Mapoly0026s0039



Description

transcription factor TGA

Reference DB

Database ID Description
GO GO:0003700 Sequence-specific DNA binding transcription factor activity
GO GO:0006351 Transcription, DNA-dependent
GO GO:0006355 Regulation of transcription, DNA-dependent
GO GO:0043565 Sequence-specific DNA binding
KEGGORTH K14431 Transcription factor TGA
OrthoMCL OG5_138072
PFAM PF00170 BZIP transcription factor
PFAM PF14144 Seed dormancy control
PANTHER PTHR22952 CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED
PANTHER PTHR22952:SF94

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBZIP8 transcription factor, bZIP Mapoly0026s0039.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0026s0039.1 scaffold_26:546189..553373  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0026s0039.2 scaffold_26:546189..553373  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0026s0039.3 scaffold_26:546189..553373  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0026s0039.4 scaffold_26:546189..553373  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0026s0039.5 scaffold_26:546189..553373  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0026s0039.6 scaffold_26:546189..553373  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0026s0039.7 scaffold_26:546189..553373  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0026s0039.8 scaffold_26:546189..553373  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0026s0039.1  

Gene structure:

mRNA scaffold_26:546189..553373  ( - strand )
three_prime_UTR scaffold_26:546189..547345  ( - strand )
CDS scaffold_26:547346..547492  ( - strand )
CDS scaffold_26:547635..547874  ( - strand )
CDS scaffold_26:548102..548373  ( - strand )
CDS scaffold_26:548582..548693  ( - strand )
CDS scaffold_26:548870..548947  ( - strand )
CDS scaffold_26:549065..549124  ( - strand )
CDS scaffold_26:549254..549331  ( - strand )
CDS scaffold_26:549617..549838  ( - strand )
CDS scaffold_26:550022..550098  ( - strand )
CDS scaffold_26:551087..551199  ( - strand )
CDS scaffold_26:552050..552162  ( - strand )
five_prime_UTR scaffold_26:552163..553373  ( - strand )

Sequences:

Gene

>Mapoly0026s0039.1
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATGTATAGTCTTCACCTCCTGAGTTGTACCACGTCTCTGTACCATAGAACTCCAGTCGTAGCTCGACTTATTGTATCCTCCACTTGTGGATCGTTCGACTTATCTGTAGCTCTGGAAACACTTCCAAAGGCCGAAATTGCTCCTGGTTTTCAGTAGATTCGTTCAGGCCACCGGGGGACGTCTGGTGGGTGGTGGCACCGATTTTTCCCCCGTGCAGTGTAGGGGTGATTTGGCGACCAGGAGAAGGGCATCCTGAAAGAGATGGTCGAAAGGGGAACGTATCCTTGGATACCTGTTCTGGGGTAGCAACTTTGCATTAAATTTATTCCACCATGTAGTATAGATGAAGCAGCAGCCAGTTGATTGGGTTGCATCAACTCGGCACTGTCGATTCCGCGACGAAGCTTCTCCTGAATGACACGATGGTGTGACAGTGAGCAATTGAGTTGAAGACGAGGCCTAGTCCACGACTGCCTAATCTCCCCGGGATCAAAAGTTCTTCTGAATTTTTGACTTCCTCCCCGCACCGCGGCTTGACAATTTGTGAGGCATCGTCGGAACTCACATTCGAGTTCGCACTGTCATTCTCAGAGTAATTTGCCGCCCTGAAGAAGCATGGCATCTGGGAAACCGGTGCGAAGGATCCTCCGATGAAATCTTGCGCCTACCATTTTGTTGTCTCCAAAGTAGAACATGGCAGGGAAAGATGGGGAGGGAGGTTCAGTAGCAACCTTAGACTGTTGAGGAGGTTGAGCGTCAAGGTGGTATGGTGTCCGTTCGGATGAGAGGTTTCAGCTACGAGCTGTGTCTGTCTTCTTCAGCACCTAACATGAGCGCGCTTGTCTTAATCAGAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACGTAGGTGTTGACCGTATGCTACTCCTCTCATCGTCATCATCATCATCAAATTTTTTCTATCTCTTGTACCTCCTCCACAGTACTGTACTCTCTCGCTCTGGCCACATTTTGCTGTCTGGTATTTATTGAGCTTCCGGTGGTCCGTGCCCCCTGTGACCCTTTCTCCCATCCGGATCGGTTCGAAATCCATTGTAGCCCTCTGGAAATCAATCCTTACTCTCGAGTCGAAACATCGGTCCGGAGCGGGTATCATCATCACCGTCATCATCGGGTGCTAAGCTGCGTCAGGCCACGAACGAACCTGCGTGTCCTCGCTGTCCGTCGCTGTCGCAGCCGCAGTTCCGTAGTCGTAATCCGGCAGTTCAGGGAATCGGATGAAGCGTGCAGATGTCGACCACCATAGAAGATTCACTTCCTCCCGGGAATTCCGATCTCGACCCCGAGGAAGGTCAGCGAGGAATCGGTAGACGCGACACAGTCGCGACATGCTCGGTACCGATGTGTACATCTAATGGTCCTCCGATGTCGATTCACCAACCGGATATTCAGTTCGATGTTTTCGAATTTTTCTCGCCCTCGGTGTGCTGGTGGCACGCTATCCTGCGCCTGGCCTGGCCGGGCCGCTCCTCGCCTTCTAATTCATGTTCTCAGAACACCGGTCCACTTTTAGTCCTCCCTGAAGCTATGCCTCGAGAGCCCAGGCCTGACAGGTCTACGAGATTGTGATTACGCATGGATGATGTAAGCGTGACGCCTGTGAAGGTCCGTGGACAGGCATGAAGAATTGTCTCACGTGCGGCGTGTGCCCCTAGCGCAGTAGGCTCGGTGCGAGTCGTTTCTCGAGCTCAGCTCAGGATGACGAGAATTTTAGAACTCGATGAAGCTCGGAATTGGACAACTGGTTTGCTCTGTGTCGTGCCTCCGAGTGCGAGAAAGTAGGCTTGCCATTTTGTCGAGCTCACAGAGTCATCCATGGCGCATTTTGCAGATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGGTAAGGAGTTGTGGGTTTACTGCATCGATCAATCAACGAATTTTTTCGCCCTCCTTTTGTCTCCTTTTAAACCTCCCGCAGACTAGCAGAGGCAGAGGAATCTTTATGTGTCAATAATGAACGTCTGCAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGGTAAACATACACACTACCTCCTTGTACGGGGAGGTTGCGGTAGGATCGTAGCTGCAGCAATTGCTGTACATTCTTTTCTCATGGGGGCTTTCTATATTTTATCCTCGATGTGCTTCGTTGTAGCAAGCGGAACCGGTGGCTGCCTAGTGCCCGGATTCCGTACCTCTTGCTTATGAAATGGCCCATCGTCCCCAGTCTGCACCGATGAATAGCTAACTGTGGATACGAGAATTGCAGCAGTCTCATGCGGTTTTCTTTCCACTATGCGCGCAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGTAAGTTGGCGAACCCACCGAACCGAATTCAGCCTTGCTGCTGCTGATTAGTCATTAGGATGCAAGTTTTCCGAGGCGAAGAGTTTGGTGTGGCTGATGATCTGACCGTCGTCAATCTTTTCTGCCCAGGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGTGAGTTCAGAATACAAGCTGCGTGGGAACGCCAACTTTTTCTATTGGTAGACGTCGAAGCAGACAAGTATGGAAGTTTTGGCTCAATCTCACCCGGTCGCTCTTATTTGGACGCAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGTTAGCTCCGTACCGTGTTGCTATTTGGATTCGAGGAGTTTTCTGATTTAGTACAGACCAGAGTAGTTGTTCTACGCACGTATGCACGCACGCTCGCTTCTGTTGTAATCACTGCTTCGAATATGTGGTTTCGGGACGAATTGATGGTAATACAGTGTTGTTTGGCACGGGTTCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGTAAGTGCCCTGGCCGCATCCCGCTCTGTCAGGTTCCATGCTTCCATCCCATTCTCCGAGGCAGGTCAGATGTGGCTAGCTGTACCGTAGGAGAGTGAGAGAATTGGCACATACCTACGCCGGATGCGTTGTTAATTGAGCTTCGAGATTTTGTCATGAGTTCGCACGTATCGGGATCATAACCGTGGTCCGTTGTCGACTGGTTCAGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGGTACGTCCTAGAGATGGCCAGGGTCCGTCGGCCGATCTGAGTGAATGCGGTCGATGTGGGGTCGTTTTTCCTGACATCGACTTAGAAAGAACCTGTGCTGCTGCGACGTGATTCCACGAAACCTCCGGAACATCGGCAAACGTCAGCCAGGTTGCTCGACATGAATGTTTCCCGACTGCCGGATGCCGATGATCCCGTAATAACACCGCGATTCGGCTCTTGTGCAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGTATTTGCAACAGGCAATTGTCTTTGAACCCCCGTGAAGTCTAACCCGCTGCACGACGAGGGCTAGAACGCGTAGTCACGTGCGCTTGAATCTCGCGATGCGATGCGATGCTCGACTGATTGATTTATTTGTTGTTCTGCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

mRNA

>Mapoly0026s0039.1
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

CDS

>Mapoly0026s0039.1
ATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGA

Protein

>Mapoly0026s0039.1
MANSRGQRGPGVPAPIASASPPVLHGMQGLSSSPPHLIASFGAEPIKDHTGGYDLGELEQPLSFNLDEELDLGERHSTVTSRPTLHILQSGPFRFSDTANKQRQQPNQQQQQQQSSQVTSPSAASTDSRSAHFTPRRHPSFESPSSRQFEHWGDSRMADNSPRTDTSTDMEADVKLEDAHHGANAGSNASDHEATKNGDSKALRRLAQNREAARKSRLRKKAYVQQLESSRIKLNQLEQELQRARQQLMTVRGERVQGVYHLGGYGDQNPHGVGGNGVNGAINPGAAAFDMEYGRWVDEQIRQMCDLRAALQAHVADNELRVLVDGGMAHYDEIFRLKSIAAKADVFHLVSGMWKTPAERCFMWMGGFRPSELLKILIPQIEPLTEQQLLGICNLQQSSQQAEDALSQGMEALQQSLADTLAAGSLGSSPNVANYMGQMAMAMGKLGTLESFVRQADNLRQQTLQQMYRILTTRQAARGLLAMGDYFARLRALSSLWSARPRD

