Mapoly0028s0060



Description

GL3 (GLABRA 3), TRANSCRIPTION FACTOR

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_164463
PFAM PF00010 Helix-loop-helix DNA-binding domain
PFAM PF14215 BHLH-MYC and R2R3-MYB transcription factors N-terminal
PANTHER PTHR11514 MYC
PANTHER PTHR11514:SF9 GL3 (GLABRA 3), TRANSCRIPTION FACTOR

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH3 transcription factor, bHLH Mapoly0028s0060.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0028s0060.1 scaffold_28:623273..638453  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0028s0060.1  

Gene structure:

mRNA scaffold_28:623273..638453  ( - strand )
three_prime_UTR scaffold_28:623273..623609  ( - strand )
CDS scaffold_28:623610..623617  ( - strand )
CDS scaffold_28:631793..631922  ( - strand )
CDS scaffold_28:632260..632748  ( - strand )
CDS scaffold_28:632959..634686  ( - strand )
CDS scaffold_28:635504..635560  ( - strand )
CDS scaffold_28:635812..635826  ( - strand )
CDS scaffold_28:635999..636098  ( - strand )
CDS scaffold_28:636400..636582  ( - strand )
CDS scaffold_28:636931..637043  ( - strand )
five_prime_UTR scaffold_28:637044..638453  ( - strand )

Sequences:

