Mapoly0025s0044



Description

CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS // SUBFAMILY NOT NAMED

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_152936
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR23042 CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS
PANTHER PTHR23042:SF19 SUBFAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH49 transcription factor, bHLH Mapoly0025s0044.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0025s0044.1 scaffold_25:784787..788840  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0025s0044.2 scaffold_25:784787..788840  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0025s0044.1  

Gene structure:

mRNA scaffold_25:784787..788840  ( - strand )
three_prime_UTR scaffold_25:784787..785229  ( - strand )
CDS scaffold_25:785230..785460  ( - strand )
CDS scaffold_25:785687..786493  ( - strand )
CDS scaffold_25:786688..786815  ( - strand )
CDS scaffold_25:787058..787191  ( - strand )
CDS scaffold_25:787651..787937  ( - strand )
five_prime_UTR scaffold_25:787938..788840  ( - strand )

Sequences:

Gene

>Mapoly0025s0044.1
CGCCGGAGCTCGAGCCCAGGACGACGACGAGGTTCCGAGAAGGAGCAAGTCGATCGGGGAGTGGGTGGAACGCGAGAGATGGCCAGAGGCAATGCTGTGGCCGTGCGGTAGGTGTTTGCTCGGAGCAGTGGCAGAGGAGAGGAGAGGAGACGAGAGGAAGGATGCAGATCTCTAGCCGCGAGCAGGAGCATCCCGTAGTACCTTGTCCAGCCACTCCAGCCCCTCGACCGGCATTGAACTCTGTGTGTCGACAAAGAGTCTGTTGAAGCGGAGCAGGAGGATGACGAGATAAAGGCGCAGTGCAGTTCTGCCGGTGTCGATGTTCTTTGTAGGGCGTGGCGAGTTGTAGAGGTAGTTGTAGGCCTCGCCAGGCCAGGTCAGGTCCTGTCAGGTCGGACAGTGGCAGGAAAAGTGAATGCGGTAGAAAGTGACCAATTTTTTATGAGCATGCTGATGGCAGTCTCGTCTGCAGATTGACAAGAGAGAGAGAGAGAGTGTGTGTGTTCCTAGGGACTGAGAAGGAGGTGGAACTCGTAGAGACGTATTGGAGGAGGATGAAGAGGAACGGAGAAGAGTAGAGTAAGGCGGAGGAGCATCGAGCAGAAGAGGGGGAGATGTTGGTGCAGTGCATACGGGTGAGGGGGAGGAAATGACGTACGGATTTTTTGTTTCGAGGTTTATGCCTAGATGTGGGCATGACAGGAGCAGGAAGAATCTGGTGACCTAAAGTACCGTGGGGGTGAGTGGGTTCGCTATTGTGGAGAAGTTGGAGGTGAATGGTTGTGATTGTAGAGCAGTGGTAGTGATGGTTTGGGTCTGCAGCGCAGGGAATGAATGTGGGGGAAAATGGTGGGACCGGTGAATTACGGCCCTGGAAGGCGAAGATGATCAGAAGTGGAAGTCATGGCAGCTTCAAGTACAAATTCGTGGCTCCACACTTCGCTTCTCTCGCCCTCATCACAGCAACAATCAGCTCAGCATGCTCTTTACGCAACAGACCTGCCGATGCACCACCCGTCTTCGCATTTGGCTCAACAGCATCATGTAGGTTTAGGGCAGCAGGATCATCACCAGGAGCACCTTCCGTGCGACACTTTCTGTCAGCCTCTGCATCACTCCCTCAATCCTGACTTTCAGCACTCGGCCGAGAGCCATCAGTTGAACGGTTTCAATGGAGGAGTCGGGGGCAGGTTAGCAATTTTCAACCTCCCATTCCACTACTCTCGCAAACTTGGCCGCCTGTTCATTGACTTTCTCGTCGGAGATGGAGAATCTGCTCTCCATTCCGCTGTACCCAAAGTTCGTTCCACAACCCTCCTGAATACGTAGCAGCTTACCTTGCCACCTCCGATAGCAGTTTTTTAATTTCAAAGTGCATGTCATCTTCTTTCTTTCGTATATAGGAGAGAGAGGGAGAGAGAGCAGTAGGCCCTGCAGGTAACTGTCAAGTGGAGGGGGAACGCTAGTCCCCACTCCTCATGACATTCCAAATTTCTGCTTACTCCCTTCGATCGTCGCCTCATCCCTGTAGCTGTGGATACTTCGTTCAGCAAGCATTGATTTTCTATTGATTCGAGTATCAGGAGTCATCCTATTCTTCCGTAAATGTGATTACAGTTACTGAGTTTCACCTGAATGATGTCGTGCAGTTGCAGCGGTCGTGTTGGTGTTGGAGGAGAAAATGGAGGTCATGTGTCGGCCAGAAAGGTTCACAAGGCAGATAGAGAGAAGCTACGAAGGGATCGGTTGAATGAGCAATTTGCCGAACTTGCCGGTGTGCTAGGTGAGCTTTCTTCTTTGTGCAGATTCTTTTTAGATATATATTAGTATGACTTACGCGCTGTGGAATCTTCGAATGCTGTGCCGAGGTGTAGCAGGTACGGAAGTTTAAGAGTGATTTGATAAGCTTCTCGTTCGTCATCTGGTCTCAACCTAGAGCGGTTCTTTCAGTTTGATGGATATGGTTGCATACAATCGTAAGTTTTCTACGAATTAGAAGCTGACATGCCTCGTCTTGGATGAAAGATCCTGATCGGCCGAAGAATGATAAGGCAACGATACTCGGTGACAGCGTTCAAGTAGTTAAAGAGTTGCGGGCTGAGGTGAAACGTCTCAGAACCGAACATACTTCACTTCTCGATGAATCCCGGGATGTAAGCTTCTCACCGTTCTAAACTCTCAATAATCACGTCTTCACTTCTTGACGGACCTCTGAAGCCTGTGTCAAGCAATGCTTCCTGATTCTGCCGCTGATTTTAGATGTACTTTATTATCTACAGTCTCATCTCTACAAAGTCATGTTCGCAGGCTTTGAATATATTTCTCATTTTTACCTGATGTCTTGCAGTTGGCGCAAGAGAAGACCGAACTTCGAGAGGAAAAGGCCTCCTTGAAGAACGAGACAGAGCAACTACAAGGGCAACTTCAACAACGGCTACGGATTATGTTGCCTTGGATGGGAATGGATCCATCTCTAATGATGGGAGCTGCACCATATGCTTATCCCATGGCTGTTCCGCAGCCTGGTCCCCCTTCATCGGAAGGAACTCAGACCAGTACAGCACCTCCAGTGCCGCAGTCCGTAGTTGCTCCTGCTGCTTACATTCCTATGGCTCCCACAGCTCCGGGCACCTTCGCAGTTCATCCAGCTTTGCAAGCGTATACGATGTTTGGGAACAGACCCGGTGAAGGCGGGGCTCCTTATATGCCATATCCCCACTATCCCCCCCAAGTCAACTCGCACTCTCATGTGGAGAGGCCTTACGCCCAGTATCCCTCTCCCGTGCAGCCTCTCCCTGGTTATCTCATGCAAATGCAGCCTCACCAGGGCCAACCCCCTATAAGCGGTGCTCCGCCTGGGCCTTCGATGTATCGCTCTTATGGACCAGGCATGCCATTGATGCCCCCCCAACCTCAAGCTAATCAGCAAAATGTACAGGCTAGAGCAAGTCAGCATCCAGTTGCTCCTTACGCTCACTACCCTGCTTCTGGGATGCAACCTTATTCTGGACCGTCCCTGTCCTCATCCCCACAAGCTTCTCCTGGTCAGTCAGTCCAGACAACATTACAATTACAGACTCCCTCGCAGCCGCAACCCCAAAAGCCTTTCGAAGCCTCACCTGTCAATAGCACGGATGGATCTTCAAAAGCACAGGTAGATGCATAGATTTCATTCCTTTCTTTTCTAGATCAAAAGAATCGTCAACTAGGATCGTCTTGGAAGAGTGGATGCAAGTCCATTGTGATTCTTTTGCAGCAGGATGTGGAGACTGTTGTTGTGGGCTTGCATTGTTTTGGCACTAGAGCTTGAGCGGAGGTTGTTCAGATTGTCCTGCCAGTACGCTTGTAGCGTGTCTGATGAAGGACGTTTTTTATCACAGAGTGGAGGCTCGGGATCTGCTTCCTCTGGACATAAGAAAGAGCCCAAACAGGCAGCAGCGTCTGGAGTGTCTGACTCGATTGCAAGCTCTCCAATATCATCAGCTCCAGCAGCTTCTGTCTCATCTACTGGGAACGGAGGAGACGCTGGACATTTGGATACTGGAGCTTGTCCCAATAGGGATACATCCCAAACTCATGATACCTCTTTCGGGAGGCCACTTGTGAAATAGGTCCATCACCATCAACTTAGCACACCCATCAGCGGGTTATTTTCTGCTAGACGCCTTCTTTCCAGTCGCCAAGTCTCAAATTTTGTAAGTGCTGAGTACTGAGCCCAGTTTGTAATTATCCACGTGATATGTTGTGTACATCGGTAGATCTGTTGAGTTCATTGAGAACGTCATTCCTGTTTATGGTGAAGAAACACACAGTACTTCAACCAACTCTTCGAGCCACAAAAGCTCCCGGTTCAAGCCTTGGCTGGTCATTATGACGAAGCTTTTGGTTGGAATGTGGAAGTGTGTTTTTGCACTGAGCAGGCACTATGACAGTTGTTGAAATTGTCCTGCTGTCAATTTATTCCAGGATGGCCCGTCCTTGTCACGATTACCATGGTGCAAAACGTGCTGTCCAGCTTGCTCATCGGAGTAAAGAATTGAAAACGAATTTGGTC