Mapoly0026s0039.2  

Gene structure:

mRNA scaffold_26:546189..553373  ( - strand )
three_prime_UTR scaffold_26:546189..547345  ( - strand )
CDS scaffold_26:547346..547492  ( - strand )
CDS scaffold_26:547635..547874  ( - strand )
CDS scaffold_26:548102..548373  ( - strand )
CDS scaffold_26:548582..548663  ( - strand )
CDS scaffold_26:548870..548947  ( - strand )
CDS scaffold_26:549065..549124  ( - strand )
CDS scaffold_26:549254..549331  ( - strand )
CDS scaffold_26:549617..549673  ( - strand )
five_prime_UTR scaffold_26:549674..549838  ( - strand )
five_prime_UTR scaffold_26:550022..550098  ( - strand )
five_prime_UTR scaffold_26:552050..553373  ( - strand )

Sequences:

Gene

>Mapoly0026s0039.2
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATGTATAGTCTTCACCTCCTGAGTTGTACCACGTCTCTGTACCATAGAACTCCAGTCGTAGCTCGACTTATTGTATCCTCCACTTGTGGATCGTTCGACTTATCTGTAGCTCTGGAAACACTTCCAAAGGCCGAAATTGCTCCTGGTTTTCAGTAGATTCGTTCAGGCCACCGGGGGACGTCTGGTGGGTGGTGGCACCGATTTTTCCCCCGTGCAGTGTAGGGGTGATTTGGCGACCAGGAGAAGGGCATCCTGAAAGAGATGGTCGAAAGGGGAACGTATCCTTGGATACCTGTTCTGGGGTAGCAACTTTGCATTAAATTTATTCCACCATGTAGTATAGATGAAGCAGCAGCCAGTTGATTGGGTTGCATCAACTCGGCACTGTCGATTCCGCGACGAAGCTTCTCCTGAATGACACGATGGTGTGACAGTGAGCAATTGAGTTGAAGACGAGGCCTAGTCCACGACTGCCTAATCTCCCCGGGATCAAAAGTTCTTCTGAATTTTTGACTTCCTCCCCGCACCGCGGCTTGACAATTTGTGAGGCATCGTCGGAACTCACATTCGAGTTCGCACTGTCATTCTCAGAGTAATTTGCCGCCCTGAAGAAGCATGGCATCTGGGAAACCGGTGCGAAGGATCCTCCGATGAAATCTTGCGCCTACCATTTTGTTGTCTCCAAAGTAGAACATGGCAGGGAAAGATGGGGAGGGAGGTTCAGTAGCAACCTTAGACTGTTGAGGAGGTTGAGCGTCAAGGTGGTATGGTGTCCGTTCGGATGAGAGGTTTCAGCTACGAGCTGTGTCTGTCTTCTTCAGCACCTAACATGAGCGCGCTTGTCTTAATCAGAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACGTAGGTGTTGACCGTATGCTACTCCTCTCATCGTCATCATCATCATCAAATTTTTTCTATCTCTTGTACCTCCTCCACAGTACTGTACTCTCTCGCTCTGGCCACATTTTGCTGTCTGGTATTTATTGAGCTTCCGGTGGTCCGTGCCCCCTGTGACCCTTTCTCCCATCCGGATCGGTTCGAAATCCATTGTAGCCCTCTGGAAATCAATCCTTACTCTCGAGTCGAAACATCGGTCCGGAGCGGGTATCATCATCACCGTCATCATCGGGTGCTAAGCTGCGTCAGGCCACGAACGAACCTGCGTGTCCTCGCTGTCCGTCGCTGTCGCAGCCGCAGTTCCGTAGTCGTAATCCGGCAGTTCAGGGAATCGGATGAAGCGTGCAGATGTCGACCACCATAGAAGATTCACTTCCTCCCGGGAATTCCGATCTCGACCCCGAGGAAGGTCAGCGAGGAATCGGTAGACGCGACACAGTCGCGACATGCTCGGTACCGATGTGTACATCTAATGGTCCTCCGATGTCGATTCACCAACCGGATATTCAGTTCGATGTTTTCGAATTTTTCTCGCCCTCGGTGTGCTGGTGGCACGCTATCCTGCGCCTGGCCTGGCCGGGCCGCTCCTCGCCTTCTAATTCATGTTCTCAGAACACCGGTCCACTTTTAGTCCTCCCTGAAGCTATGCCTCGAGAGCCCAGGCCTGACAGGTCTACGAGATTGTGATTACGCATGGATGATGTAAGCGTGACGCCTGTGAAGGTCCGTGGACAGGCATGAAGAATTGTCTCACGTGCGGCGTGTGCCCCTAGCGCAGTAGGCTCGGTGCGAGTCGTTTCTCGAGCTCAGCTCAGGATGACGAGAATTTTAGAACTCGATGAAGCTCGGAATTGGACAACTGGTTTGCTCTGTGTCGTGCCTCCGAGTGCGAGAAAGTAGGCTTGCCATTTTGTCGAGCTCACAGAGTCATCCATGGCGCATTTTGCAGATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGGTAAGGAGTTGTGGGTTTACTGCATCGATCAATCAACGAATTTTTTCGCCCTCCTTTTGTCTCCTTTTAAACCTCCCGCAGACTAGCAGAGGCAGAGGAATCTTTATGTGTCAATAATGAACGTCTGCAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGGTAAACATACACACTACCTCCTTGTACGGGGAGGTTGCGGTAGGATCGTAGCTGCAGCAATTGCTGTACATTCTTTTCTCATGGGGGCTTTCTATATTTTATCCTCGATGTGCTTCGTTGTAGCAAGCGGAACCGGTGGCTGCCTAGTGCCCGGATTCCGTACCTCTTGCTTATGAAATGGCCCATCGTCCCCAGTCTGCACCGATGAATAGCTAACTGTGGATACGAGAATTGCAGCAGTCTCATGCGGTTTTCTTTCCACTATGCGCGCAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGTAAGTTGGCGAACCCACCGAACCGAATTCAGCCTTGCTGCTGCTGATTAGTCATTAGGATGCAAGTTTTCCGAGGCGAAGAGTTTGGTGTGGCTGATGATCTGACCGTCGTCAATCTTTTCTGCCCAGGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGTGAGTTCAGAATACAAGCTGCGTGGGAACGCCAACTTTTTCTATTGGTAGACGTCGAAGCAGACAAGTATGGAAGTTTTGGCTCAATCTCACCCGGTCGCTCTTATTTGGACGCAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGTTAGCTCCGTACCGTGTTGCTATTTGGATTCGAGGAGTTTTCTGATTTAGTACAGACCAGAGTAGTTGTTCTACGCACGTATGCACGCACGCTCGCTTCTGTTGTAATCACTGCTTCGAATATGTGGTTTCGGGACGAATTGATGGTAATACAGTGTTGTTTGGCACGGGTTCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGTAAGTGCCCTGGCCGCATCCCGCTCTGTCAGGTTCCATGCTTCCATCCCATTCTCCGAGGCAGGTCAGATGTGGCTAGCTGTACCGTAGGAGAGTGAGAGAATTGGCACATACCTACGCCGGATGCGTTGTTAATTGAGCTTCGAGATTTTGTCATGAGTTCGCACGTATCGGGATCATAACCGTGGTCCGTTGTCGACTGGTTCAGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGGTACGTCCTAGAGATGGCCAGGGTCCGTCGGCCGATCTGAGTGAATGCGGTCGATGTGGGGTCGTTTTTCCTGACATCGACTTAGAAAGAACCTGTGCTGCTGCGACGTGATTCCACGAAACCTCCGGAACATCGGCAAACGTCAGCCAGGTTGCTCGACATGAATGTTTCCCGACTGCCGGATGCCGATGATCCCGTAATAACACCGCGATTCGGCTCTTGTGCAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGTATTTGCAACAGGCAATTGTCTTTGAACCCCCGTGAAGTCTAACCCGCTGCACGACGAGGGCTAGAACGCGTAGTCACGTGCGCTTGAATCTCGCGATGCGATGCGATGCTCGACTGATTGATTTATTTGTTGTTCTGCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

mRNA

>Mapoly0026s0039.2
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

CDS

>Mapoly0026s0039.2
ATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGA

Protein

>Mapoly0026s0039.2
MADNSPRTDTSTDMEADVKLEDAHHGANAGSNASDHEATKNGDSKALRRLAQNREAARKSRLRKKAYVQQLESSRIKLNQLEQELQRARQQGVYHLGGYGDQNPHGVGGNGVNGAINPGAAAFDMEYGRWVDEQIRQMCDLRAALQAHVADNELRVLVDGGMAHYDEIFRLKSIAAKADVFHLVSGMWKTPAERCFMWMGGFRPSELLKILIPQIEPLTEQQLLGICNLQQSSQQAEDALSQGMEALQQSLADTLAAGSLGSSPNVANYMGQMAMAMGKLGTLESFVRQADNLRQQTLQQMYRILTTRQAARGLLAMGDYFARLRALSSLWSARPRD

Mapoly0026s0039.3  

Gene structure:

mRNA scaffold_26:546189..553373  ( - strand )
three_prime_UTR scaffold_26:546189..547345  ( - strand )
CDS scaffold_26:547346..547492  ( - strand )
CDS scaffold_26:547635..547874  ( - strand )
CDS scaffold_26:548102..548373  ( - strand )
CDS scaffold_26:548582..548693  ( - strand )
CDS scaffold_26:548870..548947  ( - strand )
CDS scaffold_26:549065..549124  ( - strand )
CDS scaffold_26:549254..549331  ( - strand )
CDS scaffold_26:549617..549673  ( - strand )
five_prime_UTR scaffold_26:549674..549838  ( - strand )
five_prime_UTR scaffold_26:550022..550098  ( - strand )
five_prime_UTR scaffold_26:552050..553373  ( - strand )

Sequences:

Gene

>Mapoly0026s0039.3
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATGTATAGTCTTCACCTCCTGAGTTGTACCACGTCTCTGTACCATAGAACTCCAGTCGTAGCTCGACTTATTGTATCCTCCACTTGTGGATCGTTCGACTTATCTGTAGCTCTGGAAACACTTCCAAAGGCCGAAATTGCTCCTGGTTTTCAGTAGATTCGTTCAGGCCACCGGGGGACGTCTGGTGGGTGGTGGCACCGATTTTTCCCCCGTGCAGTGTAGGGGTGATTTGGCGACCAGGAGAAGGGCATCCTGAAAGAGATGGTCGAAAGGGGAACGTATCCTTGGATACCTGTTCTGGGGTAGCAACTTTGCATTAAATTTATTCCACCATGTAGTATAGATGAAGCAGCAGCCAGTTGATTGGGTTGCATCAACTCGGCACTGTCGATTCCGCGACGAAGCTTCTCCTGAATGACACGATGGTGTGACAGTGAGCAATTGAGTTGAAGACGAGGCCTAGTCCACGACTGCCTAATCTCCCCGGGATCAAAAGTTCTTCTGAATTTTTGACTTCCTCCCCGCACCGCGGCTTGACAATTTGTGAGGCATCGTCGGAACTCACATTCGAGTTCGCACTGTCATTCTCAGAGTAATTTGCCGCCCTGAAGAAGCATGGCATCTGGGAAACCGGTGCGAAGGATCCTCCGATGAAATCTTGCGCCTACCATTTTGTTGTCTCCAAAGTAGAACATGGCAGGGAAAGATGGGGAGGGAGGTTCAGTAGCAACCTTAGACTGTTGAGGAGGTTGAGCGTCAAGGTGGTATGGTGTCCGTTCGGATGAGAGGTTTCAGCTACGAGCTGTGTCTGTCTTCTTCAGCACCTAACATGAGCGCGCTTGTCTTAATCAGAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACGTAGGTGTTGACCGTATGCTACTCCTCTCATCGTCATCATCATCATCAAATTTTTTCTATCTCTTGTACCTCCTCCACAGTACTGTACTCTCTCGCTCTGGCCACATTTTGCTGTCTGGTATTTATTGAGCTTCCGGTGGTCCGTGCCCCCTGTGACCCTTTCTCCCATCCGGATCGGTTCGAAATCCATTGTAGCCCTCTGGAAATCAATCCTTACTCTCGAGTCGAAACATCGGTCCGGAGCGGGTATCATCATCACCGTCATCATCGGGTGCTAAGCTGCGTCAGGCCACGAACGAACCTGCGTGTCCTCGCTGTCCGTCGCTGTCGCAGCCGCAGTTCCGTAGTCGTAATCCGGCAGTTCAGGGAATCGGATGAAGCGTGCAGATGTCGACCACCATAGAAGATTCACTTCCTCCCGGGAATTCCGATCTCGACCCCGAGGAAGGTCAGCGAGGAATCGGTAGACGCGACACAGTCGCGACATGCTCGGTACCGATGTGTACATCTAATGGTCCTCCGATGTCGATTCACCAACCGGATATTCAGTTCGATGTTTTCGAATTTTTCTCGCCCTCGGTGTGCTGGTGGCACGCTATCCTGCGCCTGGCCTGGCCGGGCCGCTCCTCGCCTTCTAATTCATGTTCTCAGAACACCGGTCCACTTTTAGTCCTCCCTGAAGCTATGCCTCGAGAGCCCAGGCCTGACAGGTCTACGAGATTGTGATTACGCATGGATGATGTAAGCGTGACGCCTGTGAAGGTCCGTGGACAGGCATGAAGAATTGTCTCACGTGCGGCGTGTGCCCCTAGCGCAGTAGGCTCGGTGCGAGTCGTTTCTCGAGCTCAGCTCAGGATGACGAGAATTTTAGAACTCGATGAAGCTCGGAATTGGACAACTGGTTTGCTCTGTGTCGTGCCTCCGAGTGCGAGAAAGTAGGCTTGCCATTTTGTCGAGCTCACAGAGTCATCCATGGCGCATTTTGCAGATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGGTAAGGAGTTGTGGGTTTACTGCATCGATCAATCAACGAATTTTTTCGCCCTCCTTTTGTCTCCTTTTAAACCTCCCGCAGACTAGCAGAGGCAGAGGAATCTTTATGTGTCAATAATGAACGTCTGCAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGGTAAACATACACACTACCTCCTTGTACGGGGAGGTTGCGGTAGGATCGTAGCTGCAGCAATTGCTGTACATTCTTTTCTCATGGGGGCTTTCTATATTTTATCCTCGATGTGCTTCGTTGTAGCAAGCGGAACCGGTGGCTGCCTAGTGCCCGGATTCCGTACCTCTTGCTTATGAAATGGCCCATCGTCCCCAGTCTGCACCGATGAATAGCTAACTGTGGATACGAGAATTGCAGCAGTCTCATGCGGTTTTCTTTCCACTATGCGCGCAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGTAAGTTGGCGAACCCACCGAACCGAATTCAGCCTTGCTGCTGCTGATTAGTCATTAGGATGCAAGTTTTCCGAGGCGAAGAGTTTGGTGTGGCTGATGATCTGACCGTCGTCAATCTTTTCTGCCCAGGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGTGAGTTCAGAATACAAGCTGCGTGGGAACGCCAACTTTTTCTATTGGTAGACGTCGAAGCAGACAAGTATGGAAGTTTTGGCTCAATCTCACCCGGTCGCTCTTATTTGGACGCAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGTTAGCTCCGTACCGTGTTGCTATTTGGATTCGAGGAGTTTTCTGATTTAGTACAGACCAGAGTAGTTGTTCTACGCACGTATGCACGCACGCTCGCTTCTGTTGTAATCACTGCTTCGAATATGTGGTTTCGGGACGAATTGATGGTAATACAGTGTTGTTTGGCACGGGTTCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGTAAGTGCCCTGGCCGCATCCCGCTCTGTCAGGTTCCATGCTTCCATCCCATTCTCCGAGGCAGGTCAGATGTGGCTAGCTGTACCGTAGGAGAGTGAGAGAATTGGCACATACCTACGCCGGATGCGTTGTTAATTGAGCTTCGAGATTTTGTCATGAGTTCGCACGTATCGGGATCATAACCGTGGTCCGTTGTCGACTGGTTCAGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGGTACGTCCTAGAGATGGCCAGGGTCCGTCGGCCGATCTGAGTGAATGCGGTCGATGTGGGGTCGTTTTTCCTGACATCGACTTAGAAAGAACCTGTGCTGCTGCGACGTGATTCCACGAAACCTCCGGAACATCGGCAAACGTCAGCCAGGTTGCTCGACATGAATGTTTCCCGACTGCCGGATGCCGATGATCCCGTAATAACACCGCGATTCGGCTCTTGTGCAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGTATTTGCAACAGGCAATTGTCTTTGAACCCCCGTGAAGTCTAACCCGCTGCACGACGAGGGCTAGAACGCGTAGTCACGTGCGCTTGAATCTCGCGATGCGATGCGATGCTCGACTGATTGATTTATTTGTTGTTCTGCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

mRNA

>Mapoly0026s0039.3
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

CDS

>Mapoly0026s0039.3
ATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGA

Protein

>Mapoly0026s0039.3
MADNSPRTDTSTDMEADVKLEDAHHGANAGSNASDHEATKNGDSKALRRLAQNREAARKSRLRKKAYVQQLESSRIKLNQLEQELQRARQQLMTVRGERVQGVYHLGGYGDQNPHGVGGNGVNGAINPGAAAFDMEYGRWVDEQIRQMCDLRAALQAHVADNELRVLVDGGMAHYDEIFRLKSIAAKADVFHLVSGMWKTPAERCFMWMGGFRPSELLKILIPQIEPLTEQQLLGICNLQQSSQQAEDALSQGMEALQQSLADTLAAGSLGSSPNVANYMGQMAMAMGKLGTLESFVRQADNLRQQTLQQMYRILTTRQAARGLLAMGDYFARLRALSSLWSARPRD

Mapoly0026s0039.4  

Gene structure:

mRNA scaffold_26:546189..553373  ( - strand )
three_prime_UTR scaffold_26:546189..547345  ( - strand )
CDS scaffold_26:547346..547492  ( - strand )
CDS scaffold_26:547635..547874  ( - strand )
CDS scaffold_26:548102..548373  ( - strand )
CDS scaffold_26:548582..548663  ( - strand )
CDS scaffold_26:548870..548947  ( - strand )
CDS scaffold_26:549065..549124  ( - strand )
CDS scaffold_26:549254..549331  ( - strand )
CDS scaffold_26:549617..549859  ( - strand )
five_prime_UTR scaffold_26:549860..549891  ( - strand )
five_prime_UTR scaffold_26:550022..550098  ( - strand )
five_prime_UTR scaffold_26:552050..553373  ( - strand )

Sequences:

Gene

>Mapoly0026s0039.4
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATGTATAGTCTTCACCTCCTGAGTTGTACCACGTCTCTGTACCATAGAACTCCAGTCGTAGCTCGACTTATTGTATCCTCCACTTGTGGATCGTTCGACTTATCTGTAGCTCTGGAAACACTTCCAAAGGCCGAAATTGCTCCTGGTTTTCAGTAGATTCGTTCAGGCCACCGGGGGACGTCTGGTGGGTGGTGGCACCGATTTTTCCCCCGTGCAGTGTAGGGGTGATTTGGCGACCAGGAGAAGGGCATCCTGAAAGAGATGGTCGAAAGGGGAACGTATCCTTGGATACCTGTTCTGGGGTAGCAACTTTGCATTAAATTTATTCCACCATGTAGTATAGATGAAGCAGCAGCCAGTTGATTGGGTTGCATCAACTCGGCACTGTCGATTCCGCGACGAAGCTTCTCCTGAATGACACGATGGTGTGACAGTGAGCAATTGAGTTGAAGACGAGGCCTAGTCCACGACTGCCTAATCTCCCCGGGATCAAAAGTTCTTCTGAATTTTTGACTTCCTCCCCGCACCGCGGCTTGACAATTTGTGAGGCATCGTCGGAACTCACATTCGAGTTCGCACTGTCATTCTCAGAGTAATTTGCCGCCCTGAAGAAGCATGGCATCTGGGAAACCGGTGCGAAGGATCCTCCGATGAAATCTTGCGCCTACCATTTTGTTGTCTCCAAAGTAGAACATGGCAGGGAAAGATGGGGAGGGAGGTTCAGTAGCAACCTTAGACTGTTGAGGAGGTTGAGCGTCAAGGTGGTATGGTGTCCGTTCGGATGAGAGGTTTCAGCTACGAGCTGTGTCTGTCTTCTTCAGCACCTAACATGAGCGCGCTTGTCTTAATCAGAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACGTAGGTGTTGACCGTATGCTACTCCTCTCATCGTCATCATCATCATCAAATTTTTTCTATCTCTTGTACCTCCTCCACAGTACTGTACTCTCTCGCTCTGGCCACATTTTGCTGTCTGGTATTTATTGAGCTTCCGGTGGTCCGTGCCCCCTGTGACCCTTTCTCCCATCCGGATCGGTTCGAAATCCATTGTAGCCCTCTGGAAATCAATCCTTACTCTCGAGTCGAAACATCGGTCCGGAGCGGGTATCATCATCACCGTCATCATCGGGTGCTAAGCTGCGTCAGGCCACGAACGAACCTGCGTGTCCTCGCTGTCCGTCGCTGTCGCAGCCGCAGTTCCGTAGTCGTAATCCGGCAGTTCAGGGAATCGGATGAAGCGTGCAGATGTCGACCACCATAGAAGATTCACTTCCTCCCGGGAATTCCGATCTCGACCCCGAGGAAGGTCAGCGAGGAATCGGTAGACGCGACACAGTCGCGACATGCTCGGTACCGATGTGTACATCTAATGGTCCTCCGATGTCGATTCACCAACCGGATATTCAGTTCGATGTTTTCGAATTTTTCTCGCCCTCGGTGTGCTGGTGGCACGCTATCCTGCGCCTGGCCTGGCCGGGCCGCTCCTCGCCTTCTAATTCATGTTCTCAGAACACCGGTCCACTTTTAGTCCTCCCTGAAGCTATGCCTCGAGAGCCCAGGCCTGACAGGTCTACGAGATTGTGATTACGCATGGATGATGTAAGCGTGACGCCTGTGAAGGTCCGTGGACAGGCATGAAGAATTGTCTCACGTGCGGCGTGTGCCCCTAGCGCAGTAGGCTCGGTGCGAGTCGTTTCTCGAGCTCAGCTCAGGATGACGAGAATTTTAGAACTCGATGAAGCTCGGAATTGGACAACTGGTTTGCTCTGTGTCGTGCCTCCGAGTGCGAGAAAGTAGGCTTGCCATTTTGTCGAGCTCACAGAGTCATCCATGGCGCATTTTGCAGATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGGTAAGGAGTTGTGGGTTTACTGCATCGATCAATCAACGAATTTTTTCGCCCTCCTTTTGTCTCCTTTTAAACCTCCCGCAGACTAGCAGAGGCAGAGGAATCTTTATGTGTCAATAATGAACGTCTGCAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGGTAAACATACACACTACCTCCTTGTACGGGGAGGTTGCGGTAGGATCGTAGCTGCAGCAATTGCTGTACATTCTTTTCTCATGGGGGCTTTCTATATTTTATCCTCGATGTGCTTCGTTGTAGCAAGCGGAACCGGTGGCTGCCTAGTGCCCGGATTCCGTACCTCTTGCTTATGAAATGGCCCATCGTCCCCAGTCTGCACCGATGAATAGCTAACTGTGGATACGAGAATTGCAGCAGTCTCATGCGGTTTTCTTTCCACTATGCGCGCAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGTAAGTTGGCGAACCCACCGAACCGAATTCAGCCTTGCTGCTGCTGATTAGTCATTAGGATGCAAGTTTTCCGAGGCGAAGAGTTTGGTGTGGCTGATGATCTGACCGTCGTCAATCTTTTCTGCCCAGGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGTGAGTTCAGAATACAAGCTGCGTGGGAACGCCAACTTTTTCTATTGGTAGACGTCGAAGCAGACAAGTATGGAAGTTTTGGCTCAATCTCACCCGGTCGCTCTTATTTGGACGCAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGTTAGCTCCGTACCGTGTTGCTATTTGGATTCGAGGAGTTTTCTGATTTAGTACAGACCAGAGTAGTTGTTCTACGCACGTATGCACGCACGCTCGCTTCTGTTGTAATCACTGCTTCGAATATGTGGTTTCGGGACGAATTGATGGTAATACAGTGTTGTTTGGCACGGGTTCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGTAAGTGCCCTGGCCGCATCCCGCTCTGTCAGGTTCCATGCTTCCATCCCATTCTCCGAGGCAGGTCAGATGTGGCTAGCTGTACCGTAGGAGAGTGAGAGAATTGGCACATACCTACGCCGGATGCGTTGTTAATTGAGCTTCGAGATTTTGTCATGAGTTCGCACGTATCGGGATCATAACCGTGGTCCGTTGTCGACTGGTTCAGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGGTACGTCCTAGAGATGGCCAGGGTCCGTCGGCCGATCTGAGTGAATGCGGTCGATGTGGGGTCGTTTTTCCTGACATCGACTTAGAAAGAACCTGTGCTGCTGCGACGTGATTCCACGAAACCTCCGGAACATCGGCAAACGTCAGCCAGGTTGCTCGACATGAATGTTTCCCGACTGCCGGATGCCGATGATCCCGTAATAACACCGCGATTCGGCTCTTGTGCAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGTATTTGCAACAGGCAATTGTCTTTGAACCCCCGTGAAGTCTAACCCGCTGCACGACGAGGGCTAGAACGCGTAGTCACGTGCGCTTGAATCTCGCGATGCGATGCGATGCTCGACTGATTGATTTATTTGTTGTTCTGCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

mRNA

>Mapoly0026s0039.4
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

CDS

>Mapoly0026s0039.4
ATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGA

Protein

>Mapoly0026s0039.4
MLTGMHQQRQQPNQQQQQQQSSQVTSPSAASTDSRSAHFTPRRHPSFESPSSRQFEHWGDSRMADNSPRTDTSTDMEADVKLEDAHHGANAGSNASDHEATKNGDSKALRRLAQNREAARKSRLRKKAYVQQLESSRIKLNQLEQELQRARQQGVYHLGGYGDQNPHGVGGNGVNGAINPGAAAFDMEYGRWVDEQIRQMCDLRAALQAHVADNELRVLVDGGMAHYDEIFRLKSIAAKADVFHLVSGMWKTPAERCFMWMGGFRPSELLKILIPQIEPLTEQQLLGICNLQQSSQQAEDALSQGMEALQQSLADTLAAGSLGSSPNVANYMGQMAMAMGKLGTLESFVRQADNLRQQTLQQMYRILTTRQAARGLLAMGDYFARLRALSSLWSARPRD

Mapoly0026s0039.5  

Gene structure:

mRNA scaffold_26:546189..553373  ( - strand )
three_prime_UTR scaffold_26:546189..547345  ( - strand )
CDS scaffold_26:547346..547492  ( - strand )
CDS scaffold_26:547635..547874  ( - strand )
CDS scaffold_26:548102..548373  ( - strand )
CDS scaffold_26:548582..548693  ( - strand )
CDS scaffold_26:548870..548947  ( - strand )
CDS scaffold_26:549065..549124  ( - strand )
CDS scaffold_26:549254..549331  ( - strand )
CDS scaffold_26:549617..549859  ( - strand )
five_prime_UTR scaffold_26:549860..549891  ( - strand )
five_prime_UTR scaffold_26:550022..550098  ( - strand )
five_prime_UTR scaffold_26:552050..553373  ( - strand )

Sequences:

Gene

>Mapoly0026s0039.5
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATGTATAGTCTTCACCTCCTGAGTTGTACCACGTCTCTGTACCATAGAACTCCAGTCGTAGCTCGACTTATTGTATCCTCCACTTGTGGATCGTTCGACTTATCTGTAGCTCTGGAAACACTTCCAAAGGCCGAAATTGCTCCTGGTTTTCAGTAGATTCGTTCAGGCCACCGGGGGACGTCTGGTGGGTGGTGGCACCGATTTTTCCCCCGTGCAGTGTAGGGGTGATTTGGCGACCAGGAGAAGGGCATCCTGAAAGAGATGGTCGAAAGGGGAACGTATCCTTGGATACCTGTTCTGGGGTAGCAACTTTGCATTAAATTTATTCCACCATGTAGTATAGATGAAGCAGCAGCCAGTTGATTGGGTTGCATCAACTCGGCACTGTCGATTCCGCGACGAAGCTTCTCCTGAATGACACGATGGTGTGACAGTGAGCAATTGAGTTGAAGACGAGGCCTAGTCCACGACTGCCTAATCTCCCCGGGATCAAAAGTTCTTCTGAATTTTTGACTTCCTCCCCGCACCGCGGCTTGACAATTTGTGAGGCATCGTCGGAACTCACATTCGAGTTCGCACTGTCATTCTCAGAGTAATTTGCCGCCCTGAAGAAGCATGGCATCTGGGAAACCGGTGCGAAGGATCCTCCGATGAAATCTTGCGCCTACCATTTTGTTGTCTCCAAAGTAGAACATGGCAGGGAAAGATGGGGAGGGAGGTTCAGTAGCAACCTTAGACTGTTGAGGAGGTTGAGCGTCAAGGTGGTATGGTGTCCGTTCGGATGAGAGGTTTCAGCTACGAGCTGTGTCTGTCTTCTTCAGCACCTAACATGAGCGCGCTTGTCTTAATCAGAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACGTAGGTGTTGACCGTATGCTACTCCTCTCATCGTCATCATCATCATCAAATTTTTTCTATCTCTTGTACCTCCTCCACAGTACTGTACTCTCTCGCTCTGGCCACATTTTGCTGTCTGGTATTTATTGAGCTTCCGGTGGTCCGTGCCCCCTGTGACCCTTTCTCCCATCCGGATCGGTTCGAAATCCATTGTAGCCCTCTGGAAATCAATCCTTACTCTCGAGTCGAAACATCGGTCCGGAGCGGGTATCATCATCACCGTCATCATCGGGTGCTAAGCTGCGTCAGGCCACGAACGAACCTGCGTGTCCTCGCTGTCCGTCGCTGTCGCAGCCGCAGTTCCGTAGTCGTAATCCGGCAGTTCAGGGAATCGGATGAAGCGTGCAGATGTCGACCACCATAGAAGATTCACTTCCTCCCGGGAATTCCGATCTCGACCCCGAGGAAGGTCAGCGAGGAATCGGTAGACGCGACACAGTCGCGACATGCTCGGTACCGATGTGTACATCTAATGGTCCTCCGATGTCGATTCACCAACCGGATATTCAGTTCGATGTTTTCGAATTTTTCTCGCCCTCGGTGTGCTGGTGGCACGCTATCCTGCGCCTGGCCTGGCCGGGCCGCTCCTCGCCTTCTAATTCATGTTCTCAGAACACCGGTCCACTTTTAGTCCTCCCTGAAGCTATGCCTCGAGAGCCCAGGCCTGACAGGTCTACGAGATTGTGATTACGCATGGATGATGTAAGCGTGACGCCTGTGAAGGTCCGTGGACAGGCATGAAGAATTGTCTCACGTGCGGCGTGTGCCCCTAGCGCAGTAGGCTCGGTGCGAGTCGTTTCTCGAGCTCAGCTCAGGATGACGAGAATTTTAGAACTCGATGAAGCTCGGAATTGGACAACTGGTTTGCTCTGTGTCGTGCCTCCGAGTGCGAGAAAGTAGGCTTGCCATTTTGTCGAGCTCACAGAGTCATCCATGGCGCATTTTGCAGATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGGTAAGGAGTTGTGGGTTTACTGCATCGATCAATCAACGAATTTTTTCGCCCTCCTTTTGTCTCCTTTTAAACCTCCCGCAGACTAGCAGAGGCAGAGGAATCTTTATGTGTCAATAATGAACGTCTGCAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGGTAAACATACACACTACCTCCTTGTACGGGGAGGTTGCGGTAGGATCGTAGCTGCAGCAATTGCTGTACATTCTTTTCTCATGGGGGCTTTCTATATTTTATCCTCGATGTGCTTCGTTGTAGCAAGCGGAACCGGTGGCTGCCTAGTGCCCGGATTCCGTACCTCTTGCTTATGAAATGGCCCATCGTCCCCAGTCTGCACCGATGAATAGCTAACTGTGGATACGAGAATTGCAGCAGTCTCATGCGGTTTTCTTTCCACTATGCGCGCAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGTAAGTTGGCGAACCCACCGAACCGAATTCAGCCTTGCTGCTGCTGATTAGTCATTAGGATGCAAGTTTTCCGAGGCGAAGAGTTTGGTGTGGCTGATGATCTGACCGTCGTCAATCTTTTCTGCCCAGGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGTGAGTTCAGAATACAAGCTGCGTGGGAACGCCAACTTTTTCTATTGGTAGACGTCGAAGCAGACAAGTATGGAAGTTTTGGCTCAATCTCACCCGGTCGCTCTTATTTGGACGCAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGTTAGCTCCGTACCGTGTTGCTATTTGGATTCGAGGAGTTTTCTGATTTAGTACAGACCAGAGTAGTTGTTCTACGCACGTATGCACGCACGCTCGCTTCTGTTGTAATCACTGCTTCGAATATGTGGTTTCGGGACGAATTGATGGTAATACAGTGTTGTTTGGCACGGGTTCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGTAAGTGCCCTGGCCGCATCCCGCTCTGTCAGGTTCCATGCTTCCATCCCATTCTCCGAGGCAGGTCAGATGTGGCTAGCTGTACCGTAGGAGAGTGAGAGAATTGGCACATACCTACGCCGGATGCGTTGTTAATTGAGCTTCGAGATTTTGTCATGAGTTCGCACGTATCGGGATCATAACCGTGGTCCGTTGTCGACTGGTTCAGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGGTACGTCCTAGAGATGGCCAGGGTCCGTCGGCCGATCTGAGTGAATGCGGTCGATGTGGGGTCGTTTTTCCTGACATCGACTTAGAAAGAACCTGTGCTGCTGCGACGTGATTCCACGAAACCTCCGGAACATCGGCAAACGTCAGCCAGGTTGCTCGACATGAATGTTTCCCGACTGCCGGATGCCGATGATCCCGTAATAACACCGCGATTCGGCTCTTGTGCAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGTATTTGCAACAGGCAATTGTCTTTGAACCCCCGTGAAGTCTAACCCGCTGCACGACGAGGGCTAGAACGCGTAGTCACGTGCGCTTGAATCTCGCGATGCGATGCGATGCTCGACTGATTGATTTATTTGTTGTTCTGCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

mRNA

>Mapoly0026s0039.5
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

CDS

>Mapoly0026s0039.5
ATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGA

Protein

>Mapoly0026s0039.5
MLTGMHQQRQQPNQQQQQQQSSQVTSPSAASTDSRSAHFTPRRHPSFESPSSRQFEHWGDSRMADNSPRTDTSTDMEADVKLEDAHHGANAGSNASDHEATKNGDSKALRRLAQNREAARKSRLRKKAYVQQLESSRIKLNQLEQELQRARQQLMTVRGERVQGVYHLGGYGDQNPHGVGGNGVNGAINPGAAAFDMEYGRWVDEQIRQMCDLRAALQAHVADNELRVLVDGGMAHYDEIFRLKSIAAKADVFHLVSGMWKTPAERCFMWMGGFRPSELLKILIPQIEPLTEQQLLGICNLQQSSQQAEDALSQGMEALQQSLADTLAAGSLGSSPNVANYMGQMAMAMGKLGTLESFVRQADNLRQQTLQQMYRILTTRQAARGLLAMGDYFARLRALSSLWSARPRD

Mapoly0026s0039.6  

Gene structure:

mRNA scaffold_26:546189..553373  ( - strand )
three_prime_UTR scaffold_26:546189..547345  ( - strand )
CDS scaffold_26:547346..547492  ( - strand )
CDS scaffold_26:547635..547874  ( - strand )
CDS scaffold_26:548102..548373  ( - strand )
CDS scaffold_26:548582..548663  ( - strand )
CDS scaffold_26:548870..548947  ( - strand )
CDS scaffold_26:549065..549124  ( - strand )
CDS scaffold_26:549254..549331  ( - strand )
CDS scaffold_26:549605..549859  ( - strand )
five_prime_UTR scaffold_26:549860..550098  ( - strand )
five_prime_UTR scaffold_26:551087..551199  ( - strand )
five_prime_UTR scaffold_26:552050..553373  ( - strand )

Sequences:

Gene

>Mapoly0026s0039.6
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATGTATAGTCTTCACCTCCTGAGTTGTACCACGTCTCTGTACCATAGAACTCCAGTCGTAGCTCGACTTATTGTATCCTCCACTTGTGGATCGTTCGACTTATCTGTAGCTCTGGAAACACTTCCAAAGGCCGAAATTGCTCCTGGTTTTCAGTAGATTCGTTCAGGCCACCGGGGGACGTCTGGTGGGTGGTGGCACCGATTTTTCCCCCGTGCAGTGTAGGGGTGATTTGGCGACCAGGAGAAGGGCATCCTGAAAGAGATGGTCGAAAGGGGAACGTATCCTTGGATACCTGTTCTGGGGTAGCAACTTTGCATTAAATTTATTCCACCATGTAGTATAGATGAAGCAGCAGCCAGTTGATTGGGTTGCATCAACTCGGCACTGTCGATTCCGCGACGAAGCTTCTCCTGAATGACACGATGGTGTGACAGTGAGCAATTGAGTTGAAGACGAGGCCTAGTCCACGACTGCCTAATCTCCCCGGGATCAAAAGTTCTTCTGAATTTTTGACTTCCTCCCCGCACCGCGGCTTGACAATTTGTGAGGCATCGTCGGAACTCACATTCGAGTTCGCACTGTCATTCTCAGAGTAATTTGCCGCCCTGAAGAAGCATGGCATCTGGGAAACCGGTGCGAAGGATCCTCCGATGAAATCTTGCGCCTACCATTTTGTTGTCTCCAAAGTAGAACATGGCAGGGAAAGATGGGGAGGGAGGTTCAGTAGCAACCTTAGACTGTTGAGGAGGTTGAGCGTCAAGGTGGTATGGTGTCCGTTCGGATGAGAGGTTTCAGCTACGAGCTGTGTCTGTCTTCTTCAGCACCTAACATGAGCGCGCTTGTCTTAATCAGAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACGTAGGTGTTGACCGTATGCTACTCCTCTCATCGTCATCATCATCATCAAATTTTTTCTATCTCTTGTACCTCCTCCACAGTACTGTACTCTCTCGCTCTGGCCACATTTTGCTGTCTGGTATTTATTGAGCTTCCGGTGGTCCGTGCCCCCTGTGACCCTTTCTCCCATCCGGATCGGTTCGAAATCCATTGTAGCCCTCTGGAAATCAATCCTTACTCTCGAGTCGAAACATCGGTCCGGAGCGGGTATCATCATCACCGTCATCATCGGGTGCTAAGCTGCGTCAGGCCACGAACGAACCTGCGTGTCCTCGCTGTCCGTCGCTGTCGCAGCCGCAGTTCCGTAGTCGTAATCCGGCAGTTCAGGGAATCGGATGAAGCGTGCAGATGTCGACCACCATAGAAGATTCACTTCCTCCCGGGAATTCCGATCTCGACCCCGAGGAAGGTCAGCGAGGAATCGGTAGACGCGACACAGTCGCGACATGCTCGGTACCGATGTGTACATCTAATGGTCCTCCGATGTCGATTCACCAACCGGATATTCAGTTCGATGTTTTCGAATTTTTCTCGCCCTCGGTGTGCTGGTGGCACGCTATCCTGCGCCTGGCCTGGCCGGGCCGCTCCTCGCCTTCTAATTCATGTTCTCAGAACACCGGTCCACTTTTAGTCCTCCCTGAAGCTATGCCTCGAGAGCCCAGGCCTGACAGGTCTACGAGATTGTGATTACGCATGGATGATGTAAGCGTGACGCCTGTGAAGGTCCGTGGACAGGCATGAAGAATTGTCTCACGTGCGGCGTGTGCCCCTAGCGCAGTAGGCTCGGTGCGAGTCGTTTCTCGAGCTCAGCTCAGGATGACGAGAATTTTAGAACTCGATGAAGCTCGGAATTGGACAACTGGTTTGCTCTGTGTCGTGCCTCCGAGTGCGAGAAAGTAGGCTTGCCATTTTGTCGAGCTCACAGAGTCATCCATGGCGCATTTTGCAGATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGGTAAGGAGTTGTGGGTTTACTGCATCGATCAATCAACGAATTTTTTCGCCCTCCTTTTGTCTCCTTTTAAACCTCCCGCAGACTAGCAGAGGCAGAGGAATCTTTATGTGTCAATAATGAACGTCTGCAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGGTAAACATACACACTACCTCCTTGTACGGGGAGGTTGCGGTAGGATCGTAGCTGCAGCAATTGCTGTACATTCTTTTCTCATGGGGGCTTTCTATATTTTATCCTCGATGTGCTTCGTTGTAGCAAGCGGAACCGGTGGCTGCCTAGTGCCCGGATTCCGTACCTCTTGCTTATGAAATGGCCCATCGTCCCCAGTCTGCACCGATGAATAGCTAACTGTGGATACGAGAATTGCAGCAGTCTCATGCGGTTTTCTTTCCACTATGCGCGCAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGTAAGTTGGCGAACCCACCGAACCGAATTCAGCCTTGCTGCTGCTGATTAGTCATTAGGATGCAAGTTTTCCGAGGCGAAGAGTTTGGTGTGGCTGATGATCTGACCGTCGTCAATCTTTTCTGCCCAGGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGTGAGTTCAGAATACAAGCTGCGTGGGAACGCCAACTTTTTCTATTGGTAGACGTCGAAGCAGACAAGTATGGAAGTTTTGGCTCAATCTCACCCGGTCGCTCTTATTTGGACGCAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGTTAGCTCCGTACCGTGTTGCTATTTGGATTCGAGGAGTTTTCTGATTTAGTACAGACCAGAGTAGTTGTTCTACGCACGTATGCACGCACGCTCGCTTCTGTTGTAATCACTGCTTCGAATATGTGGTTTCGGGACGAATTGATGGTAATACAGTGTTGTTTGGCACGGGTTCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGTAAGTGCCCTGGCCGCATCCCGCTCTGTCAGGTTCCATGCTTCCATCCCATTCTCCGAGGCAGGTCAGATGTGGCTAGCTGTACCGTAGGAGAGTGAGAGAATTGGCACATACCTACGCCGGATGCGTTGTTAATTGAGCTTCGAGATTTTGTCATGAGTTCGCACGTATCGGGATCATAACCGTGGTCCGTTGTCGACTGGTTCAGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGGTACGTCCTAGAGATGGCCAGGGTCCGTCGGCCGATCTGAGTGAATGCGGTCGATGTGGGGTCGTTTTTCCTGACATCGACTTAGAAAGAACCTGTGCTGCTGCGACGTGATTCCACGAAACCTCCGGAACATCGGCAAACGTCAGCCAGGTTGCTCGACATGAATGTTTCCCGACTGCCGGATGCCGATGATCCCGTAATAACACCGCGATTCGGCTCTTGTGCAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGTATTTGCAACAGGCAATTGTCTTTGAACCCCCGTGAAGTCTAACCCGCTGCACGACGAGGGCTAGAACGCGTAGTCACGTGCGCTTGAATCTCGCGATGCGATGCGATGCTCGACTGATTGATTTATTTGTTGTTCTGCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