Gene

>Mapoly0028s0060.1
GAAAGCATTCATAAGGTCTCCAGCTTACCCCGGAACACATCATATTTTCAAACCGTGTGTTCGATTTCTGAACTCATCTCTCTCTCTCACCATCCATCCGTCTTCCTTTCTTTTCCCTTCCCTTCCTTCCTTCTTTCTTTCTTTCCTCACCTTCGCTTGTCCCTACTTCCCGCTCTCTCTTTCTCTCTTCTACATACCCTCTCCTTCCCCCGAACCTCGTGCTTGCCGGCATTCTGCTTCGCTTCTCGTGCTAGCTCATTGAATTATACTGTGCTGTGCCAAAGTCGTCCACTCCGATACCATCTCGTGAGGATTCTGATACCGTCTCGTGGCGCATGCTTGCGCGTTCGCTGGGGCCTCGGAGTGTCCAGACTCCAAAGATATCTGACTGACTTCGTCTTATTTTCTCTTTTATCGAGCGTCAGTAGATGGGGAGGCAAAAAGCTGTCCGTTCTCTGCTGGGGAAGAGAACATTAATCTGGGGTCAAGTTCTCACACTTTGCCAATGGAAGAGAGCATGAACTTGTGGTGGGGTTTCTTGTCCCTCTCGAGCACGCGGTCCGTCTCTATCTCTCGGCACTTGAAACACCGTACAGATTGAAACAGGCGTCAAATGACACAACTTCTTTTCAAGCACGCGCAGTCGGACCAATTCTTACTGTTCCGCGGTGGGAAGGGGTTAGCCAATTCGCCGCACTCTCTTGCTGAGGACGACCTCCTCGAGTTCTCGATTTACAGGGATTAGAACAAAAAACCTGCCCCAAATGTTATAATGCTTCAGCCTACGGCATCAGGATGACCGACAGAACTGACATAGGGCAGAATTATCTTCGAGTGCGTTCCAGCAATCTCGAACCTAGCACCGTCTTATTCGTAGTTAAGTACAAGTTTCAAACATTGGCGAGGAGGTGTCATCGGCGATCGACGTCCGAACCCGATAACCATAGGATACGATTCTGCTGAATGCATGGGGGGTGAAAAATATTATCGATATTCATATTCGATTTCTTTCAGTGCTGCGAAATTCGGGCGAGATATATATACTCATATATATATTTACACATATATTTCGCTAGTTTTTCTCACAGCTGCTCTAGCTAGTCTCAGGAGTACAGCAGATGCCTGTGGCGTGAATATCTTTGCTAGTGGAGTAATTAGAGCAGAATTTTCTAGAGGGCTTGAAGGAAACTGAGGTCGATCCTCAAAGTCCGACTGTAGGATCTGTCGGTCTAGTCTATGCGCATTCACCTACAATTTCTTGTGTTCAGCGTAAATTTTTCTCAACTCTGGGGACAAAACATCAGCTCGACAGTATATATCGTGCAGTTTCCAACTTGAATTGGCAGCACATTGTGGCCACTTTTCAACCGTGGTTTGAAAAGGTGCCTACATGCTGCCTTGGGCTGAGACATGTCCTTCATGCAAGCTGAGCAGCAACCCTCTCCCTGGATCAAAGACCTGGTGCATAAACTAAAATGGACCTACGCTGCTCTATGGACGCTGAACACAACAGATGGTTCCAGGTAACATCCTGCTTCAAGTTACTGTCTCCTGTTCCAAGCAAACTGTGAAAAGTTCTAGCTTTATGTATTCATATATCATGGGCATTTTGAATTCCTTTATCTTTATGATACACAGTATTCATTTTTTCTGCTTGTCGAAGATTGTCACATTATCAAGTTGGTGCAGCTCGTGCTGCTGTTGCTCAGCCTTGAGCAGGCAAACTCCTATCTGACATTCTCATAGCTTTGGTCTCAAAAATAGCGAAACTCAGACCAGAGGGTAAAACCCTTGGCTCTTCTCGTACGGATGGCCGAGCAGGAAATCACTGCATGCTCACCATCTCGGGTCGGAAATTTGTGACAATGCAGGCCGCTAATTGGTATCGACGCAGCCCATACAGTTGCGGAATGGAAGGATGGATGGTACAATTCGGACTCGAATAGGTTGACTAGAGCGCTATCTGGAAACGAGAACGTAGTTAGAGACGATTCACGAATCGAAGCGTTGTTCTACTCCACTTATAAATCGTGCTCCTTTCAGCAAGGATTCGGGTAATTGACAGCTTTTCCCATCACACGAGCGGCTCTTGCGTTCTTTCGCAGTTACTTGGCGTATTCTGAGAGATATCCCTCGATACTGCGGTATCTCATAGTAGCTTGTCCTACCGGCTGGATCATTTAGAATCACCTTCTAGTTGTCAACATTTTCATCCTGAGCTGAACATATAAGATAGGACTTAAATTTTTGCTTCGTATGACTAAGAAGCAATATAATGAGTTGTGGATATTGAGGTGACGAGTCGACTGAACATCAAGGCTGGATGGATGTGCGTGGGGTGATTTGACCAAGCAGATACGTCGGGCTCGTACTGCTTAAAAGAGAAAGCACCTGGCTGACTGGCAGCCAGGAGGTCCTCGAACACGCGTTTCATACCCAAGCTCTCTTCTTGAAGGTTTCTCTTTCTCTCACACGCGGTATTTCCCTTTATGTCAGTTGGCGGAGCTTCCGTTGGATTGTGGTGTTTTTAATCCGTCACTGGATGTTAAGAATTATCTGACACGTTCCTGTTTGTTTGCACCTTCCTTTGCATTTGTCGACGACCGGTATATTATCTTGCTACTCAGACGGCACGTATTCAGGTACTGTGGATCATGTTTTGGGCTTCAATTTCTCTATTTGACTTTCTGAAGCTCATCCCTCGTCCGCAAGCGAGAGACTGAAAGGATGTTTGGTTTCAGAAGATGCCACTAACTCGAAAACGAATTTCAATTCGATTCAAGCAGTCATTCGTCAAAGTAGAGAGGCCGATAGAGAATTTAGAGAAATCGGATTTCCAACCCGTCAATTGCTGGCTTACACACACACTGGCTTGCGGCCGGGTCGATTGCAGACAGTGATGTGCACGCCTTGGAACAACCACGTACTGGAGCTGGGAAAATTCGAACAGGTGGGGATTTTACCTGCTTCTGATTTGAACTGTGCAATGCGAAACCTCACTCGTACTGTTTTGGAATGGTTGTTCGTTCGCTCGCTCGCTACCTCGGGCCTTCAGTGAGTCAGTCACACGAGAAGCGTAGAGTAGCAGTAAAAGCAGTACTGTAAAACGAGGAGGCGGAGGGAGACGACGTAAAACTCGCGGTCAATGGAGGTAAATCGACGATCATGCGGCCGATGGAAACTCGGCCCAGCGCCGGGAGACAATGCGGTGCTGAAGAACGCGGGAGCCCACGCGGGCGGGCAGAAAAAATCCGGGCAGCACTCGATGCTGGTGAGGTCAGAGAGCGCAGTTTCACGAGGGCGCTCGTCCTCGTTGGAAGAAGGCGATTAGACATGTGGACGAGGGAAGGCAACGTGATTTCGGGTCCACAAGACATTTTTTCTGTGCGCGATCGAAAGGCTGTGGGCCCCAGCAGAGCCCGGCGGTCCGCTGCGCTTTGGAACTTCCATAAAAAAATCGTTTTTGCCTCGCCTTTTATTTTTGTTTTGTCTCCTTTTCGTTTTTCGCCACCCAAGGCTGGTTAAGGCGCAGGAAGACTGTTCCCGTCTGGACCCGCGAGTCACCCTGCGGACGTAGAGAGTCTTCTGCTGCTTCTTCCTATAAGTGACAATTTTGGAGCTCTGAAAGTCTTCGCGCGCCGGGGCCTCGGTCTTCCTTCCACAGACGCATTTATTTGGCGATCACCACTAGCACTGCTCCTGCTGACTGCCACTCCTTACCTAAACCGAAAGCGTCGTTCTCATCATGCTGCATCAAATTGTTGCAGGAGTCGAGGAACGAAAATGTCCTGCATCAGATTCAGCGATGGCTCTCGAGCGTGACGACGCCTCTCAATATTCAGCCCAGTCCCGGTGCAGTGGGTTCAGAAAACGACAGCGGAGGAAGTCGTGAAGCCATGCAGATGTCTCCGTCGATCGCTTCGTCGATGTTTGCCGATGGCTCCAATTGCAACGTGCACTTCGGGCCGTCATCTGATATTTTGCTCAAGCGCAATAATTCCGGCCAAGGCAGCGGCGCGGGCGGTTTCTCGGTGTCGGGCCATGAGAACGCCTCCGCCTCCAGCGGTGCCCCGGGCGCTGGGAGTCGAGTGCAAGTGCAGGTGCAGGTGCGCAAGAAGAATGGCCTTGGCAGGTATCCCCCGCACTCTCACGATGCCATCTCGCTGCTCAATCGACATAATCAGGACGTGCTGTCGCAGAGAAGGTCGATTTCCGGACAGGAGAAGACTTTGGAGGCCTCATCCTTTGTAGAGGAATGGGGGCCGGCGGCAGCTGGAACGAGTAGTATATTCCAACAGGTGGTCGGGCATGATTCAGATCCTATCATCAGTTGCAGTGGCATGGGCATACCAGGAATTTCTTCGCTCATGCCGCCCGATACGTTCTCGCAGCAGCAGCAGCAACAGCAGCGCTCTCATCCGAGAGGAGCCGCGAGCATTTCCTTGGACCAGGCTTTGCTCACGTCATTGCCCATGACAATGGCAACCGACATTTCGGCATCCTTGGCGCTCCCCATGGACATGTTACAGGACTCGGCCGCAAATCTTTACGGTTTGCACTCGAAGAATTCCAGAGAATGGCCCACATTGGAACCCAGCAAAGAGCAGTCTCTTGTACAGATGCTTGAAGAGTTTACCGATGACGACCATTTACAGCGGCTTCAATCGCCAGATCATGCTCTAATCCAAACTGCAGTCGCTAGCTCCAGCGACACTATGGCCGAATGGGCCTCGACTGGGACAGCCTCGATATCCCATCAACAGCAGCATCATCGTCATTACGATCACCACACTCAACAAAGACTTCAACAGCAGCAACGCCAGCAGCAGCAGCAACAACAACAACGAGTTGTCCAGCGACAATTTGAATTTCCTAATAATCCTGCTGTGAGCAGCTTACAAAATATGACAACTCCGAGACCGGCGCTGGCCAATCTCATCTCTCACCAGCAGCATCAGCACCAGCCGCAGCAACACCGGCCGCAATTGGTCCCGCATGGTGGTGGACAACAGCCACAATTGCTCCCCCTAGGCCAGCAGCAGCAGCAACAACAGGTAAATCAACCAGGTCCTCCGAGTTGGCAACAAAACATTTCCTTCACCACGCCGACGGCTTGGGTGCGATGGGTGAGCCGAAAGCAAGCATCACTGTTGCGATACAAAGCTCGAGATCCCAACGGCGCGAGTCCTGCTGCGCTGCGCGTCAATCAAATGGTTCTCAAAAGGCTGCTGACAGAAATGGTACCGAAAATTGCTAAGGAGCAGAAAGCGCGAGAGCAGGAAGCAGGTCAGGCACTGGACACGGAGACCTCGAGCCACGGACACAGAGTCAGAATGATCAGCTATCCGACCACAACGTCGACGAAGCCTTCTGAATCCGGCACCCTCATCCAAGACCCTCAAGCAAGGACCCACATGCTGGCCGAGCGCAGACGAAGAGTGAGGGAAAACGAACATTACGACGCTCTGCGCAAACTAATTCCTCCCACCTCAAGGGTGGGTCACTAAATCCCCTATGTCATGATCATGCAATTGGGTTTGGCTCTCTTCTGGGACCTCGGGCGTGTAAGTTGAGTTCAGTTTTTATGGTCGTCGTCGATATTTAGTTCGTGATACATGACATTAGTGGCTTTCCCTTCCGCTAATTCCTGCCTGCTTTTGCTAATTGATGGCTTCCCATTGCGGTCTGTCACTGTACGTGTTCAGATGGACAAGGCAACGGTTCTGGCCGAAACCATCAAGCTCGTGAAAAAGCTCCGGAGACGTGTGGGGCAATTGGAGAAGGGAAACCCCGACAATAGTGGAACTCCGAACCTGTCATTGGTCACGTCCGAGGATTCGCAAATCGGCACAACTTCTCCCAGTTCACGTGGGGAACCTGGAAGTCCGATACCTGCACGTACAGGAGCCGGTTCCTCTGAACCCGAACTTCAGGAAGGAAAGCCTCCGGGTGGCAGATTTCTCGATTCCTGCCTCGTACCCGCTCCTGCTCCGTCACAAGAGGACAACAAGGAAATTGTTGAGGTTGATAGAAGAGCATGTATTCCGACCGAATTGAGAGCCAAAATTCGGACCTCGCACCGGCCCGACACTGTCATTCACATACTCACATGCTTGAAGGACCTTGGTCTAGAAGTCCTATCAACCAACATAAGCATTGAAAAGGATTGGGTTTACGCGGACTTTCAACTGAAGGTGAGATTTCAATTTCTTCCGTGGTAGTCTTTGAATTTTGTGGTTCCTGACAACTGAGCGGGAACAGAACACTCCATTGTCGATAACCAATAGCTATCGAGATTGAGTTGGTTCATCTCTTGTGAGTGAACTAATCAAGTCCATTGTTATTCGTTGTGATTGTCCATTGTTGATTCGTCTTCGTTGGCTACGCGCAAGAACTCCTGAGAATTTTTCAACGGAAAAGGCAGATTGCAAGTGCTCTCCTATGGCTCTAAAATACTCTTCCGGAGGAAACTCTTCGAAGACATCAGTCCATTTACAAATGCGTCTGTTTTCTGTTTTCTTCTGTCGTCAGATGAATGAAGTTCACATCTGCCGTGTATCACAATTCTGCGAAGAGCTTCAGGAAGCAATACGAAAAGCTATTTTTCCTGCAGAATCTTCCAATGCAGATTCAACTCTAGATGGAAGATCACACTCACAGGGTGAGTGGTCTCCGTTTTCTCGATCATAATTGTTTTCTGATGGTTTGTTTGATTATTTAAGTCTGGAGCTACGTCTTCCCATCTCTTGTCCACGATCACAGTATTCTTGTACATAGTGCAAACTATGTCAAGAGCTGGGTATTCTCTGTTGAGATCATATTTCTGCTGGGGCTTCAGTCCGTTGCTTCTCAGTGTTTTCACTTCACCGATTTGCCCCTTTAAGTGTGGAATTAAGATTCGTTCATTAATTATGCACTCTTTTCCATCCATCCATCATATAGCTCTAGAGACATGTAAGCCTCCGACAACAATAGCACTACGGTGAATACCTCTGCTGCAAGTCTTGAGGTGCATTCACAATTCAGTAGTCCTCTAAAGCACACTCTGAACGCATACGCATAATATATAATATATGTCCTTCAAGGTAGCCACTTCTATGACGTCGGAGCTGAAACAGTTACCACCATCATGTTGACGGTGCCTAGTAAAATTCGGAAGGGAATGTCGAATCATTCAATCATTATGTAGTCGTTTGCCAGACGTCTAACTTAGGCAGGTTCCTGGGTGACAGCCTGGCTCAGAAATCTAACACCATGAAATGAACTCGTGCATCAAGGGACCCCAGTGCATGTGATTTGATTTGCATGAGAGCTACTTGTAATCAAAAAACATAGGCTTAAAGGTTGAAGAAAATGTGCTTGTAATATGATACTGTAGGCTGGATAAACAATAAGCTGTGTTGTATTTTAAAGGAGCGAATAAAAATAATTCTAGAATATTTTATTAAAGAACCAACTGCAAGTATCATGGTTCGAAGTATAAAAACCAGAAATTCCCCCCTTCTATTTCAAACCTAAACCCTTTTCAGGATACAGTTGTCTAATCTGCCAACTTTTGATGCAAGGTTGGTGTCAATTTCCACTGAGCGGTGACACTAGACCCCAAAGCCCTTTTTGGTCTAATACCAACTGCAAATAGAAGAGATGTTCTGATTCTTGCCACCTGGAGAAAGAAGCTAGAAGATAGGTCTCAAGATTCCAAAGGATTCCATCACTATATTTTGATGTGATAGGTACTCCGGACAGTCACTGTAGTACTAGCAGCTACTTAGAGCCCAAAGAAACCTTCAACTGGCATGCACAGGAGCAGTAACAAGAATAGGAAGCAGGGTCAGAGGTTTCAATTCACCTCACGGAGCAAGTTGTGACAATCATCGACTTGCCGAACAAGGTAGTATTCAGGACACATAATTTGGGATTGGTATTAAGATATGCCCTGCCTCCGAAGGTATGTTGTCCTTACGAAAGTTTAACTTTGGTTTGGATTGTAATTATCTCATAATTGTTTTTATTTTGATATTTTGAAAATTGTTGAGATGTTGCAGTAGTTCTAGATGTATCATTAGCATTGCTTCATGTTGCTACTGACTCTCTAATATTAGTCCTAGCTTGCTACTACTCCCATTTCTATAAGATAGGCTATGAGAAATAACACTTACATCATAATCAAGAGATCATTTCAAACGTTTGAAATAGTACCTATTCAATTTAAATTCTACCACTTTTCACAAATCGAGCGTTGCGGTCAACATCTGAAAAAATAATCAATGACAAAATGTATTTCATTAAGGTAATGTATACAAAGTTTAATTTTGAAACTTATAATTCAATAACCTTTTTCTTGACATGTATGAAACCTACCAAACCTTATAATCCTAATATAATGTAGTATCAACCTTTGAAAAATTTTGGTATTGAAGTACTAATCCTTCCAATGCGTATAGAAAAGAACCGACTCCGAAATAAGAAACTTCATCACTCGCACTCCAGGAGTAGGAAACTTTAGTTCCATCAACCGCCATGTAATTCTAATTTTCGGTACACTAATTATTCTTTCCTTCCGACAAATCTTCCACATAAAGCAATATTTTTGGTTCTTCTGATAAATATGATTTGAAGATGATGCAATAGTTCGAGTGTTTAAAAACCATATGATTCTGAGCTTGTTAACTAGATCCAGGTCTATTACAAAATCTTTTTGGTCAATTCACTCTTGAGTAGGTAGTTAAGAAACGTTAGTCTCACATTTTGTTACATTGAGCTACTGATTTTGTTGAATGCTCCATCAAAAGGTACATCCACCACTAAAAGAAGTCGAAAAACCACTTGAAGATGTATTGCTGTCATATTATCTCCCCAACTAATAACATAAGAGAATGCTTTGAGAGTAACCTCAAATCATGGCCTCCCAAGTAGATGTTATAAATTCTCAGTTGCGAGAATAGCAGAGTCTTGACGCATCCCCAATAAGTTGGAAATGGACATTATTCTATACGTCCAAAGCTCTCACTCACTGAGCTATTTCTGGTCTGGTGCAAACAGCATAAACATTCTTGTACCTTTGTCGGTTTGATAGAGAAACTGAAAATATTCAATTGTCTCTTAGTATATTTTCCTTAGTTTGACAATAGAATTTTCTGGTGCTGCATCAGATTCTGTATACGTTTAGAAAAAGTCAAAATACGAAGTCTCGGTGATTTCATTCCATACGTTATGACTAATCTTACATGTATTGATCCCTAAGCAAACCTAGTGATCCTATCTAAAACATGACAAAGGTAAGATTCAACACTTCTCACTCCATTAACGTCCTTCCTCATTGGAGACAAAATCATATAGATACAATACAATATGAAAATTTTGTCTTTGATGTCCATATTCAATTATGAGTACTCTCCTGAAACCTTGTTGTTAGAGCAACAATATCAAAATTGATAAGAACCTCTGGTGTTTAATCTAGATCAGTAAATGTTTTTTATAAATAAGACAGATTACCTTCTTAAGCAATGTAGCCTCAAGAATATCCATGTAGATTACTCTTCTTATATACTGTTACGCAAGTTGTATACCCATCCAAATGCCCGATATCTTAGTCGTTCTCAAAAGCTAGAGCTAAAAGTATTTCGGTAGAGCAAACAACATTTATGCTGGGGCAAATAAAAATAAAATAAAATAAATAAATAAATAAAATATCAAAGCCTGTATAATGGCTGTACATCTTGATCATCAACCAGTTTTGAATTCAAAAAGTCTTGCGTGCCTCTTCTTTTAAATAGAAGATGGACATGCACCCATTGGTTTTTTAAATGAGAGGAAACATCTTCCCGGTGAGATATTTCTTAGAAGTACTTTATATTATTGTATTGAATTCACTTCTTCAATCTAATCTATTTGATTTGTGAGAAATTGAAAATGTTTCATCATCCTCAAATTTTAAAAAACTTCCTCCTTGACTAAATAACTCATCATCAAGATATGAATATTTGTTGTAACTATCCCCAATTTTCATGTTTAAAATATCCGTCTGAAGTATCTTCTTGGAGCAATTCCTCTACTTTCTCTTTTGTGCTCACTTCATTATCAGCTTCAAAATCAAATAGCATTCACGTTGCATGAATGTCACCATGTGTTTAGGATGATGATAGGCCTCTGTCATCACTGAAGAAGGATACCAGTCGTTGTACCTACATGTACAACGACATTAGCAACTATAGCATCTGTTGTCATCAAACAGCACATATATTCTCTCTTAGTGTATTTAAGGTATATATATATATATATATATATATATTCTTCAACTTTAAGAGAGATCCATCTTGACATAATTTTTTTGCATTTTCAAATTTGTATTTTGAAAAAGGTCAGAAAATTCCAAAATGGTAAGATCAGACTTCAAAATCAACTTGCAAATTTGAATCTTAATGAGTTTGAAAATTGAAACTCATAGTTATTTCACATCATATTCAATCAACTTGCAACTTAAACATGTGATGAATTCATCACATGTTGATAATCACATCTATAGTTGTCACATCCATTATAATATATTCATTATATATCAAAGCAAAGTACATATGATTCATGTAATTTGTGATTACTTAAATAATAATACTCTTCCTTTTCCTCCATATATAAGTTTCTAACGCACCTTTAGAATTTTTGAACTTATCAAGTGACTCATGTTTCAAATTAGTATACCATTTTGAATCTTGTCAACTTTGTTTAAGCCATTAGCTCACATACATGTGAATTTCTCAATTTCAACAAGTTTACGCAAGCCTATAATGACTCTACAAGAAATGGTTTTATTTGTATCTCTTTCTTTAGAGCATAATAATTAAAGCGTTTTTTTTAATTGATCTTTCACATCACTTAGCATAAATTTTAGAGATTTTAGATTGAGAGAATTATTAAAGTCCTCTTTGTCACAACTTCAATGCTTATTTGAGTATGATTTGACTTCATAAGTTTCATATCCAACGTTTATATAAGGTGTATCAGAGAAATAAGAACAGACTTCTTTCTTATCATTCTTCAAAGTACAAAATCTCATCCAAAAAACACATCAAAACTATTAATTGTTAGATTTTTGATTGAAAATTTTTTTTTAATTGATACATCTTTTTTCAATGAAAAATGTATCCAAATTTTTTTTCATTCAAAAAAAAAAATGAACTACATATCTTATCTCTTGTAACATCAAGTTATGTTGTTTAGTATTGTTCTCTCCTCCCCTATAGTTCGAGAGGAATCATTTTTATTATATAAATTTGGGATTTCACACAACTTTCATTCTCTACACTTTCATTCCTAAGATTAATTGCTTACATAACTTATATGAGATTTGGAGATTGAATCCACAGATTCAATCTTATCTGTCCTTACTTGTCTTCTATACTTTCGATTGTAAAATAATTACTTTCATTTAAGATATGAGTATTTTTTGACAAAATTGCACTCTCTTTCTTCTTTCCATCAATATTTTAATTTTGTATATTTGTTATTCTCTTTAAACCAAAAAAAGTTGGAGCCGACATATTTCTTCTTCTTTTTTTTCATTTTGAACAGAATGGAAAAACATGAGTTCATATATCGCCTAAGATCACATGTGGAACAATTTCAAAACTTTTGACTTCTCGTGACCCATTTTTACACTGATTTGTGTGCTAACATTTTAGTCTTGGAGCTTTGAATTTTTAATCTTTATCAAATTTTGAGTTCAGCTTTAGCATGTTGATATCAGTTACAATTTTGAGCAAGTATTCCATATATTGTTCAAGTATTTCATGCATATGCATAAGGTACTTGTTGACCTTATCTAGAGTCTTTCTTAATAATCTCTTGTAAACATCTCATCTTCAAAACGATCAATGTTTTCACGATGCTTGCAACACTTGAAGTAGTCATGTAGATTGAAAGTGTACTTAGCATCAAGTGTTAATTCTCTTTTCACTTGAGGTATTAGGCTTTTTATTAAGCTAACCGATGGGGTAAAAAAAACATGTGACATAAATCAAATTTTCAGTAAAGATATTATAAATATTTTGAAATATTTTTTTTTGAAATTTATTATGTATTAATATTGTTGAGAATGCTATCATTGTGAATACTAACTCGTATTTATAATTATGAATACAATTTAGCTTCTTAGCAAGAGAGTACAAGAGTGATGATAAATTTATGAAAAATGGGTGAAATTTAACCTATACTCTATAAATGTATAAAGTCTCAAACTTGAGGCTTTAACTAAAAATTCCAAGCTCAACCCTCTTAAACTCTAAAGTAAATTATTGTTTACTTATGATAAAATCTAGTAACTAGATTATACTTCTTACGATTAGTACTTCGTTGTGATATCTTATTTCGTTATTTAGCAAAAGGAATGCCTGATTTATTACATGCCATGGTCGATGGAGCAGACTCCTTAAATCAATTCATAAGCATGATCGGCGCATGTTGAAGAAGGAATATTGTCGTAGTGATTCAAACATGCGTAATTTGTCCGTTGTGAGACAAATACAACAGGAACTACACATTTTTTTGGTTACGGCAGTTGTAATCAAGTCTGTGAAGAGTGGACGACGTCAGATCACAACCTGACGTACGAATATCGACTCGAGATGTGAACTCAATTGTAGAAGATCCTGGTCTATGGTTTGATTCACCAGGAAAATGACAGGATATTAGTAGCCAATAATTTAGTTGCGGTACTACAATTACGTATGACAAGAACTATATCCTGCTGTTTAGCACCAAGATGGAAAAATAGGATACTTGATTAATGGAAAGGATGTGTGGGGATATGCATACTTTACTGCACAGTCACCTAAGCTTTTCCGGGAGTTTGTGAACAAAGGAATTGTTGTCAAGGTGTTGAACTGGTTCTTTGAACACATGTAAGAGGAAGTTTACGTGACGTGTCTTTCGTGAGTCCCAAAGATCACTTAAAAATTATCCATTTTTCCCGCCGGTAAGACTGTTATTCTTGATCCAGGACTCTGCAGCTCAGAACAGTATATATTATGAGAACGGCTAATTACAAAATCTGCGAGGTCTTTAAAGTCTGCCAGTCTTTTGATTCTGAAATTGGGAACTTAGTCTAAGACCTGTCAGAAGACAGAATTCCGTGTGTTCCACTTGAGGAATACTGGAGAAGTTTAACCAAAGTAAAATATGCGACAACATCCTACAATCTTGGATTTACTTTCAGTCATTTTGGAATCTGTATCTCTGATCAATCTAGCAAAATGTCTCAACATCCATGTCCTGCATGAGATCCTTCTGATCCTTCAATCAAGAAAGAAGTTTGTCACATTTTATCTTCAATGTCTATACAGGACGATGTGGATATCTTTGATATTCCATGTTTCTTGAGTAGAAACTCTGTCGTATAGAATTCCAACGGGCGAGTTGCGTAATTAAGAGTACAGTCTCTCTCCTGAGTGCAGGCTTCGCTCTCAGAAGATCCCCTCTGTAATTTAAATGGATTTCCTCTGTTTTTCCTAGTTCTCAACTACATTCATATGTCAAAACAATATCGGATGGGTGTTGATTTCTCTCAGTGGTCCCGGGCAGTAATAATTCTTGATATGGACTTGAGGTGTAGGTTCAGTGCGAATAACACAGCAGTCTAGGAGGACATATCATAGACTTCCTCCCACCAGGGTTGGCCACATGCTCTTCGCATTTCAAACCCCTGCCATGGTCTCTTGCTGCCCTCCTTCATTCATTAACTGGAAAGACCTTGCTAAAATGCTCTTGCTCTCCTCCTTCAGATCACTGCAGATAGTCTCAGGACACCTTTATAATGTATCATCTCATTTGTTTGCGAGCATAGTTTTCTACCCGAACCTGTGTTAGCATAATGTCCTCACATGTTGTCCAGATTTGAGTTCAGTAACACATGAATGTGTATCTCATTCTAATGCATTCGCCATATTCATCCAGGTAATCCAAGAAACTGCCAATAGATTTTGAATCGTGCAGGGAATGCTGAAACCCTTCACCAGTAATTGTCTTCATTTGCCCATTTTCTTAACTTGAAGGTCCCTTTAGTGAATTACCAATTTACCGTGTTGCATCGGACTAGCAAAATCCTGCTGCCCTATGCAAATAAAGGCTAGATGAATTTAGTGTGTGGCTAGACACCTCAGACAATGTTGGTACAAAATTAGAAAATTCTTCTCATATTTTATCAGGAAACCATGCTAAACTGATAAGAGACTAGAAGGGCTAGCTGGTTTGGCAGAATGGAACGTTTACAAACAGTTCAAAATGTGTTGTAGACGAGCAACTCTCTGCATGACCGTTATGTGACTTAAGAACTTGGATGAAATTTTTCCCTGTATAAGGTGAATTTCTTGCAGCTTTGCTTATCTTAGTTTGCTGTTCAGGACCTCTATCAACCTGGATTTTTGCGTCATCATTTCCTCTTCAATTTTTCTGGTTGGAACCATGTAAAATTAATCTGCATGATGTTTTCTCAGGATCGCAACGAGCTTAATGTAGTACCCGTTCTCCTCTAACGTTATGCTCAGATCATGACCTTATTAAGTTGCAGTATTCTGTGTTCAAGAGCTCTCCGTTCTTTACGGCCCGAACAGTTGACTTCTGAATGAACTTTAGATTTTCTGTCAACAGTCTAAGCTATATACAATATGTTCAAATATTCGGCACTCTAAGCTAAACTGCTGTGACATAGATCATGGAGTTTGAAGTGACTAACATGAAGCGTAGAGCATTCTTCCCTAACATCTTCAACTTGAGGTTAGAGGGAACTGTTTGCCAGTCTCTGTAACTGAAATCTCTTAACCTCTTGAATGTTGTTGTCTTTCAGACTCGTGACCGTTGGCTCTACCAAATGAAGTGATGCAACTCAGCATGATAAGATGCTCTCATAGGAAAATTCTCGACAATAATCTTGTGCAGAAAATCTGGAGCATCGTTGGTTCGTCATGGGTTTGTTTAGACCCGTAGACCTTGTGAGAAGCAAATCATGCTTTTAACCAGATTTGGAGAAATCCCTAGATAGAGGTTCAGCGGTCCACCATCACTGAGGGAGGACCAGTTATGTAAAGCTTTGTCTCTTCGTGTAACTTTGGCTACCATTGGCAAATATCTACTCAGATCACTCAGTCTGTATGTTTATCTTCAAGTAAACACTGCAATTCCTCCAATTCAA