mRNA

>Mapoly0025s0044.1
CGCCGGAGCTCGAGCCCAGGACGACGACGAGGTTCCGAGAAGGAGCAAGTCGATCGGGGAGTGGGTGGAACGCGAGAGATGGCCAGAGGCAATGCTGTGGCCGTGCGGTAGGTGTTTGCTCGGAGCAGTGGCAGAGGAGAGGAGAGGAGACGAGAGGAAGGATGCAGATCTCTAGCCGCGAGCAGGAGCATCCCGTAGTACCTTGTCCAGCCACTCCAGCCCCTCGACCGGCATTGAACTCTGTGTGTCGACAAAGAGTCTGTTGAAGCGGAGCAGGAGGATGACGAGATAAAGGCGCAGTGCAGTTCTGCCGGTGTCGATGTTCTTTGTAGGGCGTGGCGAGTTGTAGAGGTAGTTGTAGGCCTCGCCAGGCCAGGTCAGGTCCTGTCAGGTCGGACAGTGGCAGGAAAAGTGAATGCGGTAGAAAGTGACCAATTTTTTATGAGCATGCTGATGGCAGTCTCGTCTGCAGATTGACAAGAGAGAGAGAGAGAGTGTGTGTGTTCCTAGGGACTGAGAAGGAGGTGGAACTCGTAGAGACGTATTGGAGGAGGATGAAGAGGAACGGAGAAGAGTAGAGTAAGGCGGAGGAGCATCGAGCAGAAGAGGGGGAGATGTTGGTGCAGTGCATACGGGTGAGGGGGAGGAAATGACGTACGGATTTTTTGTTTCGAGGTTTATGCCTAGATGTGGGCATGACAGGAGCAGGAAGAATCTGGTGACCTAAAGTACCGTGGGGGTGAGTGGGTTCGCTATTGTGGAGAAGTTGGAGGTGAATGGTTGTGATTGTAGAGCAGTGGTAGTGATGGTTTGGGTCTGCAGCGCAGGGAATGAATGTGGGGGAAAATGGTGGGACCGGTGAATTACGGCCCTGGAAGGCGAAGATGATCAGAAGTGGAAGTCATGGCAGCTTCAAGTACAAATTCGTGGCTCCACACTTCGCTTCTCTCGCCCTCATCACAGCAACAATCAGCTCAGCATGCTCTTTACGCAACAGACCTGCCGATGCACCACCCGTCTTCGCATTTGGCTCAACAGCATCATGTAGGTTTAGGGCAGCAGGATCATCACCAGGAGCACCTTCCGTGCGACACTTTCTGTCAGCCTCTGCATCACTCCCTCAATCCTGACTTTCAGCACTCGGCCGAGAGCCATCAGTTGAACGGTTTCAATGGAGGAGTCGGGGGCAGTTGCAGCGGTCGTGTTGGTGTTGGAGGAGAAAATGGAGGTCATGTGTCGGCCAGAAAGGTTCACAAGGCAGATAGAGAGAAGCTACGAAGGGATCGGTTGAATGAGCAATTTGCCGAACTTGCCGGTGTGCTAGATCCTGATCGGCCGAAGAATGATAAGGCAACGATACTCGGTGACAGCGTTCAAGTAGTTAAAGAGTTGCGGGCTGAGGTGAAACGTCTCAGAACCGAACATACTTCACTTCTCGATGAATCCCGGGATTTGGCGCAAGAGAAGACCGAACTTCGAGAGGAAAAGGCCTCCTTGAAGAACGAGACAGAGCAACTACAAGGGCAACTTCAACAACGGCTACGGATTATGTTGCCTTGGATGGGAATGGATCCATCTCTAATGATGGGAGCTGCACCATATGCTTATCCCATGGCTGTTCCGCAGCCTGGTCCCCCTTCATCGGAAGGAACTCAGACCAGTACAGCACCTCCAGTGCCGCAGTCCGTAGTTGCTCCTGCTGCTTACATTCCTATGGCTCCCACAGCTCCGGGCACCTTCGCAGTTCATCCAGCTTTGCAAGCGTATACGATGTTTGGGAACAGACCCGGTGAAGGCGGGGCTCCTTATATGCCATATCCCCACTATCCCCCCCAAGTCAACTCGCACTCTCATGTGGAGAGGCCTTACGCCCAGTATCCCTCTCCCGTGCAGCCTCTCCCTGGTTATCTCATGCAAATGCAGCCTCACCAGGGCCAACCCCCTATAAGCGGTGCTCCGCCTGGGCCTTCGATGTATCGCTCTTATGGACCAGGCATGCCATTGATGCCCCCCCAACCTCAAGCTAATCAGCAAAATGTACAGGCTAGAGCAAGTCAGCATCCAGTTGCTCCTTACGCTCACTACCCTGCTTCTGGGATGCAACCTTATTCTGGACCGTCCCTGTCCTCATCCCCACAAGCTTCTCCTGGTCAGTCAGTCCAGACAACATTACAATTACAGACTCCCTCGCAGCCGCAACCCCAAAAGCCTTTCGAAGCCTCACCTGTCAATAGCACGGATGGATCTTCAAAAGCACAGAGTGGAGGCTCGGGATCTGCTTCCTCTGGACATAAGAAAGAGCCCAAACAGGCAGCAGCGTCTGGAGTGTCTGACTCGATTGCAAGCTCTCCAATATCATCAGCTCCAGCAGCTTCTGTCTCATCTACTGGGAACGGAGGAGACGCTGGACATTTGGATACTGGAGCTTGTCCCAATAGGGATACATCCCAAACTCATGATACCTCTTTCGGGAGGCCACTTGTGAAATAGGTCCATCACCATCAACTTAGCACACCCATCAGCGGGTTATTTTCTGCTAGACGCCTTCTTTCCAGTCGCCAAGTCTCAAATTTTGTAAGTGCTGAGTACTGAGCCCAGTTTGTAATTATCCACGTGATATGTTGTGTACATCGGTAGATCTGTTGAGTTCATTGAGAACGTCATTCCTGTTTATGGTGAAGAAACACACAGTACTTCAACCAACTCTTCGAGCCACAAAAGCTCCCGGTTCAAGCCTTGGCTGGTCATTATGACGAAGCTTTTGGTTGGAATGTGGAAGTGTGTTTTTGCACTGAGCAGGCACTATGACAGTTGTTGAAATTGTCCTGCTGTCAATTTATTCCAGGATGGCCCGTCCTTGTCACGATTACCATGGTGCAAAACGTGCTGTCCAGCTTGCTCATCGGAGTAAAGAATTGAAAACGAATTTGGTC