mRNA

>Mapoly0026s0039.6
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGGTAAGGAGTTGTGGGTTTACTGCATCGATCAATCAACGAATTTTTTCGCCCTCCTTTTGTCTCCTTTTAAACCTCCCGCAGACTAGCAGAGGCAGAGGAATCTTTATGTGTCAATAATGAACGTCTGCAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

CDS

>Mapoly0026s0039.6
ATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGA

Protein

>Mapoly0026s0039.6
MLTGMHQQRQQPNQQQQQQQSSQVTSPSAASTDSRSAHFTPRRHPSFESPSSRQFEHWGDSRMADNSPRTDTSTDMEADVKVDNWLEDAHHGANAGSNASDHEATKNGDSKALRRLAQNREAARKSRLRKKAYVQQLESSRIKLNQLEQELQRARQQGVYHLGGYGDQNPHGVGGNGVNGAINPGAAAFDMEYGRWVDEQIRQMCDLRAALQAHVADNELRVLVDGGMAHYDEIFRLKSIAAKADVFHLVSGMWKTPAERCFMWMGGFRPSELLKILIPQIEPLTEQQLLGICNLQQSSQQAEDALSQGMEALQQSLADTLAAGSLGSSPNVANYMGQMAMAMGKLGTLESFVRQADNLRQQTLQQMYRILTTRQAARGLLAMGDYFARLRALSSLWSARPRD

Mapoly0026s0039.7  

Gene structure:

mRNA scaffold_26:546189..553373  ( - strand )
three_prime_UTR scaffold_26:546189..547345  ( - strand )
CDS scaffold_26:547346..547492  ( - strand )
CDS scaffold_26:547635..547874  ( - strand )
CDS scaffold_26:548102..548373  ( - strand )
CDS scaffold_26:548582..548663  ( - strand )
CDS scaffold_26:548870..548947  ( - strand )
CDS scaffold_26:549065..549124  ( - strand )
CDS scaffold_26:549254..549331  ( - strand )
CDS scaffold_26:549617..549838  ( - strand )
CDS scaffold_26:550022..550098  ( - strand )
CDS scaffold_26:551087..551199  ( - strand )
CDS scaffold_26:552050..552162  ( - strand )
five_prime_UTR scaffold_26:552163..553373  ( - strand )

Sequences:

Gene

>Mapoly0026s0039.7
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATGTATAGTCTTCACCTCCTGAGTTGTACCACGTCTCTGTACCATAGAACTCCAGTCGTAGCTCGACTTATTGTATCCTCCACTTGTGGATCGTTCGACTTATCTGTAGCTCTGGAAACACTTCCAAAGGCCGAAATTGCTCCTGGTTTTCAGTAGATTCGTTCAGGCCACCGGGGGACGTCTGGTGGGTGGTGGCACCGATTTTTCCCCCGTGCAGTGTAGGGGTGATTTGGCGACCAGGAGAAGGGCATCCTGAAAGAGATGGTCGAAAGGGGAACGTATCCTTGGATACCTGTTCTGGGGTAGCAACTTTGCATTAAATTTATTCCACCATGTAGTATAGATGAAGCAGCAGCCAGTTGATTGGGTTGCATCAACTCGGCACTGTCGATTCCGCGACGAAGCTTCTCCTGAATGACACGATGGTGTGACAGTGAGCAATTGAGTTGAAGACGAGGCCTAGTCCACGACTGCCTAATCTCCCCGGGATCAAAAGTTCTTCTGAATTTTTGACTTCCTCCCCGCACCGCGGCTTGACAATTTGTGAGGCATCGTCGGAACTCACATTCGAGTTCGCACTGTCATTCTCAGAGTAATTTGCCGCCCTGAAGAAGCATGGCATCTGGGAAACCGGTGCGAAGGATCCTCCGATGAAATCTTGCGCCTACCATTTTGTTGTCTCCAAAGTAGAACATGGCAGGGAAAGATGGGGAGGGAGGTTCAGTAGCAACCTTAGACTGTTGAGGAGGTTGAGCGTCAAGGTGGTATGGTGTCCGTTCGGATGAGAGGTTTCAGCTACGAGCTGTGTCTGTCTTCTTCAGCACCTAACATGAGCGCGCTTGTCTTAATCAGAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACGTAGGTGTTGACCGTATGCTACTCCTCTCATCGTCATCATCATCATCAAATTTTTTCTATCTCTTGTACCTCCTCCACAGTACTGTACTCTCTCGCTCTGGCCACATTTTGCTGTCTGGTATTTATTGAGCTTCCGGTGGTCCGTGCCCCCTGTGACCCTTTCTCCCATCCGGATCGGTTCGAAATCCATTGTAGCCCTCTGGAAATCAATCCTTACTCTCGAGTCGAAACATCGGTCCGGAGCGGGTATCATCATCACCGTCATCATCGGGTGCTAAGCTGCGTCAGGCCACGAACGAACCTGCGTGTCCTCGCTGTCCGTCGCTGTCGCAGCCGCAGTTCCGTAGTCGTAATCCGGCAGTTCAGGGAATCGGATGAAGCGTGCAGATGTCGACCACCATAGAAGATTCACTTCCTCCCGGGAATTCCGATCTCGACCCCGAGGAAGGTCAGCGAGGAATCGGTAGACGCGACACAGTCGCGACATGCTCGGTACCGATGTGTACATCTAATGGTCCTCCGATGTCGATTCACCAACCGGATATTCAGTTCGATGTTTTCGAATTTTTCTCGCCCTCGGTGTGCTGGTGGCACGCTATCCTGCGCCTGGCCTGGCCGGGCCGCTCCTCGCCTTCTAATTCATGTTCTCAGAACACCGGTCCACTTTTAGTCCTCCCTGAAGCTATGCCTCGAGAGCCCAGGCCTGACAGGTCTACGAGATTGTGATTACGCATGGATGATGTAAGCGTGACGCCTGTGAAGGTCCGTGGACAGGCATGAAGAATTGTCTCACGTGCGGCGTGTGCCCCTAGCGCAGTAGGCTCGGTGCGAGTCGTTTCTCGAGCTCAGCTCAGGATGACGAGAATTTTAGAACTCGATGAAGCTCGGAATTGGACAACTGGTTTGCTCTGTGTCGTGCCTCCGAGTGCGAGAAAGTAGGCTTGCCATTTTGTCGAGCTCACAGAGTCATCCATGGCGCATTTTGCAGATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGGTAAGGAGTTGTGGGTTTACTGCATCGATCAATCAACGAATTTTTTCGCCCTCCTTTTGTCTCCTTTTAAACCTCCCGCAGACTAGCAGAGGCAGAGGAATCTTTATGTGTCAATAATGAACGTCTGCAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGGTAAACATACACACTACCTCCTTGTACGGGGAGGTTGCGGTAGGATCGTAGCTGCAGCAATTGCTGTACATTCTTTTCTCATGGGGGCTTTCTATATTTTATCCTCGATGTGCTTCGTTGTAGCAAGCGGAACCGGTGGCTGCCTAGTGCCCGGATTCCGTACCTCTTGCTTATGAAATGGCCCATCGTCCCCAGTCTGCACCGATGAATAGCTAACTGTGGATACGAGAATTGCAGCAGTCTCATGCGGTTTTCTTTCCACTATGCGCGCAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGTAAGTTGGCGAACCCACCGAACCGAATTCAGCCTTGCTGCTGCTGATTAGTCATTAGGATGCAAGTTTTCCGAGGCGAAGAGTTTGGTGTGGCTGATGATCTGACCGTCGTCAATCTTTTCTGCCCAGGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGTGAGTTCAGAATACAAGCTGCGTGGGAACGCCAACTTTTTCTATTGGTAGACGTCGAAGCAGACAAGTATGGAAGTTTTGGCTCAATCTCACCCGGTCGCTCTTATTTGGACGCAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGTTAGCTCCGTACCGTGTTGCTATTTGGATTCGAGGAGTTTTCTGATTTAGTACAGACCAGAGTAGTTGTTCTACGCACGTATGCACGCACGCTCGCTTCTGTTGTAATCACTGCTTCGAATATGTGGTTTCGGGACGAATTGATGGTAATACAGTGTTGTTTGGCACGGGTTCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGTAAGTGCCCTGGCCGCATCCCGCTCTGTCAGGTTCCATGCTTCCATCCCATTCTCCGAGGCAGGTCAGATGTGGCTAGCTGTACCGTAGGAGAGTGAGAGAATTGGCACATACCTACGCCGGATGCGTTGTTAATTGAGCTTCGAGATTTTGTCATGAGTTCGCACGTATCGGGATCATAACCGTGGTCCGTTGTCGACTGGTTCAGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGGTACGTCCTAGAGATGGCCAGGGTCCGTCGGCCGATCTGAGTGAATGCGGTCGATGTGGGGTCGTTTTTCCTGACATCGACTTAGAAAGAACCTGTGCTGCTGCGACGTGATTCCACGAAACCTCCGGAACATCGGCAAACGTCAGCCAGGTTGCTCGACATGAATGTTTCCCGACTGCCGGATGCCGATGATCCCGTAATAACACCGCGATTCGGCTCTTGTGCAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGTATTTGCAACAGGCAATTGTCTTTGAACCCCCGTGAAGTCTAACCCGCTGCACGACGAGGGCTAGAACGCGTAGTCACGTGCGCTTGAATCTCGCGATGCGATGCGATGCTCGACTGATTGATTTATTTGTTGTTCTGCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

