGGATGATTTACCTCTGGACCAAGGTGTAAGATGTTTGTTAAAAGGGTGTCGGAAATTAACCCGATTTGCGTTGTATGTCCGGCATGGGGGACTCACTGACGAAGGCATGGGTTACATCGGGGAGTATGGAGGCAATCTCAAGTGGATCTTACTTGGCTGTGCCGGAGAAACCGATCAGGGTTTACTTCGTTTAGCGGTGGGTTGTCAGTCATTGGAGAGGCTGGAGATGAGAGATTGTCCCGTAACTGAGGCTGGACTTGCAACTGCAGCTGTGAGCATGAAGAACAGTCTGAAATACATGTGGGTGCAAGGGTACCAGGCAACTGATGCTGGTGGTAGACTTTTGGCGAGGGCTCGCCCTTTCTGGAATGTTGAAATCTGTTCCGGATCGTCTCAGTTGCCAGGCCAGCTTCTGGCGTACTGCACTCTAGCTGGGCCTCGAACGGATTGTCCACCAGAAGTGGATTTGTTATCTGAGATTGCACCAGCGCGGGAAAATTGGGAACTATGA

Protein

>Mapoly0025s0025.1
MEVRGPAGANRVSDETLGCIFAHLDSPGDRKAVSQVCRQWRRVDANTRKHVSIANCYSVAPAALSRRFPNLQSLKIKGKPRAFEYELLVPNWGGYARPWVAEVARGYAQRLQSLWLRRMHVTDADLTLLAQSCSESLQVLKLHKCSGFSTSGIHDITTYCRSLRVLYLEESAISPSERGGEWLHELALNNTTLEDLNFQYLHEFDDISITDLEGVVENCRSLRSLKVSEIDILDMRGVLSKAHNLREHGTGCCASIGDPLRAGGVDLPRTIIALSGLYELNEIGLPMVANLLPNLKKLDLKYTLLSAQGHVQILSHCVSLEELEVRNVLGDDGLIMVARTCRQLRRIRVDESDGEGFLSPLGMIPIAQNCTKLEFLVMYVVDINNATLRAFGENCPNMKDCRFVLLSTLGTVDDLPLDQGVRCLLKGCRKLTRFALYVRHGGLTDEGMGYIGEYGGNLKWILLGCAGETDQGLLRLAVGCQSLERLEMRDCPVTEAGLATAAVSMKNSLKYMWVQGYQATDAGGRLLARARPFWNVEICSGSSQLPGQLLAYCTLAGPRTDCPPEVDLLSEIAPARENWEL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>