CDS

>Mapoly0025s0044.1
ATGGCAGCTTCAAGTACAAATTCGTGGCTCCACACTTCGCTTCTCTCGCCCTCATCACAGCAACAATCAGCTCAGCATGCTCTTTACGCAACAGACCTGCCGATGCACCACCCGTCTTCGCATTTGGCTCAACAGCATCATGTAGGTTTAGGGCAGCAGGATCATCACCAGGAGCACCTTCCGTGCGACACTTTCTGTCAGCCTCTGCATCACTCCCTCAATCCTGACTTTCAGCACTCGGCCGAGAGCCATCAGTTGAACGGTTTCAATGGAGGAGTCGGGGGCAGTTGCAGCGGTCGTGTTGGTGTTGGAGGAGAAAATGGAGGTCATGTGTCGGCCAGAAAGGTTCACAAGGCAGATAGAGAGAAGCTACGAAGGGATCGGTTGAATGAGCAATTTGCCGAACTTGCCGGTGTGCTAGATCCTGATCGGCCGAAGAATGATAAGGCAACGATACTCGGTGACAGCGTTCAAGTAGTTAAAGAGTTGCGGGCTGAGGTGAAACGTCTCAGAACCGAACATACTTCACTTCTCGATGAATCCCGGGATTTGGCGCAAGAGAAGACCGAACTTCGAGAGGAAAAGGCCTCCTTGAAGAACGAGACAGAGCAACTACAAGGGCAACTTCAACAACGGCTACGGATTATGTTGCCTTGGATGGGAATGGATCCATCTCTAATGATGGGAGCTGCACCATATGCTTATCCCATGGCTGTTCCGCAGCCTGGTCCCCCTTCATCGGAAGGAACTCAGACCAGTACAGCACCTCCAGTGCCGCAGTCCGTAGTTGCTCCTGCTGCTTACATTCCTATGGCTCCCACAGCTCCGGGCACCTTCGCAGTTCATCCAGCTTTGCAAGCGTATACGATGTTTGGGAACAGACCCGGTGAAGGCGGGGCTCCTTATATGCCATATCCCCACTATCCCCCCCAAGTCAACTCGCACTCTCATGTGGAGAGGCCTTACGCCCAGTATCCCTCTCCCGTGCAGCCTCTCCCTGGTTATCTCATGCAAATGCAGCCTCACCAGGGCCAACCCCCTATAAGCGGTGCTCCGCCTGGGCCTTCGATGTATCGCTCTTATGGACCAGGCATGCCATTGATGCCCCCCCAACCTCAAGCTAATCAGCAAAATGTACAGGCTAGAGCAAGTCAGCATCCAGTTGCTCCTTACGCTCACTACCCTGCTTCTGGGATGCAACCTTATTCTGGACCGTCCCTGTCCTCATCCCCACAAGCTTCTCCTGGTCAGTCAGTCCAGACAACATTACAATTACAGACTCCCTCGCAGCCGCAACCCCAAAAGCCTTTCGAAGCCTCACCTGTCAATAGCACGGATGGATCTTCAAAAGCACAGAGTGGAGGCTCGGGATCTGCTTCCTCTGGACATAAGAAAGAGCCCAAACAGGCAGCAGCGTCTGGAGTGTCTGACTCGATTGCAAGCTCTCCAATATCATCAGCTCCAGCAGCTTCTGTCTCATCTACTGGGAACGGAGGAGACGCTGGACATTTGGATACTGGAGCTTGTCCCAATAGGGATACATCCCAAACTCATGATACCTCTTTCGGGAGGCCACTTGTGAAATAG

Protein

>Mapoly0025s0044.1
MAASSTNSWLHTSLLSPSSQQQSAQHALYATDLPMHHPSSHLAQQHHVGLGQQDHHQEHLPCDTFCQPLHHSLNPDFQHSAESHQLNGFNGGVGGSCSGRVGVGGENGGHVSARKVHKADREKLRRDRLNEQFAELAGVLDPDRPKNDKATILGDSVQVVKELRAEVKRLRTEHTSLLDESRDLAQEKTELREEKASLKNETEQLQGQLQQRLRIMLPWMGMDPSLMMGAAPYAYPMAVPQPGPPSSEGTQTSTAPPVPQSVVAPAAYIPMAPTAPGTFAVHPALQAYTMFGNRPGEGGAPYMPYPHYPPQVNSHSHVERPYAQYPSPVQPLPGYLMQMQPHQGQPPISGAPPGPSMYRSYGPGMPLMPPQPQANQQNVQARASQHPVAPYAHYPASGMQPYSGPSLSSSPQASPGQSVQTTLQLQTPSQPQPQKPFEASPVNSTDGSSKAQSGGSGSASSGHKKEPKQAAASGVSDSIASSPISSAPAASVSSTGNGGDAGHLDTGACPNRDTSQTHDTSFGRPLVK