mRNA

>Mapoly0026s0039.7
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

CDS

>Mapoly0026s0039.7
ATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGA

Protein

>Mapoly0026s0039.7
MANSRGQRGPGVPAPIASASPPVLHGMQGLSSSPPHLIASFGAEPIKDHTGGYDLGELEQPLSFNLDEELDLGERHSTVTSRPTLHILQSGPFRFSDTANKQRQQPNQQQQQQQSSQVTSPSAASTDSRSAHFTPRRHPSFESPSSRQFEHWGDSRMADNSPRTDTSTDMEADVKLEDAHHGANAGSNASDHEATKNGDSKALRRLAQNREAARKSRLRKKAYVQQLESSRIKLNQLEQELQRARQQGVYHLGGYGDQNPHGVGGNGVNGAINPGAAAFDMEYGRWVDEQIRQMCDLRAALQAHVADNELRVLVDGGMAHYDEIFRLKSIAAKADVFHLVSGMWKTPAERCFMWMGGFRPSELLKILIPQIEPLTEQQLLGICNLQQSSQQAEDALSQGMEALQQSLADTLAAGSLGSSPNVANYMGQMAMAMGKLGTLESFVRQADNLRQQTLQQMYRILTTRQAARGLLAMGDYFARLRALSSLWSARPRD

Mapoly0026s0039.8  

Gene structure:

mRNA scaffold_26:546189..553373  ( - strand )
three_prime_UTR scaffold_26:546189..547345  ( - strand )
CDS scaffold_26:547346..547492  ( - strand )
CDS scaffold_26:547635..547874  ( - strand )
CDS scaffold_26:548102..548373  ( - strand )
CDS scaffold_26:548582..548693  ( - strand )
CDS scaffold_26:548870..548947  ( - strand )
CDS scaffold_26:549065..549124  ( - strand )
CDS scaffold_26:549254..549331  ( - strand )
CDS scaffold_26:549605..549859  ( - strand )
five_prime_UTR scaffold_26:549860..550098  ( - strand )
five_prime_UTR scaffold_26:551087..551199  ( - strand )
five_prime_UTR scaffold_26:552050..553373  ( - strand )

Sequences:

Gene

>Mapoly0026s0039.8
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATGTATAGTCTTCACCTCCTGAGTTGTACCACGTCTCTGTACCATAGAACTCCAGTCGTAGCTCGACTTATTGTATCCTCCACTTGTGGATCGTTCGACTTATCTGTAGCTCTGGAAACACTTCCAAAGGCCGAAATTGCTCCTGGTTTTCAGTAGATTCGTTCAGGCCACCGGGGGACGTCTGGTGGGTGGTGGCACCGATTTTTCCCCCGTGCAGTGTAGGGGTGATTTGGCGACCAGGAGAAGGGCATCCTGAAAGAGATGGTCGAAAGGGGAACGTATCCTTGGATACCTGTTCTGGGGTAGCAACTTTGCATTAAATTTATTCCACCATGTAGTATAGATGAAGCAGCAGCCAGTTGATTGGGTTGCATCAACTCGGCACTGTCGATTCCGCGACGAAGCTTCTCCTGAATGACACGATGGTGTGACAGTGAGCAATTGAGTTGAAGACGAGGCCTAGTCCACGACTGCCTAATCTCCCCGGGATCAAAAGTTCTTCTGAATTTTTGACTTCCTCCCCGCACCGCGGCTTGACAATTTGTGAGGCATCGTCGGAACTCACATTCGAGTTCGCACTGTCATTCTCAGAGTAATTTGCCGCCCTGAAGAAGCATGGCATCTGGGAAACCGGTGCGAAGGATCCTCCGATGAAATCTTGCGCCTACCATTTTGTTGTCTCCAAAGTAGAACATGGCAGGGAAAGATGGGGAGGGAGGTTCAGTAGCAACCTTAGACTGTTGAGGAGGTTGAGCGTCAAGGTGGTATGGTGTCCGTTCGGATGAGAGGTTTCAGCTACGAGCTGTGTCTGTCTTCTTCAGCACCTAACATGAGCGCGCTTGTCTTAATCAGAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACGTAGGTGTTGACCGTATGCTACTCCTCTCATCGTCATCATCATCATCAAATTTTTTCTATCTCTTGTACCTCCTCCACAGTACTGTACTCTCTCGCTCTGGCCACATTTTGCTGTCTGGTATTTATTGAGCTTCCGGTGGTCCGTGCCCCCTGTGACCCTTTCTCCCATCCGGATCGGTTCGAAATCCATTGTAGCCCTCTGGAAATCAATCCTTACTCTCGAGTCGAAACATCGGTCCGGAGCGGGTATCATCATCACCGTCATCATCGGGTGCTAAGCTGCGTCAGGCCACGAACGAACCTGCGTGTCCTCGCTGTCCGTCGCTGTCGCAGCCGCAGTTCCGTAGTCGTAATCCGGCAGTTCAGGGAATCGGATGAAGCGTGCAGATGTCGACCACCATAGAAGATTCACTTCCTCCCGGGAATTCCGATCTCGACCCCGAGGAAGGTCAGCGAGGAATCGGTAGACGCGACACAGTCGCGACATGCTCGGTACCGATGTGTACATCTAATGGTCCTCCGATGTCGATTCACCAACCGGATATTCAGTTCGATGTTTTCGAATTTTTCTCGCCCTCGGTGTGCTGGTGGCACGCTATCCTGCGCCTGGCCTGGCCGGGCCGCTCCTCGCCTTCTAATTCATGTTCTCAGAACACCGGTCCACTTTTAGTCCTCCCTGAAGCTATGCCTCGAGAGCCCAGGCCTGACAGGTCTACGAGATTGTGATTACGCATGGATGATGTAAGCGTGACGCCTGTGAAGGTCCGTGGACAGGCATGAAGAATTGTCTCACGTGCGGCGTGTGCCCCTAGCGCAGTAGGCTCGGTGCGAGTCGTTTCTCGAGCTCAGCTCAGGATGACGAGAATTTTAGAACTCGATGAAGCTCGGAATTGGACAACTGGTTTGCTCTGTGTCGTGCCTCCGAGTGCGAGAAAGTAGGCTTGCCATTTTGTCGAGCTCACAGAGTCATCCATGGCGCATTTTGCAGATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGGTAAGGAGTTGTGGGTTTACTGCATCGATCAATCAACGAATTTTTTCGCCCTCCTTTTGTCTCCTTTTAAACCTCCCGCAGACTAGCAGAGGCAGAGGAATCTTTATGTGTCAATAATGAACGTCTGCAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGGTAAACATACACACTACCTCCTTGTACGGGGAGGTTGCGGTAGGATCGTAGCTGCAGCAATTGCTGTACATTCTTTTCTCATGGGGGCTTTCTATATTTTATCCTCGATGTGCTTCGTTGTAGCAAGCGGAACCGGTGGCTGCCTAGTGCCCGGATTCCGTACCTCTTGCTTATGAAATGGCCCATCGTCCCCAGTCTGCACCGATGAATAGCTAACTGTGGATACGAGAATTGCAGCAGTCTCATGCGGTTTTCTTTCCACTATGCGCGCAGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGTAAGTTGGCGAACCCACCGAACCGAATTCAGCCTTGCTGCTGCTGATTAGTCATTAGGATGCAAGTTTTCCGAGGCGAAGAGTTTGGTGTGGCTGATGATCTGACCGTCGTCAATCTTTTCTGCCCAGGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGTGAGTTCAGAATACAAGCTGCGTGGGAACGCCAACTTTTTCTATTGGTAGACGTCGAAGCAGACAAGTATGGAAGTTTTGGCTCAATCTCACCCGGTCGCTCTTATTTGGACGCAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGGTTAGCTCCGTACCGTGTTGCTATTTGGATTCGAGGAGTTTTCTGATTTAGTACAGACCAGAGTAGTTGTTCTACGCACGTATGCACGCACGCTCGCTTCTGTTGTAATCACTGCTTCGAATATGTGGTTTCGGGACGAATTGATGGTAATACAGTGTTGTTTGGCACGGGTTCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGTAAGTGCCCTGGCCGCATCCCGCTCTGTCAGGTTCCATGCTTCCATCCCATTCTCCGAGGCAGGTCAGATGTGGCTAGCTGTACCGTAGGAGAGTGAGAGAATTGGCACATACCTACGCCGGATGCGTTGTTAATTGAGCTTCGAGATTTTGTCATGAGTTCGCACGTATCGGGATCATAACCGTGGTCCGTTGTCGACTGGTTCAGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGGTACGTCCTAGAGATGGCCAGGGTCCGTCGGCCGATCTGAGTGAATGCGGTCGATGTGGGGTCGTTTTTCCTGACATCGACTTAGAAAGAACCTGTGCTGCTGCGACGTGATTCCACGAAACCTCCGGAACATCGGCAAACGTCAGCCAGGTTGCTCGACATGAATGTTTCCCGACTGCCGGATGCCGATGATCCCGTAATAACACCGCGATTCGGCTCTTGTGCAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGTATTTGCAACAGGCAATTGTCTTTGAACCCCCGTGAAGTCTAACCCGCTGCACGACGAGGGCTAGAACGCGTAGTCACGTGCGCTTGAATCTCGCGATGCGATGCGATGCTCGACTGATTGATTTATTTGTTGTTCTGCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