mRNA

>Mapoly0028s0060.1
GAAAGCATTCATAAGGTCTCCAGCTTACCCCGGAACACATCATATTTTCAAACCGTGTGTTCGATTTCTGAACTCATCTCTCTCTCTCACCATCCATCCGTCTTCCTTTCTTTTCCCTTCCCTTCCTTCCTTCTTTCTTTCTTTCCTCACCTTCGCTTGTCCCTACTTCCCGCTCTCTCTTTCTCTCTTCTACATACCCTCTCCTTCCCCCGAACCTCGTGCTTGCCGGCATTCTGCTTCGCTTCTCGTGCTAGCTCATTGAATTATACTGTGCTGTGCCAAAGTCGTCCACTCCGATACCATCTCGTGAGGATTCTGATACCGTCTCGTGGCGCATGCTTGCGCGTTCGCTGGGGCCTCGGAGTGTCCAGACTCCAAAGATATCTGACTGACTTCGTCTTATTTTCTCTTTTATCGAGCGTCAGTAGATGGGGAGGCAAAAAGCTGTCCGTTCTCTGCTGGGGAAGAGAACATTAATCTGGGGTCAAGTTCTCACACTTTGCCAATGGAAGAGAGCATGAACTTGTGGTGGGGTTTCTTGTCCCTCTCGAGCACGCGGTCCGTCTCTATCTCTCGGCACTTGAAACACCGTACAGATTGAAACAGGCGTCAAATGACACAACTTCTTTTCAAGCACGCGCAGTCGGACCAATTCTTACTGTTCCGCGGTGGGAAGGGGTTAGCCAATTCGCCGCACTCTCTTGCTGAGGACGACCTCCTCGAGTTCTCGATTTACAGGGATTAGAACAAAAAACCTGCCCCAAATGTTATAATGCTTCAGCCTACGGCATCAGGATGACCGACAGAACTGACATAGGGCAGAATTATCTTCGAGTGCGTTCCAGCAATCTCGAACCTAGCACCGTCTTATTCGTAGTTAAGTACAAGTTTCAAACATTGGCGAGGAGGTGTCATCGGCGATCGACGTCCGAACCCGATAACCATAGGATACGATTCTGCTGAATGCATGGGGGGTGAAAAATATTATCGATATTCATATTCGATTTCTTTCAGTGCTGCGAAATTCGGGCGAGATATATATACTCATATATATATTTACACATATATTTCGCTAGTTTTTCTCACAGCTGCTCTAGCTAGTCTCAGGAGTACAGCAGATGCCTGTGGCGTGAATATCTTTGCTAGTGGAGTAATTAGAGCAGAATTTTCTAGAGGGCTTGAAGGAAACTGAGGTCGATCCTCAAAGTCCGACTGTAGGATCTGTCGGTCTAGTCTATGCGCATTCACCTACAATTTCTTGTGTTCAGCGTAAATTTTTCTCAACTCTGGGGACAAAACATCAGCTCGACAGTATATATCGTGCAGTTTCCAACTTGAATTGGCAGCACATTGTGGCCACTTTTCAACCGTGGTTTGAAAAGGTGCCTACATGCTGCCTTGGGCTGAGACATGTCCTTCATGCAAGCTGAGCAGCAACCCTCTCCCTGGATCAAAGACCTGGTGCATAAACTAAAATGGACCTACGCTGCTCTATGGACGCTGAACACAACAGATGGTTCCAGGCCGCTAATTGGTATCGACGCAGCCCATACAGTTGCGGAATGGAAGGATGGATGGTACAATTCGGACTCGAATAGGTTGACTAGAGCGCTATCTGGAAACGAGAACGTAGTTAGAGACGATTCACGAATCGAAGCGTTGTTCTACTCCACTTATAAATCGTGCTCCTTTCAGCAAGGATTCGGATACGTCGGGCTCGTACTGCTTAAAAGAGAAAGCACCTGGCTGACTGGCAGCCAGGAGGTCCTCGAACACGCGTTTCATACCCAAGCTCTCTTCTTGAAGACGGCACGTATTCAGACAGTGATGTGCACGCCTTGGAACAACCACGTACTGGAGCTGGGAAAATTCGAACAGGAGTCGAGGAACGAAAATGTCCTGCATCAGATTCAGCGATGGCTCTCGAGCGTGACGACGCCTCTCAATATTCAGCCCAGTCCCGGTGCAGTGGGTTCAGAAAACGACAGCGGAGGAAGTCGTGAAGCCATGCAGATGTCTCCGTCGATCGCTTCGTCGATGTTTGCCGATGGCTCCAATTGCAACGTGCACTTCGGGCCGTCATCTGATATTTTGCTCAAGCGCAATAATTCCGGCCAAGGCAGCGGCGCGGGCGGTTTCTCGGTGTCGGGCCATGAGAACGCCTCCGCCTCCAGCGGTGCCCCGGGCGCTGGGAGTCGAGTGCAAGTGCAGGTGCAGGTGCGCAAGAAGAATGGCCTTGGCAGGTATCCCCCGCACTCTCACGATGCCATCTCGCTGCTCAATCGACATAATCAGGACGTGCTGTCGCAGAGAAGGTCGATTTCCGGACAGGAGAAGACTTTGGAGGCCTCATCCTTTGTAGAGGAATGGGGGCCGGCGGCAGCTGGAACGAGTAGTATATTCCAACAGGTGGTCGGGCATGATTCAGATCCTATCATCAGTTGCAGTGGCATGGGCATACCAGGAATTTCTTCGCTCATGCCGCCCGATACGTTCTCGCAGCAGCAGCAGCAACAGCAGCGCTCTCATCCGAGAGGAGCCGCGAGCATTTCCTTGGACCAGGCTTTGCTCACGTCATTGCCCATGACAATGGCAACCGACATTTCGGCATCCTTGGCGCTCCCCATGGACATGTTACAGGACTCGGCCGCAAATCTTTACGGTTTGCACTCGAAGAATTCCAGAGAATGGCCCACATTGGAACCCAGCAAAGAGCAGTCTCTTGTACAGATGCTTGAAGAGTTTACCGATGACGACCATTTACAGCGGCTTCAATCGCCAGATCATGCTCTAATCCAAACTGCAGTCGCTAGCTCCAGCGACACTATGGCCGAATGGGCCTCGACTGGGACAGCCTCGATATCCCATCAACAGCAGCATCATCGTCATTACGATCACCACACTCAACAAAGACTTCAACAGCAGCAACGCCAGCAGCAGCAGCAACAACAACAACGAGTTGTCCAGCGACAATTTGAATTTCCTAATAATCCTGCTGTGAGCAGCTTACAAAATATGACAACTCCGAGACCGGCGCTGGCCAATCTCATCTCTCACCAGCAGCATCAGCACCAGCCGCAGCAACACCGGCCGCAATTGGTCCCGCATGGTGGTGGACAACAGCCACAATTGCTCCCCCTAGGCCAGCAGCAGCAGCAACAACAGGTAAATCAACCAGGTCCTCCGAGTTGGCAACAAAACATTTCCTTCACCACGCCGACGGCTTGGGTGCGATGGGTGAGCCGAAAGCAAGCATCACTGTTGCGATACAAAGCTCGAGATCCCAACGGCGCGAGTCCTGCTGCGCTGCGCGTCAATCAAATGGTTCTCAAAAGGCTGCTGACAGAAATGGTACCGAAAATTGCTAAGGAGCAGAAAGCGCGAGAGCAGGAAGCAGGTCAGGCACTGGACACGGAGACCTCGAGCCACGGACACAGAGTCAGAATGATCAGCTATCCGACCACAACGTCGACGAAGCCTTCTGAATCCGGCACCCTCATCCAAGACCCTCAAGCAAGGACCCACATGCTGGCCGAGCGCAGACGAAGAGTGAGGGAAAACGAACATTACGACGCTCTGCGCAAACTAATTCCTCCCACCTCAAGGATGGACAAGGCAACGGTTCTGGCCGAAACCATCAAGCTCGTGAAAAAGCTCCGGAGACGTGTGGGGCAATTGGAGAAGGGAAACCCCGACAATAGTGGAACTCCGAACCTGTCATTGGTCACGTCCGAGGATTCGCAAATCGGCACAACTTCTCCCAGTTCACGTGGGGAACCTGGAAGTCCGATACCTGCACGTACAGGAGCCGGTTCCTCTGAACCCGAACTTCAGGAAGGAAAGCCTCCGGGTGGCAGATTTCTCGATTCCTGCCTCGTACCCGCTCCTGCTCCGTCACAAGAGGACAACAAGGAAATTGTTGAGGTTGATAGAAGAGCATGTATTCCGACCGAATTGAGAGCCAAAATTCGGACCTCGCACCGGCCCGACACTGTCATTCACATACTCACATGCTTGAAGGACCTTGGTCTAGAAGTCCTATCAACCAACATAAGCATTGAAAAGGATTGGGTTTACGCGGACTTTCAACTGAAGATGAATGAAGTTCACATCTGCCGTGTATCACAATTCTGCGAAGAGCTTCAGGAAGCAATACGAAAAGCTATTTTTCCTGCAGAATCTTCCAATGCAGATTCAACTCTAGATGGAAGATCACACTCACAGGACTCGTGACCGTTGGCTCTACCAAATGAAGTGATGCAACTCAGCATGATAAGATGCTCTCATAGGAAAATTCTCGACAATAATCTTGTGCAGAAAATCTGGAGCATCGTTGGTTCGTCATGGGTTTGTTTAGACCCGTAGACCTTGTGAGAAGCAAATCATGCTTTTAACCAGATTTGGAGAAATCCCTAGATAGAGGTTCAGCGGTCCACCATCACTGAGGGAGGACCAGTTATGTAAAGCTTTGTCTCTTCGTGTAACTTTGGCTACCATTGGCAAATATCTACTCAGATCACTCAGTCTGTATGTTTATCTTCAAGTAAACACTGCAATTCCTCCAATTCAA