Mapoly0025s0044.2  

Gene structure:

mRNA scaffold_25:784787..788840  ( - strand )
three_prime_UTR scaffold_25:784787..785229  ( - strand )
CDS scaffold_25:785230..785460  ( - strand )
CDS scaffold_25:785687..786493  ( - strand )
CDS scaffold_25:786688..786815  ( - strand )
CDS scaffold_25:787058..787191  ( - strand )
CDS scaffold_25:787542..787576  ( - strand )
five_prime_UTR scaffold_25:787577..788840  ( - strand )

Sequences:

Gene

>Mapoly0025s0044.2
CGCCGGAGCTCGAGCCCAGGACGACGACGAGGTTCCGAGAAGGAGCAAGTCGATCGGGGAGTGGGTGGAACGCGAGAGATGGCCAGAGGCAATGCTGTGGCCGTGCGGTAGGTGTTTGCTCGGAGCAGTGGCAGAGGAGAGGAGAGGAGACGAGAGGAAGGATGCAGATCTCTAGCCGCGAGCAGGAGCATCCCGTAGTACCTTGTCCAGCCACTCCAGCCCCTCGACCGGCATTGAACTCTGTGTGTCGACAAAGAGTCTGTTGAAGCGGAGCAGGAGGATGACGAGATAAAGGCGCAGTGCAGTTCTGCCGGTGTCGATGTTCTTTGTAGGGCGTGGCGAGTTGTAGAGGTAGTTGTAGGCCTCGCCAGGCCAGGTCAGGTCCTGTCAGGTCGGACAGTGGCAGGAAAAGTGAATGCGGTAGAAAGTGACCAATTTTTTATGAGCATGCTGATGGCAGTCTCGTCTGCAGATTGACAAGAGAGAGAGAGAGAGTGTGTGTGTTCCTAGGGACTGAGAAGGAGGTGGAACTCGTAGAGACGTATTGGAGGAGGATGAAGAGGAACGGAGAAGAGTAGAGTAAGGCGGAGGAGCATCGAGCAGAAGAGGGGGAGATGTTGGTGCAGTGCATACGGGTGAGGGGGAGGAAATGACGTACGGATTTTTTGTTTCGAGGTTTATGCCTAGATGTGGGCATGACAGGAGCAGGAAGAATCTGGTGACCTAAAGTACCGTGGGGGTGAGTGGGTTCGCTATTGTGGAGAAGTTGGAGGTGAATGGTTGTGATTGTAGAGCAGTGGTAGTGATGGTTTGGGTCTGCAGCGCAGGGAATGAATGTGGGGGAAAATGGTGGGACCGGTGAATTACGGCCCTGGAAGGCGAAGATGATCAGAAGTGGAAGTCATGGCAGCTTCAAGTACAAATTCGTGGCTCCACACTTCGCTTCTCTCGCCCTCATCACAGCAACAATCAGCTCAGCATGCTCTTTACGCAACAGACCTGCCGATGCACCACCCGTCTTCGCATTTGGCTCAACAGCATCATGTAGGTTTAGGGCAGCAGGATCATCACCAGGAGCACCTTCCGTGCGACACTTTCTGTCAGCCTCTGCATCACTCCCTCAATCCTGACTTTCAGCACTCGGCCGAGAGCCATCAGTTGAACGGTTTCAATGGAGGAGTCGGGGGCAGGTTAGCAATTTTCAACCTCCCATTCCACTACTCTCGCAAACTTGGCCGCCTGTTCATTGACTTTCTCGTCGGAGATGGAGAATCTGCTCTCCATTCCGCTGTACCCAAAGTTCGTTCCACAACCCTCCTGAATACGTAGCAGCTTACCTTGCCACCTCCGATAGCAGTTTTTTAATTTCAAAGTGCATGTCATCTTCTTTCTTTCGTATATAGGAGAGAGAGGGAGAGAGAGCAGTAGGCCCTGCAGGTAACTGTCAAGTGGAGGGGGAACGCTAGTCCCCACTCCTCATGACATTCCAAATTTCTGCTTACTCCCTTCGATCGTCGCCTCATCCCTGTAGCTGTGGATACTTCGTTCAGCAAGCATTGATTTTCTATTGATTCGAGTATCAGGAGTCATCCTATTCTTCCGTAAATGTGATTACAGTTACTGAGTTTCACCTGAATGATGTCGTGCAGTTGCAGCGGTCGTGTTGGTGTTGGAGGAGAAAATGGAGGTCATGTGTCGGCCAGAAAGGTTCACAAGGCAGATAGAGAGAAGCTACGAAGGGATCGGTTGAATGAGCAATTTGCCGAACTTGCCGGTGTGCTAGGTGAGCTTTCTTCTTTGTGCAGATTCTTTTTAGATATATATTAGTATGACTTACGCGCTGTGGAATCTTCGAATGCTGTGCCGAGGTGTAGCAGGTACGGAAGTTTAAGAGTGATTTGATAAGCTTCTCGTTCGTCATCTGGTCTCAACCTAGAGCGGTTCTTTCAGTTTGATGGATATGGTTGCATACAATCGTAAGTTTTCTACGAATTAGAAGCTGACATGCCTCGTCTTGGATGAAAGATCCTGATCGGCCGAAGAATGATAAGGCAACGATACTCGGTGACAGCGTTCAAGTAGTTAAAGAGTTGCGGGCTGAGGTGAAACGTCTCAGAACCGAACATACTTCACTTCTCGATGAATCCCGGGATGTAAGCTTCTCACCGTTCTAAACTCTCAATAATCACGTCTTCACTTCTTGACGGACCTCTGAAGCCTGTGTCAAGCAATGCTTCCTGATTCTGCCGCTGATTTTAGATGTACTTTATTATCTACAGTCTCATCTCTACAAAGTCATGTTCGCAGGCTTTGAATATATTTCTCATTTTTACCTGATGTCTTGCAGTTGGCGCAAGAGAAGACCGAACTTCGAGAGGAAAAGGCCTCCTTGAAGAACGAGACAGAGCAACTACAAGGGCAACTTCAACAACGGCTACGGATTATGTTGCCTTGGATGGGAATGGATCCATCTCTAATGATGGGAGCTGCACCATATGCTTATCCCATGGCTGTTCCGCAGCCTGGTCCCCCTTCATCGGAAGGAACTCAGACCAGTACAGCACCTCCAGTGCCGCAGTCCGTAGTTGCTCCTGCTGCTTACATTCCTATGGCTCCCACAGCTCCGGGCACCTTCGCAGTTCATCCAGCTTTGCAAGCGTATACGATGTTTGGGAACAGACCCGGTGAAGGCGGGGCTCCTTATATGCCATATCCCCACTATCCCCCCCAAGTCAACTCGCACTCTCATGTGGAGAGGCCTTACGCCCAGTATCCCTCTCCCGTGCAGCCTCTCCCTGGTTATCTCATGCAAATGCAGCCTCACCAGGGCCAACCCCCTATAAGCGGTGCTCCGCCTGGGCCTTCGATGTATCGCTCTTATGGACCAGGCATGCCATTGATGCCCCCCCAACCTCAAGCTAATCAGCAAAATGTACAGGCTAGAGCAAGTCAGCATCCAGTTGCTCCTTACGCTCACTACCCTGCTTCTGGGATGCAACCTTATTCTGGACCGTCCCTGTCCTCATCCCCACAAGCTTCTCCTGGTCAGTCAGTCCAGACAACATTACAATTACAGACTCCCTCGCAGCCGCAACCCCAAAAGCCTTTCGAAGCCTCACCTGTCAATAGCACGGATGGATCTTCAAAAGCACAGGTAGATGCATAGATTTCATTCCTTTCTTTTCTAGATCAAAAGAATCGTCAACTAGGATCGTCTTGGAAGAGTGGATGCAAGTCCATTGTGATTCTTTTGCAGCAGGATGTGGAGACTGTTGTTGTGGGCTTGCATTGTTTTGGCACTAGAGCTTGAGCGGAGGTTGTTCAGATTGTCCTGCCAGTACGCTTGTAGCGTGTCTGATGAAGGACGTTTTTTATCACAGAGTGGAGGCTCGGGATCTGCTTCCTCTGGACATAAGAAAGAGCCCAAACAGGCAGCAGCGTCTGGAGTGTCTGACTCGATTGCAAGCTCTCCAATATCATCAGCTCCAGCAGCTTCTGTCTCATCTACTGGGAACGGAGGAGACGCTGGACATTTGGATACTGGAGCTTGTCCCAATAGGGATACATCCCAAACTCATGATACCTCTTTCGGGAGGCCACTTGTGAAATAGGTCCATCACCATCAACTTAGCACACCCATCAGCGGGTTATTTTCTGCTAGACGCCTTCTTTCCAGTCGCCAAGTCTCAAATTTTGTAAGTGCTGAGTACTGAGCCCAGTTTGTAATTATCCACGTGATATGTTGTGTACATCGGTAGATCTGTTGAGTTCATTGAGAACGTCATTCCTGTTTATGGTGAAGAAACACACAGTACTTCAACCAACTCTTCGAGCCACAAAAGCTCCCGGTTCAAGCCTTGGCTGGTCATTATGACGAAGCTTTTGGTTGGAATGTGGAAGTGTGTTTTTGCACTGAGCAGGCACTATGACAGTTGTTGAAATTGTCCTGCTGTCAATTTATTCCAGGATGGCCCGTCCTTGTCACGATTACCATGGTGCAAAACGTGCTGTCCAGCTTGCTCATCGGAGTAAAGAATTGAAAACGAATTTGGTC

