Mapoly0027s0033



Description

B-box zinc finger

Reference DB

Database ID Description
GO GO:0005622 Intracellular
GO GO:0008270 Zinc ion binding
OrthoMCL OG5_160011
PFAM PF00643 B-box zinc finger
PANTHER PTHR31832 FAMILY NOT NAMED
PANTHER PTHR31832:SF5

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBBX1 transcription factor, BBX Mapoly0027s0033.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0027s0033.1 scaffold_27:291794..296900  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0027s0033.1  

Gene structure:

mRNA scaffold_27:291794..296900  ( + strand )
five_prime_UTR scaffold_27:291794..292261  ( + strand )
five_prime_UTR scaffold_27:292621..292992  ( + strand )
CDS scaffold_27:292993..293085  ( + strand )
CDS scaffold_27:293870..293966  ( + strand )
CDS scaffold_27:294190..294305  ( + strand )
CDS scaffold_27:294786..295103  ( + strand )
CDS scaffold_27:295465..295554  ( + strand )
three_prime_UTR scaffold_27:295555..296900  ( + strand )

Sequences:

Gene

>Mapoly0027s0033.1
ATGCGTTGGCTGCTCTGCCGCATCGGTTCGATCCGCGCCGGTCGTGCTCGGAGTAACGCAGCTCCGTATTACGGCGTAACCCGTCGGTCCGAGTTTGCTCATTCCATCCGCGCGCGCGGTGTGAAACGAAGGCCGAAATCAGGGACTCGTCGATCCGCGGTTCAGGCCGTCGTCACTGGCGATTTGTTTGTTTTTTCCCGGACGTGATTTCTGTCGTTCGTTTGTTCGTCCGTTGCCTTCTGGCGGAGGAGGAATGTTGCGGACTTGATTGCGTTGGCGCCTCACGCTCGTCGAGTTTGCAAGTGAGTGGAGTCGGAACGTCGGTCTTGGAATCGTTAATTTTTTATGTGGAGAGGAGAGTGAGAGGGCCATCGATCGTCAAAATCCGCGCTAGTTCAGGTGCTGTGCGAGCGAGCGAGCTCCTGGGGATCTCGCCGGGAAACACGAGAGAGTGGCTGCCACCGCATGGTATTATTATTCTTTCTACAGCCCACAACGGTCCCGCTTCGTTCGATCAGAGCATGGCAACAGAAATTCCGGACACGGTTTGTCGAGGTGGAGGTGGAGGAGGAGAAGTGTCGCGCTTCCCGTGAGTTGTGCAGGAAGTGGTTCCCTTCGTCCCACCTCCTGTTTCCCAGCGGAGGCATCTTGCGGTGCGATCGTTCACGAGCACTGCAGCTCAGTCTTCCGCGCTAGTGCCTGCGCGAGTCCTGCGATCTTGGACCTTGTGTGTTTTCTGCTCGAGTGACCAAGAATGTGTTCGTTCGTTGGTGTGGTTCGCGATTCCTGACGGTTTCGTTGCTTGAATCGTTGATGTTTCTTCACAGGAGGTTGGTGCACACTTCGAGGCGGCCAGAGTCTGACTGGAAGCAACCGAACACGAGAAACGGCAGTTTGTAGAATCTGGATGGTCGCATGCTCTTGCTGCTTGAAGCGCTCTGCGAGTTCGTGGGAGGCAGGAAGCAGGAAGGTGTTTGCTCAGCATAGGTTGGTAGAAATCGAGGACAATTAGGAAACGGACCTTGCGCAGAATGTCAATGTATCACGGTGTGAGACGTCTGATAGCTGTCACCGGGAGGAGTAGCTCGAATTTTGGGGTGCAGGAGTTTGGGAGTGCGACCGTAGAGGAACAGATCAAGGGATAGTTGGCGGAAAGTTCAAATTGTTTTGGAGTGGATAGCAGAAACCCATAGACGCAGATGCGGACTCTTTGTGATGTTTGCGAGGCAGCGCCCGCGCGACTTTTTTGTGCCGCCGACGAGGCTGCACTGTGCTTGACATGTGATGAGAAGGTACCTTCTCGCGGACATTGTTTCTTCTGCATAGTTCTTTGTTCAACTCTCTGGCAGAATTTTGATCATCCTATTTTTCGTGGAAATTGACATTGCCTGTACGGGCGTGTTCTGGTCGATCCACGCTACGAATCAAGGATTGTGACAAGGTGATAGTCCGACGTCAGTACCTGCTGGTCTGGCCTCTCGAGGAAACTTTAACTCCGGGTCTAAGGAGGAGACTTCATCTGGATAGGAAGTGCTTTCCCACAATGGTGGACTCGAAGCTTAGGCTGGGTTGGAGTACTAACAGTTCTTCGTTTTCTCCTCTAGGACAGAATTTTACACTGGTCACGACGTTGTGTTGGCAAATCCCTCGCGTTGTCGAAAGAACGCCCTTTCTTCAATGAATGTCAGGGCATTAGCCATCGTCGAAATTGTCCCTCAGTGCTTCTGCTCAGGAACGAACGGTTTATTCCGTTCGTGACCAGCTACTGCTCGTCGGCCACCGGTGTGTAGACTGTAGCCATGAGCATAGTCTCTAAAATAGTTTGAGAAGTGAGTGAGTCCACCATGTCGCACAACGTGCAATCCTTGCCGGCAGCGTAGAAGGAAATAAATAAATATCTCATGTCCGGCGGGGCGGTCACTACCAGCTTTTTTTTGGCCACTTGCGACTTGGGATTGAGAGCGTTCTCTCCCGGCATCAAGCTTCAGAGTAGTGGTTACGGACATCGGCCAGAACTAGACGACTCTTCTAAGTCAATTGACAAACTTATCAGTTTATGGTCATCTCTACATGTAGGTACATGGATGCAACAAATTGGCCAGTAGACACGTGCGGCTGGAGCTCGCCGAAGCGCGGGCAGTGCCACGCTGTGACATCTGCGAGAACGCCCCCGGTACACTAAACTTTCCTTCACAGAATGTGCCACCTCGGCCTCATTTCTTCCACGAAACTATTTGTGCTTGTAGTTGTCAGTTAGATCTCACGTGTGATACTTGTAGTACATTTAAGACATCGGATTTTTGGAAACTCGAAGGTCCAGTCAGACAGTGTTATCTCATCGGAGATACTGTTAGGGTTCAATTAGGTTGATTATTGCCCGTTCCATTGTTGTGCAGCCTTTTTTTTTTGTGGCATTGATGGTACCTCGTTATGCCTACAATGCGACATGGATGTGCACATCGGGGGAAAAAAGACCCACGAACGCTATTTGTTGATGGGGCAACGCGTTGAGGTTCGTAATTTGAGTTGATTTCAATTATACCTGCTTGTTCGTCTAAGAAGTGGACGCGAATGTTACTTCGCTCGTTGTGTTGTCTGAAATTGTTCTTTATTATTCAAAGTTTAGTTCATGTATAGTGCAAAGGGATTTGAAACGAACTTGATTAGAAATGAACTCGATAAACCATTGAAATAAATTTGAAGATCACTCTGATAAACTTGTACGTATGTTTTGGGACGTGGAGTTCATATAGTAAGTACCATTGTGTGTTGATAATTTATGATGTGAATGTTGTTTTGTTCCGATCGAGCTCTGAAAATTATTTAGCTAAAGATAAGAAGGCGCGTATGTTCGTATGAACGAACATATTGTAGTTCGAGGACAAGGACCTGAGACTCGCTGGCCTGACATGTTACGGACAGATGTTTATGTTGAGGTGAAGTTGAAATCTCAGTCACAAACTCATTTTTTAGTCGTGACAACTGCCTACAGTTACCCACGAAGCCACGCCAGGATGATCTTGCAGCAGTGAAAGACGGTGCAACAAAGGACGGGAAGAAATCCAAGGATGGAAACGAACACATTCACCATCACCACCACCACCACCATCATCATCACCATCACCATGAAGGACAACAGGACAAGACCAAACCTGTCACAAGTGGAGAATGGAATAACAGCAATGCACCTGCCGTAGCCATTGCCGTAGGTGACGAGGATTTGCAGTCACCCACGAATCGTCGGGTGTCGCGGATGATAGATCTGAACACAAGGCCAGCACATTTACAGCAATTGGCACATACCAGCAAGGTATCTACCTCTAGAATATTCTCATCTTGTGGTCTTCTGTAATCGTCAGTCTGATTCAGTTTTTTGAGGTTCATTCACAATTAGAGATCAAATACGACGTCTGATCCTTGTCCAAAGCAAGCAGCGCAAATGTTGACATGTTGAGTACTGCTGGACATCAAAATTGTTTGACGGAGTTTGAGCACACATATTCCATAATTACAATCGCAGCTATGTACTCATTTCATTCGAAAGATAGAACAGGCTTTTTTTTTTTTTTGGGTTACAGTGTAAACGCTGGAGTCGAATCTATCTAGTGCAGCATAACTTACATATACTGGGAATGTCTCGTCAATTCTTACTGGTTGTCCTGTCATTGCAGGACCAGGAGCTGGCCAGCAGTGACGACGAATGTGTTGGAGTTGTCCCCGAGATGGCCCCAAGATCGTCATCAGAAAATTCGGAGGAATAATCGGCTAATTGGTTCATATTCCATTCTCTGTTGTCTTCCATAAATGAGGTTAACAATTCTGTAACAAAAGCTTCACCTCTTTTTTCTAGAATGACCTTTTCAATCGGTAGTTCCTTAGTCAAGGAACCAGTTGAGTAGAATAGAGATGGGTACATGTTTTCAGACTGCCAACTACCGCCATGCATTTGCAATTTAGTGTTATTATATTCCGCGGCATCTTTTTTAGCACTGATACTCCTTTTTGAGTTGTTGTCGCTCCTCTATCTCAGTTGCCGCTTGGCAGTGTCTTGTCTTCTGAAGAATGAAAGGTGGAGGAGATTCCTCAGTCGAATCCTGATATGTGCTGAGATGTGGACTCCAATGGTTAAAATGGAAGGGTTAATGCACCAATTTTTTAGGCACATGAATCTTGGAAGATCAGGATGTTGTCAAATGAGGACGTAAGCTCTGTTTGAAACTTTTAGGAAAAGTCTAGTTTAGAACGCAGTCATTGGATCTGTAGAGATGTGCCAAGTCGCTTACATGTTCGCTCGTGAACACACAAAGCTATTAAATCAGCTGGGCACATGATTTTAGAAGGTCTTGTTTGGACCTCCTCATCTTTGGGTAGTTCTGGGGAAGATCAAGAAGATCGTGTAAAAAGTCTCAAGCTATACGTTTGTATAGAGAGCACAGAGAAAGGTTTTATTTCTTTCACAATTCCAGGCACCTTTCAGTCGTTCATCCCCCAATCTTTTATTTGTGAGGGTCGGGGGACATTAACAGGTTGTGCTCAAGATCATTTCAATAGTACCTCTCATGTTAATTGGGAAAGTTCCTTGGAGTACCTACTCACCTTTTTCTCTCAAGGTGTACTTTTACATACACTCCTTCTTACTGAACGTTTTATGCTTCTTTCATTGCTCCTTGTAGCATAGATATCCGTTCCCGGTCTCGGAGTGAGCGTTTTCTGTTTTCCCAAAGTCAGCTACTCATTTGTCCTGCATTCATGTCTTCCACTGGTATACGCAACTTTCCTGTCTTCTGCTATAATTTCGTAGCCGCTGACCAATCGTAGTCCCTGGGTTCTACGTTCTTATTTCGAAGGCGTACAAGCCCATCCTTGATACAGTACCTCTTCAGACTCGTGTGCTTTAGTTGATCGTATGTTCACCACACTTTGCATAATGGTCTTGTTTCGTTTTGTTGCATGACTCATCTAGATCTTGGTTGTCCACCACACTCTTGTAGTCGTTTATAGGAGCAAAATTTCTCTGTTGCTGTTTTTCATGTTTCTTGGCTTATTCCTCGTCTGCATGCCGTTTTGCTCGATCGTTGGCTTGTGGTCGAACTCACGTGTTGATCGC