mRNA

>Mapoly0026s0039.8
TTCACTGTCTTCCTCTTGCTCCCACACACACACGGACGGACACACTCTCTCACACAGGAAGAGCAGCTGCCGCTGCTGCTGCTGCTCGCCTTCCTCCCTTGGAGCCTCTCCTCCTTCTCATACACATCATCTCTCCATCAGCACAAAACATCGGAGTGTCACCTTGCGCTTTACTTTGCCACTGCTGCTCATCACTCGGCTGGTGCTCCTCTCTCCAGCGAGACAACGACAGACTACAGCGCCCCCCCTGCCCATCTTCATCCTCCTGCTGCCTCTATCTATCTATATCGATCAAGGAGTGAGTGAAGCAGTGAGTGAAATCTACACTGTCTGGCCGATGGAGTGAAATATATCTACTAGTCGAGCGTCAGCATAGCGCTCAGGCTCAGAAAGCTCGGGAAGCGGCACGCCACTGCAAGTCACTTTATTGTCCTAACGAGCGACCGAGACGGAGAGTCGGGGGGAGAGAGGGAGGGGGAGTGAGAGATAGAGAGAGAGATCGGCTGTCGAGTACTATTCTCGTACTAGGAGTCGCCTGGCGGCACTCTGTGGTGCGGCTCGGCAGCGCTGCGTCGACCTTTTCCATAACGTTTTGCCTCGCGTTGCCAAGCTCGTCGACGCTCAGGCTCTGGCTCATGGACGACAGAGTAGTTTATTGGTGTGCTTGAAGCCTGTCCAATAAGACACCCAAGGGAGGGAGTACTCTCGGTGTGGAGAAAACGCGCGAGGAGATGGATGGGGCTTCAGGATTCTGTAGGAACGGGTGAGTGAAGGACAGACAGCCTGCAGTCTGACTGGCCCAAAATAGGAGAAGAGAAGGGGGCTTGCAGCAGAAGTGTGAAATTTCGAGTTAGGGATAGGAGGCACTGATTTGCGAAGAAGGCGAGAAGAGACGCTGCCTGATTTGGTGGATTGGTCGTCCGAGCTGCTCACACAACCTCGGGTTTTCGTCTTCTGCCTGCCTGCCTGCCCGCCCAAGTTCGCTCCGGCTGTGACCCAGCAACGACTGAGATCGACACGCGAAGGAGGAGCTGGTGCACGAAATACTCGCTCTAGCAGCAACCTCTGTGGCTGCTGCTACTGCTGCTTCTGCGACACACAGACTGACTAACTGACTGAGAGCAACTCGAGGCGCAAGGAGATGAAGATTAGTGGAAGAGTTTACTTCTGAGGTTTAGACACCGGGGAGGGGATGAGAGCCTGTGAAGTGCATGGCAAATAGTCGAGGGCAGCGGGGACCTGGGGTGCCCGCGCCTATCGCATCAGCATCGCCCCCTGTACTCCACGGCATGCAAGGCCTATCGTCTTCACCTCCTCATCTCATAGCAAGTTTTGGTGCGGAGCCAATCAAAGATCACACTGGAGGATACGACCTCGGAGAGCTTGAGCAACCCCTTAGCTTCAATCTGGACGAAGAGCTAGACCTTGGAGAAAGACATTCGACTGTTACATCGCGACCAACGCTCCACATACTGCAGTCAGGCCCCTTTCGCTTCAGTGACACCGCAAACAAGGTAAGGAGTTGTGGGTTTACTGCATCGATCAATCAACGAATTTTTTCGCCCTCCTTTTGTCTCCTTTTAAACCTCCCGCAGACTAGCAGAGGCAGAGGAATCTTTATGTGTCAATAATGAACGTCTGCAGTTTGGTGGCGCTTGTATATATCTGATGTAAGCATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGAGTTGTTTGGGTTCTCTGTGAGAGAATGTAAAGGTGCTGTCCCGACATCATACGTATGTGACATCCCGTTTCGGCGTACCGAAGCCACAGCTGTGAACGATCCTGAAATAGATACCCACATTTGGTATGGCCAGCTGTTGATGATGGCCGGACACAGGGTTGATGAAGGGTTGTGAGGGTGGATGAATGTGGAGGGTATGTCAGATGTAGGCTTGAAGTATTTTCGGCGCTTGTTGGTGCGGGTGGTAGGGTTGTCCATATTTCCTTTGTTTCGACTGTACACAGTTTGGGGTTTCCGAGCCTTCGGTTGAGCTCTGACTGCTTTCCACGAATGTTGCTTGCTTGCTTGCTCTCTCTAGCTCTGCTGCTGTAGCTGGCTAGGTACCTCGCTGGGAAGGTAGATTCTTGGATGGGTTTTGACTGCAGTGTTCTACGGCGCTCATGGAAGATCATCTCGAGGCTCTTCTCTTGTGTGGTTTGCCCGCCTCTGCCGTGCCTAAGTCAAGTCGTCATCGTCCCTCACACCCTTCAGAGCGCTATCCAGCCTGGACACGACTGTTCTGCACGCACTCCTCTCTTCCCTGCAGGAGAGCGATCGACCTAGAGATGACGGAAGAAGTTTTGAGGTTACATGCGGTTTGCGGATGATGCTGATGCTGATGATGGATGATGTTCTGGATCATGGTTGACTACTCAGCGACGTAGTTCCAGTGGCAGAGCCAGAGCACATGGTCCCTCATCTCTTGACAGCACCGATCATCTCGACTGTGCGTGCGCTTATGTGCAGAGCGTGTGAAGCTCCTACGTTAGCTAGGTGCTATTACCCTAGTACTTTTCAGGTTAATAACTTAAGTACAGTAATTTAAATTAAGCTATCTCTAGGTTGTAAGTAAATTGCTCAGGGAGGTGGAGCTTACATGGTTCAGTGTCCTATTCTTTCTCCCTACAGGATTTCTCATCATGTACGTACTGTGCTTGATCAGCTCTAAGTGAAGTATGTTTTCGGCCAGAAGCCGTCTACCCTAGTGTACCTAGCATAGTCTTCTGCCAGAGCACCACTTAACACTCTTTTTGAAAGTGACATTGATCAATCATGCACCTACATATTTATGTGCCTCCACCTTCTATTCGATAGTAAAATTTTTTTGCACTACTTCC

CDS

>Mapoly0026s0039.8
ATGCTCACTGGCATGCACCAGCAACGACAACAGCCGAATCAGCAACAGCAGCAGCAGCAGTCGTCTCAGGTCACTTCCCCATCCGCTGCAAGCACAGATTCGCGATCTGCACACTTCACACCTAGAAGGCACCCGAGCTTTGAGTCCCCGTCAAGCAGGCAATTTGAACATTGGGGAGACTCACGGATGGCTGATAATAGCCCCCGTACTGATACCTCTACTGATATGGAAGCTGACGTGAAGGTAGACAACTGGTTGGAGGATGCACACCATGGGGCTAATGCAGGGTCCAATGCCTCCGATCACGAAGCCACCAAAAATGGTGACTCCAAAGCACTGCGGCGCTTAGCGCAAAATCGAGAAGCAGCCCGAAAATCCCGGCTGCGGAAGAAGGCTTATGTGCAGCAACTCGAGTCTAGCCGAATCAAGCTCAATCAGCTTGAGCAGGAGTTGCAGCGGGCCAGGCAGCAGCTGATGACGGTCAGAGGGGAACGTGTGCAGGGAGTCTATCATCTGGGTGGTTACGGGGACCAGAACCCCCATGGTGTGGGAGGTAATGGCGTCAACGGGGCTATCAATCCCGGCGCCGCTGCCTTCGACATGGAGTATGGGCGGTGGGTGGACGAGCAGATCCGTCAAATGTGCGACCTTCGTGCCGCATTGCAGGCGCACGTCGCCGACAACGAACTTCGTGTATTAGTGGATGGAGGGATGGCTCACTACGATGAGATTTTTCGTCTGAAGAGTATCGCGGCGAAGGCGGATGTATTTCACCTCGTCTCGGGCATGTGGAAGACACCAGCTGAGCGGTGTTTCATGTGGATGGGAGGATTCCGCCCGTCTGAGCTTCTGAAGATTCTAATCCCTCAAATCGAACCCTTGACCGAGCAGCAGTTGCTTGGTATCTGCAATCTTCAACAGTCGTCGCAACAGGCTGAAGATGCTTTATCTCAGGGTATGGAGGCACTACAGCAGTCTCTAGCAGACACATTAGCGGCGGGTTCCTTGGGCTCATCTCCGAATGTGGCCAACTATATGGGGCAAATGGCGATGGCCATGGGCAAGCTTGGCACCTTGGAATCTTTCGTACGCCAGGCCGACAATCTTCGGCAACAGACTCTTCAGCAAATGTATCGTATCTTAACAACACGGCAAGCAGCCCGTGGTCTTCTGGCGATGGGGGACTATTTTGCCCGGCTGCGAGCATTGAGCTCCCTTTGGTCTGCTCGTCCTAGAGATTGA

Protein

>Mapoly0026s0039.8
MLTGMHQQRQQPNQQQQQQQSSQVTSPSAASTDSRSAHFTPRRHPSFESPSSRQFEHWGDSRMADNSPRTDTSTDMEADVKVDNWLEDAHHGANAGSNASDHEATKNGDSKALRRLAQNREAARKSRLRKKAYVQQLESSRIKLNQLEQELQRARQQLMTVRGERVQGVYHLGGYGDQNPHGVGGNGVNGAINPGAAAFDMEYGRWVDEQIRQMCDLRAALQAHVADNELRVLVDGGMAHYDEIFRLKSIAAKADVFHLVSGMWKTPAERCFMWMGGFRPSELLKILIPQIEPLTEQQLLGICNLQQSSQQAEDALSQGMEALQQSLADTLAAGSLGSSPNVANYMGQMAMAMGKLGTLESFVRQADNLRQQTLQQMYRILTTRQAARGLLAMGDYFARLRALSSLWSARPRD

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>