mRNA

>Mapoly0025s0044.2
CGCCGGAGCTCGAGCCCAGGACGACGACGAGGTTCCGAGAAGGAGCAAGTCGATCGGGGAGTGGGTGGAACGCGAGAGATGGCCAGAGGCAATGCTGTGGCCGTGCGGTAGGTGTTTGCTCGGAGCAGTGGCAGAGGAGAGGAGAGGAGACGAGAGGAAGGATGCAGATCTCTAGCCGCGAGCAGGAGCATCCCGTAGTACCTTGTCCAGCCACTCCAGCCCCTCGACCGGCATTGAACTCTGTGTGTCGACAAAGAGTCTGTTGAAGCGGAGCAGGAGGATGACGAGATAAAGGCGCAGTGCAGTTCTGCCGGTGTCGATGTTCTTTGTAGGGCGTGGCGAGTTGTAGAGGTAGTTGTAGGCCTCGCCAGGCCAGGTCAGGTCCTGTCAGGTCGGACAGTGGCAGGAAAAGTGAATGCGGTAGAAAGTGACCAATTTTTTATGAGCATGCTGATGGCAGTCTCGTCTGCAGATTGACAAGAGAGAGAGAGAGAGTGTGTGTGTTCCTAGGGACTGAGAAGGAGGTGGAACTCGTAGAGACGTATTGGAGGAGGATGAAGAGGAACGGAGAAGAGTAGAGTAAGGCGGAGGAGCATCGAGCAGAAGAGGGGGAGATGTTGGTGCAGTGCATACGGGTGAGGGGGAGGAAATGACGTACGGATTTTTTGTTTCGAGGTTTATGCCTAGATGTGGGCATGACAGGAGCAGGAAGAATCTGGTGACCTAAAGTACCGTGGGGGTGAGTGGGTTCGCTATTGTGGAGAAGTTGGAGGTGAATGGTTGTGATTGTAGAGCAGTGGTAGTGATGGTTTGGGTCTGCAGCGCAGGGAATGAATGTGGGGGAAAATGGTGGGACCGGTGAATTACGGCCCTGGAAGGCGAAGATGATCAGAAGTGGAAGTCATGGCAGCTTCAAGTACAAATTCGTGGCTCCACACTTCGCTTCTCTCGCCCTCATCACAGCAACAATCAGCTCAGCATGCTCTTTACGCAACAGACCTGCCGATGCACCACCCGTCTTCGCATTTGGCTCAACAGCATCATGTAGGTTTAGGGCAGCAGGATCATCACCAGGAGCACCTTCCGTGCGACACTTTCTGTCAGCCTCTGCATCACTCCCTCAATCCTGACTTTCAGCACTCGGCCGAGAGCCATCAGTTGAACGGTTTCAATGGAGGAGTCGGGGGCAGGTTAGCAATTTTCAACCTCCCATTCCACTACTCTCGCAAACTTGGCCGCCTGTTCATTGACTTTCTCGTCGGAGATGGAGAATCTGCTCTCCATTCCGCTGTACCCAAATTGCAGCGGTCGTGTTGGTGTTGGAGGAGAAAATGGAGGTCATGTGTCGGCCAGAAAGGTTCACAAGGCAGATAGAGAGAAGCTACGAAGGGATCGGTTGAATGAGCAATTTGCCGAACTTGCCGGTGTGCTAGATCCTGATCGGCCGAAGAATGATAAGGCAACGATACTCGGTGACAGCGTTCAAGTAGTTAAAGAGTTGCGGGCTGAGGTGAAACGTCTCAGAACCGAACATACTTCACTTCTCGATGAATCCCGGGATTTGGCGCAAGAGAAGACCGAACTTCGAGAGGAAAAGGCCTCCTTGAAGAACGAGACAGAGCAACTACAAGGGCAACTTCAACAACGGCTACGGATTATGTTGCCTTGGATGGGAATGGATCCATCTCTAATGATGGGAGCTGCACCATATGCTTATCCCATGGCTGTTCCGCAGCCTGGTCCCCCTTCATCGGAAGGAACTCAGACCAGTACAGCACCTCCAGTGCCGCAGTCCGTAGTTGCTCCTGCTGCTTACATTCCTATGGCTCCCACAGCTCCGGGCACCTTCGCAGTTCATCCAGCTTTGCAAGCGTATACGATGTTTGGGAACAGACCCGGTGAAGGCGGGGCTCCTTATATGCCATATCCCCACTATCCCCCCCAAGTCAACTCGCACTCTCATGTGGAGAGGCCTTACGCCCAGTATCCCTCTCCCGTGCAGCCTCTCCCTGGTTATCTCATGCAAATGCAGCCTCACCAGGGCCAACCCCCTATAAGCGGTGCTCCGCCTGGGCCTTCGATGTATCGCTCTTATGGACCAGGCATGCCATTGATGCCCCCCCAACCTCAAGCTAATCAGCAAAATGTACAGGCTAGAGCAAGTCAGCATCCAGTTGCTCCTTACGCTCACTACCCTGCTTCTGGGATGCAACCTTATTCTGGACCGTCCCTGTCCTCATCCCCACAAGCTTCTCCTGGTCAGTCAGTCCAGACAACATTACAATTACAGACTCCCTCGCAGCCGCAACCCCAAAAGCCTTTCGAAGCCTCACCTGTCAATAGCACGGATGGATCTTCAAAAGCACAGAGTGGAGGCTCGGGATCTGCTTCCTCTGGACATAAGAAAGAGCCCAAACAGGCAGCAGCGTCTGGAGTGTCTGACTCGATTGCAAGCTCTCCAATATCATCAGCTCCAGCAGCTTCTGTCTCATCTACTGGGAACGGAGGAGACGCTGGACATTTGGATACTGGAGCTTGTCCCAATAGGGATACATCCCAAACTCATGATACCTCTTTCGGGAGGCCACTTGTGAAATAGGTCCATCACCATCAACTTAGCACACCCATCAGCGGGTTATTTTCTGCTAGACGCCTTCTTTCCAGTCGCCAAGTCTCAAATTTTGTAAGTGCTGAGTACTGAGCCCAGTTTGTAATTATCCACGTGATATGTTGTGTACATCGGTAGATCTGTTGAGTTCATTGAGAACGTCATTCCTGTTTATGGTGAAGAAACACACAGTACTTCAACCAACTCTTCGAGCCACAAAAGCTCCCGGTTCAAGCCTTGGCTGGTCATTATGACGAAGCTTTTGGTTGGAATGTGGAAGTGTGTTTTTGCACTGAGCAGGCACTATGACAGTTGTTGAAATTGTCCTGCTGTCAATTTATTCCAGGATGGCCCGTCCTTGTCACGATTACCATGGTGCAAAACGTGCTGTCCAGCTTGCTCATCGGAGTAAAGAATTGAAAACGAATTTGGTC