mRNA

>Mapoly0027s0033.1
ATGCGTTGGCTGCTCTGCCGCATCGGTTCGATCCGCGCCGGTCGTGCTCGGAGTAACGCAGCTCCGTATTACGGCGTAACCCGTCGGTCCGAGTTTGCTCATTCCATCCGCGCGCGCGGTGTGAAACGAAGGCCGAAATCAGGGACTCGTCGATCCGCGGTTCAGGCCGTCGTCACTGGCGATTTGTTTGTTTTTTCCCGGACGTGATTTCTGTCGTTCGTTTGTTCGTCCGTTGCCTTCTGGCGGAGGAGGAATGTTGCGGACTTGATTGCGTTGGCGCCTCACGCTCGTCGAGTTTGCAAGTGAGTGGAGTCGGAACGTCGGTCTTGGAATCGTTAATTTTTTATGTGGAGAGGAGAGTGAGAGGGCCATCGATCGTCAAAATCCGCGCTAGTTCAGGTGCTGTGCGAGCGAGCGAGCTCCTGGGGATCTCGCCGGGAAACACGAGAGAGTGGCTGCCACCGCATGGAGGTTGGTGCACACTTCGAGGCGGCCAGAGTCTGACTGGAAGCAACCGAACACGAGAAACGGCAGTTTGTAGAATCTGGATGGTCGCATGCTCTTGCTGCTTGAAGCGCTCTGCGAGTTCGTGGGAGGCAGGAAGCAGGAAGGTGTTTGCTCAGCATAGGTTGGTAGAAATCGAGGACAATTAGGAAACGGACCTTGCGCAGAATGTCAATGTATCACGGTGTGAGACGTCTGATAGCTGTCACCGGGAGGAGTAGCTCGAATTTTGGGGTGCAGGAGTTTGGGAGTGCGACCGTAGAGGAACAGATCAAGGGATAGTTGGCGGAAAGTTCAAATTGTTTTGGAGTGGATAGCAGAAACCCATAGACGCAGATGCGGACTCTTTGTGATGTTTGCGAGGCAGCGCCCGCGCGACTTTTTTGTGCCGCCGACGAGGCTGCACTGTGCTTGACATGTGATGAGAAGGTACATGGATGCAACAAATTGGCCAGTAGACACGTGCGGCTGGAGCTCGCCGAAGCGCGGGCAGTGCCACGCTGTGACATCTGCGAGAACGCCCCCGCCTTTTTTTTTTGTGGCATTGATGGTACCTCGTTATGCCTACAATGCGACATGGATGTGCACATCGGGGGAAAAAAGACCCACGAACGCTATTTGTTGATGGGGCAACGCGTTGAGTTACCCACGAAGCCACGCCAGGATGATCTTGCAGCAGTGAAAGACGGTGCAACAAAGGACGGGAAGAAATCCAAGGATGGAAACGAACACATTCACCATCACCACCACCACCACCATCATCATCACCATCACCATGAAGGACAACAGGACAAGACCAAACCTGTCACAAGTGGAGAATGGAATAACAGCAATGCACCTGCCGTAGCCATTGCCGTAGGTGACGAGGATTTGCAGTCACCCACGAATCGTCGGGTGTCGCGGATGATAGATCTGAACACAAGGCCAGCACATTTACAGCAATTGGCACATACCAGCAAGGACCAGGAGCTGGCCAGCAGTGACGACGAATGTGTTGGAGTTGTCCCCGAGATGGCCCCAAGATCGTCATCAGAAAATTCGGAGGAATAATCGGCTAATTGGTTCATATTCCATTCTCTGTTGTCTTCCATAAATGAGGTTAACAATTCTGTAACAAAAGCTTCACCTCTTTTTTCTAGAATGACCTTTTCAATCGGTAGTTCCTTAGTCAAGGAACCAGTTGAGTAGAATAGAGATGGGTACATGTTTTCAGACTGCCAACTACCGCCATGCATTTGCAATTTAGTGTTATTATATTCCGCGGCATCTTTTTTAGCACTGATACTCCTTTTTGAGTTGTTGTCGCTCCTCTATCTCAGTTGCCGCTTGGCAGTGTCTTGTCTTCTGAAGAATGAAAGGTGGAGGAGATTCCTCAGTCGAATCCTGATATGTGCTGAGATGTGGACTCCAATGGTTAAAATGGAAGGGTTAATGCACCAATTTTTTAGGCACATGAATCTTGGAAGATCAGGATGTTGTCAAATGAGGACGTAAGCTCTGTTTGAAACTTTTAGGAAAAGTCTAGTTTAGAACGCAGTCATTGGATCTGTAGAGATGTGCCAAGTCGCTTACATGTTCGCTCGTGAACACACAAAGCTATTAAATCAGCTGGGCACATGATTTTAGAAGGTCTTGTTTGGACCTCCTCATCTTTGGGTAGTTCTGGGGAAGATCAAGAAGATCGTGTAAAAAGTCTCAAGCTATACGTTTGTATAGAGAGCACAGAGAAAGGTTTTATTTCTTTCACAATTCCAGGCACCTTTCAGTCGTTCATCCCCCAATCTTTTATTTGTGAGGGTCGGGGGACATTAACAGGTTGTGCTCAAGATCATTTCAATAGTACCTCTCATGTTAATTGGGAAAGTTCCTTGGAGTACCTACTCACCTTTTTCTCTCAAGGTGTACTTTTACATACACTCCTTCTTACTGAACGTTTTATGCTTCTTTCATTGCTCCTTGTAGCATAGATATCCGTTCCCGGTCTCGGAGTGAGCGTTTTCTGTTTTCCCAAAGTCAGCTACTCATTTGTCCTGCATTCATGTCTTCCACTGGTATACGCAACTTTCCTGTCTTCTGCTATAATTTCGTAGCCGCTGACCAATCGTAGTCCCTGGGTTCTACGTTCTTATTTCGAAGGCGTACAAGCCCATCCTTGATACAGTACCTCTTCAGACTCGTGTGCTTTAGTTGATCGTATGTTCACCACACTTTGCATAATGGTCTTGTTTCGTTTTGTTGCATGACTCATCTAGATCTTGGTTGTCCACCACACTCTTGTAGTCGTTTATAGGAGCAAAATTTCTCTGTTGCTGTTTTTCATGTTTCTTGGCTTATTCCTCGTCTGCATGCCGTTTTGCTCGATCGTTGGCTTGTGGTCGAACTCACGTGTTGATCGC