CDS

>Mapoly0028s0060.1
ATGTCCTTCATGCAAGCTGAGCAGCAACCCTCTCCCTGGATCAAAGACCTGGTGCATAAACTAAAATGGACCTACGCTGCTCTATGGACGCTGAACACAACAGATGGTTCCAGGCCGCTAATTGGTATCGACGCAGCCCATACAGTTGCGGAATGGAAGGATGGATGGTACAATTCGGACTCGAATAGGTTGACTAGAGCGCTATCTGGAAACGAGAACGTAGTTAGAGACGATTCACGAATCGAAGCGTTGTTCTACTCCACTTATAAATCGTGCTCCTTTCAGCAAGGATTCGGATACGTCGGGCTCGTACTGCTTAAAAGAGAAAGCACCTGGCTGACTGGCAGCCAGGAGGTCCTCGAACACGCGTTTCATACCCAAGCTCTCTTCTTGAAGACGGCACGTATTCAGACAGTGATGTGCACGCCTTGGAACAACCACGTACTGGAGCTGGGAAAATTCGAACAGGAGTCGAGGAACGAAAATGTCCTGCATCAGATTCAGCGATGGCTCTCGAGCGTGACGACGCCTCTCAATATTCAGCCCAGTCCCGGTGCAGTGGGTTCAGAAAACGACAGCGGAGGAAGTCGTGAAGCCATGCAGATGTCTCCGTCGATCGCTTCGTCGATGTTTGCCGATGGCTCCAATTGCAACGTGCACTTCGGGCCGTCATCTGATATTTTGCTCAAGCGCAATAATTCCGGCCAAGGCAGCGGCGCGGGCGGTTTCTCGGTGTCGGGCCATGAGAACGCCTCCGCCTCCAGCGGTGCCCCGGGCGCTGGGAGTCGAGTGCAAGTGCAGGTGCAGGTGCGCAAGAAGAATGGCCTTGGCAGGTATCCCCCGCACTCTCACGATGCCATCTCGCTGCTCAATCGACATAATCAGGACGTGCTGTCGCAGAGAAGGTCGATTTCCGGACAGGAGAAGACTTTGGAGGCCTCATCCTTTGTAGAGGAATGGGGGCCGGCGGCAGCTGGAACGAGTAGTATATTCCAACAGGTGGTCGGGCATGATTCAGATCCTATCATCAGTTGCAGTGGCATGGGCATACCAGGAATTTCTTCGCTCATGCCGCCCGATACGTTCTCGCAGCAGCAGCAGCAACAGCAGCGCTCTCATCCGAGAGGAGCCGCGAGCATTTCCTTGGACCAGGCTTTGCTCACGTCATTGCCCATGACAATGGCAACCGACATTTCGGCATCCTTGGCGCTCCCCATGGACATGTTACAGGACTCGGCCGCAAATCTTTACGGTTTGCACTCGAAGAATTCCAGAGAATGGCCCACATTGGAACCCAGCAAAGAGCAGTCTCTTGTACAGATGCTTGAAGAGTTTACCGATGACGACCATTTACAGCGGCTTCAATCGCCAGATCATGCTCTAATCCAAACTGCAGTCGCTAGCTCCAGCGACACTATGGCCGAATGGGCCTCGACTGGGACAGCCTCGATATCCCATCAACAGCAGCATCATCGTCATTACGATCACCACACTCAACAAAGACTTCAACAGCAGCAACGCCAGCAGCAGCAGCAACAACAACAACGAGTTGTCCAGCGACAATTTGAATTTCCTAATAATCCTGCTGTGAGCAGCTTACAAAATATGACAACTCCGAGACCGGCGCTGGCCAATCTCATCTCTCACCAGCAGCATCAGCACCAGCCGCAGCAACACCGGCCGCAATTGGTCCCGCATGGTGGTGGACAACAGCCACAATTGCTCCCCCTAGGCCAGCAGCAGCAGCAACAACAGGTAAATCAACCAGGTCCTCCGAGTTGGCAACAAAACATTTCCTTCACCACGCCGACGGCTTGGGTGCGATGGGTGAGCCGAAAGCAAGCATCACTGTTGCGATACAAAGCTCGAGATCCCAACGGCGCGAGTCCTGCTGCGCTGCGCGTCAATCAAATGGTTCTCAAAAGGCTGCTGACAGAAATGGTACCGAAAATTGCTAAGGAGCAGAAAGCGCGAGAGCAGGAAGCAGGTCAGGCACTGGACACGGAGACCTCGAGCCACGGACACAGAGTCAGAATGATCAGCTATCCGACCACAACGTCGACGAAGCCTTCTGAATCCGGCACCCTCATCCAAGACCCTCAAGCAAGGACCCACATGCTGGCCGAGCGCAGACGAAGAGTGAGGGAAAACGAACATTACGACGCTCTGCGCAAACTAATTCCTCCCACCTCAAGGATGGACAAGGCAACGGTTCTGGCCGAAACCATCAAGCTCGTGAAAAAGCTCCGGAGACGTGTGGGGCAATTGGAGAAGGGAAACCCCGACAATAGTGGAACTCCGAACCTGTCATTGGTCACGTCCGAGGATTCGCAAATCGGCACAACTTCTCCCAGTTCACGTGGGGAACCTGGAAGTCCGATACCTGCACGTACAGGAGCCGGTTCCTCTGAACCCGAACTTCAGGAAGGAAAGCCTCCGGGTGGCAGATTTCTCGATTCCTGCCTCGTACCCGCTCCTGCTCCGTCACAAGAGGACAACAAGGAAATTGTTGAGGTTGATAGAAGAGCATGTATTCCGACCGAATTGAGAGCCAAAATTCGGACCTCGCACCGGCCCGACACTGTCATTCACATACTCACATGCTTGAAGGACCTTGGTCTAGAAGTCCTATCAACCAACATAAGCATTGAAAAGGATTGGGTTTACGCGGACTTTCAACTGAAGATGAATGAAGTTCACATCTGCCGTGTATCACAATTCTGCGAAGAGCTTCAGGAAGCAATACGAAAAGCTATTTTTCCTGCAGAATCTTCCAATGCAGATTCAACTCTAGATGGAAGATCACACTCACAGGACTCGTGA

Protein

>Mapoly0028s0060.1
MSFMQAEQQPSPWIKDLVHKLKWTYAALWTLNTTDGSRPLIGIDAAHTVAEWKDGWYNSDSNRLTRALSGNENVVRDDSRIEALFYSTYKSCSFQQGFGYVGLVLLKRESTWLTGSQEVLEHAFHTQALFLKTARIQTVMCTPWNNHVLELGKFEQESRNENVLHQIQRWLSSVTTPLNIQPSPGAVGSENDSGGSREAMQMSPSIASSMFADGSNCNVHFGPSSDILLKRNNSGQGSGAGGFSVSGHENASASSGAPGAGSRVQVQVQVRKKNGLGRYPPHSHDAISLLNRHNQDVLSQRRSISGQEKTLEASSFVEEWGPAAAGTSSIFQQVVGHDSDPIISCSGMGIPGISSLMPPDTFSQQQQQQQRSHPRGAASISLDQALLTSLPMTMATDISASLALPMDMLQDSAANLYGLHSKNSREWPTLEPSKEQSLVQMLEEFTDDDHLQRLQSPDHALIQTAVASSSDTMAEWASTGTASISHQQQHHRHYDHHTQQRLQQQQRQQQQQQQQRVVQRQFEFPNNPAVSSLQNMTTPRPALANLISHQQHQHQPQQHRPQLVPHGGGQQPQLLPLGQQQQQQQVNQPGPPSWQQNISFTTPTAWVRWVSRKQASLLRYKARDPNGASPAALRVNQMVLKRLLTEMVPKIAKEQKAREQEAGQALDTETSSHGHRVRMISYPTTTSTKPSESGTLIQDPQARTHMLAERRRRVRENEHYDALRKLIPPTSRMDKATVLAETIKLVKKLRRRVGQLEKGNPDNSGTPNLSLVTSEDSQIGTTSPSSRGEPGSPIPARTGAGSSEPELQEGKPPGGRFLDSCLVPAPAPSQEDNKEIVEVDRRACIPTELRAKIRTSHRPDTVIHILTCLKDLGLEVLSTNISIEKDWVYADFQLKMNEVHICRVSQFCEELQEAIRKAIFPAESSNADSTLDGRSHSQDS

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>