CDS

>Mapoly0025s0044.2
ATGGAGAATCTGCTCTCCATTCCGCTGTACCCAAATTGCAGCGGTCGTGTTGGTGTTGGAGGAGAAAATGGAGGTCATGTGTCGGCCAGAAAGGTTCACAAGGCAGATAGAGAGAAGCTACGAAGGGATCGGTTGAATGAGCAATTTGCCGAACTTGCCGGTGTGCTAGATCCTGATCGGCCGAAGAATGATAAGGCAACGATACTCGGTGACAGCGTTCAAGTAGTTAAAGAGTTGCGGGCTGAGGTGAAACGTCTCAGAACCGAACATACTTCACTTCTCGATGAATCCCGGGATTTGGCGCAAGAGAAGACCGAACTTCGAGAGGAAAAGGCCTCCTTGAAGAACGAGACAGAGCAACTACAAGGGCAACTTCAACAACGGCTACGGATTATGTTGCCTTGGATGGGAATGGATCCATCTCTAATGATGGGAGCTGCACCATATGCTTATCCCATGGCTGTTCCGCAGCCTGGTCCCCCTTCATCGGAAGGAACTCAGACCAGTACAGCACCTCCAGTGCCGCAGTCCGTAGTTGCTCCTGCTGCTTACATTCCTATGGCTCCCACAGCTCCGGGCACCTTCGCAGTTCATCCAGCTTTGCAAGCGTATACGATGTTTGGGAACAGACCCGGTGAAGGCGGGGCTCCTTATATGCCATATCCCCACTATCCCCCCCAAGTCAACTCGCACTCTCATGTGGAGAGGCCTTACGCCCAGTATCCCTCTCCCGTGCAGCCTCTCCCTGGTTATCTCATGCAAATGCAGCCTCACCAGGGCCAACCCCCTATAAGCGGTGCTCCGCCTGGGCCTTCGATGTATCGCTCTTATGGACCAGGCATGCCATTGATGCCCCCCCAACCTCAAGCTAATCAGCAAAATGTACAGGCTAGAGCAAGTCAGCATCCAGTTGCTCCTTACGCTCACTACCCTGCTTCTGGGATGCAACCTTATTCTGGACCGTCCCTGTCCTCATCCCCACAAGCTTCTCCTGGTCAGTCAGTCCAGACAACATTACAATTACAGACTCCCTCGCAGCCGCAACCCCAAAAGCCTTTCGAAGCCTCACCTGTCAATAGCACGGATGGATCTTCAAAAGCACAGAGTGGAGGCTCGGGATCTGCTTCCTCTGGACATAAGAAAGAGCCCAAACAGGCAGCAGCGTCTGGAGTGTCTGACTCGATTGCAAGCTCTCCAATATCATCAGCTCCAGCAGCTTCTGTCTCATCTACTGGGAACGGAGGAGACGCTGGACATTTGGATACTGGAGCTTGTCCCAATAGGGATACATCCCAAACTCATGATACCTCTTTCGGGAGGCCACTTGTGAAATAG

Protein

>Mapoly0025s0044.2
MENLLSIPLYPNCSGRVGVGGENGGHVSARKVHKADREKLRRDRLNEQFAELAGVLDPDRPKNDKATILGDSVQVVKELRAEVKRLRTEHTSLLDESRDLAQEKTELREEKASLKNETEQLQGQLQQRLRIMLPWMGMDPSLMMGAAPYAYPMAVPQPGPPSSEGTQTSTAPPVPQSVVAPAAYIPMAPTAPGTFAVHPALQAYTMFGNRPGEGGAPYMPYPHYPPQVNSHSHVERPYAQYPSPVQPLPGYLMQMQPHQGQPPISGAPPGPSMYRSYGPGMPLMPPQPQANQQNVQARASQHPVAPYAHYPASGMQPYSGPSLSSSPQASPGQSVQTTLQLQTPSQPQPQKPFEASPVNSTDGSSKAQSGGSGSASSGHKKEPKQAAASGVSDSIASSPISSAPAASVSSTGNGGDAGHLDTGACPNRDTSQTHDTSFGRPLVK

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>