CDS

>Mapoly0027s0033.1
ATGCGGACTCTTTGTGATGTTTGCGAGGCAGCGCCCGCGCGACTTTTTTGTGCCGCCGACGAGGCTGCACTGTGCTTGACATGTGATGAGAAGGTACATGGATGCAACAAATTGGCCAGTAGACACGTGCGGCTGGAGCTCGCCGAAGCGCGGGCAGTGCCACGCTGTGACATCTGCGAGAACGCCCCCGCCTTTTTTTTTTGTGGCATTGATGGTACCTCGTTATGCCTACAATGCGACATGGATGTGCACATCGGGGGAAAAAAGACCCACGAACGCTATTTGTTGATGGGGCAACGCGTTGAGTTACCCACGAAGCCACGCCAGGATGATCTTGCAGCAGTGAAAGACGGTGCAACAAAGGACGGGAAGAAATCCAAGGATGGAAACGAACACATTCACCATCACCACCACCACCACCATCATCATCACCATCACCATGAAGGACAACAGGACAAGACCAAACCTGTCACAAGTGGAGAATGGAATAACAGCAATGCACCTGCCGTAGCCATTGCCGTAGGTGACGAGGATTTGCAGTCACCCACGAATCGTCGGGTGTCGCGGATGATAGATCTGAACACAAGGCCAGCACATTTACAGCAATTGGCACATACCAGCAAGGACCAGGAGCTGGCCAGCAGTGACGACGAATGTGTTGGAGTTGTCCCCGAGATGGCCCCAAGATCGTCATCAGAAAATTCGGAGGAATAA

Protein

>Mapoly0027s0033.1
MRTLCDVCEAAPARLFCAADEAALCLTCDEKVHGCNKLASRHVRLELAEARAVPRCDICENAPAFFFCGIDGTSLCLQCDMDVHIGGKKTHERYLLMGQRVELPTKPRQDDLAAVKDGATKDGKKSKDGNEHIHHHHHHHHHHHHHHEGQQDKTKPVTSGEWNNSNAPAVAIAVGDEDLQSPTNRRVSRMIDLNTRPAHLQQLAHTSKDQELASSDDECVGVVPEMAPRSSSENSEE

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>