Mapoly0028s0062



Description

GL3 (GLABRA 3), TRANSCRIPTION FACTOR

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_212581
PFAM PF00010 Helix-loop-helix DNA-binding domain
PFAM PF14215 BHLH-MYC and R2R3-MYB transcription factors N-terminal
PANTHER PTHR11514 MYC
PANTHER PTHR11514:SF9 GL3 (GLABRA 3), TRANSCRIPTION FACTOR

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH2 transcription factor, bHLH Mapoly0028s0062.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0028s0062.1 scaffold_28:680028..684774  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0028s0062.2 scaffold_28:680028..684774  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0028s0062.1  

Gene structure:

mRNA scaffold_28:680028..684774  ( - strand )
three_prime_UTR scaffold_28:680028..680765  ( - strand )
CDS scaffold_28:680766..681365  ( - strand )
CDS scaffold_28:681527..682624  ( - strand )
CDS scaffold_28:682740..682811  ( - strand )
CDS scaffold_28:683330..683441  ( - strand )
CDS scaffold_28:683630..683761  ( - strand )
CDS scaffold_28:683885..683973  ( - strand )
five_prime_UTR scaffold_28:683974..684774  ( - strand )

Sequences:

Gene

>Mapoly0028s0062.1
CGTTGTGTTGCGCAGCGAAGGTGCAGCGTTAGAGGAGGAGGAGGAGCAGATGAGCGAGAGGGACGGAAGGCCCAGGAAGGAAGCAAAGGGTCGCCAGGACAGGGTGAGAAGCGGGTTCGTGTTGAGGGGGCGCTCGTGTCCGCGTAGAAGCTAGTAGTCACATGGCAGAAATGCTACGTTGCCGCGTTATGGTGCCATGCTCAAAAGCACTGGATTGCCAGTGGCACAATCCAGTATGCGAACATTCAGCGGTTCAAGAAGTGGAAGAAGAAGAAGAATCAGAGGCTGGTGATAACTCCACTCTGGCTTCTGTCTCTGCTGACACTTGAGAACGAGCGGAAGTGTTGACACAGAAAGTCGCATCGTAGATTCTTGAACTCGAATTCTGAATTTTCTGTCGCAGATTCAGCGATCCCAGCTCGAATTGTAGATTCGTCGGAGTGTTTCGGTGGTTGGACAGGCAGGTCAGAGGGCAGAGCAGTGAGTAGACGCACAGATAGGAGCGCCGCCGCAGCAGCAGGAGCAAAAGAAGAAGAAGAAGAACAAGCTGATTGTTACTCCGACAGACAGTCGATAGGGTAGCGGTGTCAAAGGGAAATCCACCGGGTAGAGGAATTTGACAACCGCGAATGAGTCGTACATGAGAGTAGAGCGAACGGCGACTCAGGAAGAGCCTCGTTGGTACTTGCCCATTGCCCGGGCACCCTCTGAGACCAACACCTAACACCAGAACAGCGCTGCAGCCTTCGCTGCTGCGCAAGGATTTTTCCTCTGGAGCAAACAACAATTCTCAACCGGATAATGGCAGAGCTCAACACCACGCTCTGGGACCTTCTCCAGACCATTCAATGGTCCTACGCTGCGCTCTGGACCCTGACCCCCGATCGAAGGTGGGTTTGAGTTCGCCCAGATACCTAGTCTTGCAACTCGCAATTAATCGGTGATCAGAGCGGTTGGGTGGGATGGGGTGGGGTTTTACATTTCTGACCTCACCTTGCTCGTTCAACTTGCAGGATGCTCAAGTGGCAGGAAGGGTGGTTCAACCTGAAAGCGGCGGGAGACAGCAATGGAAGCGACTCAGATAATAAGAATGCAGAGCTTTTCTACTTCCTATACAATCAGTTGACATTTGCCCCGGGCGTCGGGTACATTCCAATTCCCTCTGGCACTGTCAATTTGGCCGGAAAACCAATTCAGAGTTAGCAATTCGTCGGAACTGGACCAGAATTTTTAATTTCTATGCGCATTCAGTAGAACAACTTTTTGTGCAGGATTCCAGGTCGAATGGCAGCTAAATTGGAACGCATCCTGCTTGGTTATTTTTCGTCCGCAGGTTTGCAGGTCATGCTCTCCAACATATGGGCGACAGAATTCTCTGGTTGGCTGGAGATATGGCTTTGGGTAGCATTCCCAATCCAGTTGAGAAGCAGAGCTTTTTCATAAAGGTAGACCAGACCTCCACCTCCTCGTAGTCGGTTCAAGTCATAGGCTCAAATTCAATCATTCAGGGCACTCGCGCTGGCACCCAGGCTCTTTGTTCTCGCCGTGATGGGAGCGGAGCTCAGTCACTCCGTTATCCTTTGATAGATGGCCAATTAAGTTTCGACATAGTAAACATCAGCACAACTCTCGCTTTTGAACCAATTCGCATTCTCCACAATCCCAGAGGGCTGGCGGAAGGTCGAATGGGACTGTGGGATCCCATTCCTCGGGAGCTGGCCTTCAAGGAATTTGCTGCTGGCCAGGGAATTGGCTTCCGGGATTCCTTGATGCTAGGAAAGGCTGGATCCCTGCGGTGTTGTCTGTTGTCTATTTATATTCTATTAAAAGTAGGTCCCTGAATTGGGGCTGAGACCAGTTTGGCATTAGGGGTAATCTGGCATAAATAATGCATGATCCGCGAATTTGACGTCAACCACCAGGATTGAGCGTTTTTTGTGTGCTGAACGTCTTATCCCCACAGGCAGCTGGAATCCAGACCACAATCTGCATCCCGTTGGAGGACAAGGTGTTGGAGCTCGGCACGATCAACTTGGTAGATTCCGCCTTCCTCTGTTTGACACGCTGGGCTTTGCTTTGTTTGTGTATTGGGCCGATTTGTTCGCATTTCTGGACAGTCTTCTGATGCCTCGCTTTGACCGCCGACACAGGTTCCGGAAAATGATGAAATAGCTCACTGCATCAAGAAGATTATGTACAGCCTTTTGGACCGCTACTTGAAGAAGCCTGAGCCTTGCCACTTCCCCGACATTCAGTTCGGGCTGGAAATGAACAATTTAACCCCGACATCGTCCGGAGCTGGGCCATCGATGGTGATACCACTTCCGAATGATTTCTCCTCGCTGTCATCGAAACCAATGAATCTGATGGCTATGAACTTGCCCACAGTTTACGACGACCTGGATGCGAGCTACATTGTGCCGCCAGTGGCAATGTCTGCTCCAGAATTGATGCAGAGCCGATTATCTTGGACTCCAGAGCAACTGTCGATGCCATTGGGTCACAATGACTTGGACATATGGAGCACAGCATCCACTTTAGCGGCACTGCAATCTCATGGGATTTCTACCTCGTCCGCATCATCGACCCTCATGGTGGACCATATCGAACAGGCTCTTCCAGGGTTCACATTGCCAATGCCGTTCATCGAGAGCGACGTGACATTATTGGCACCTTCTCCTTCCCCTCCTATAGTAGAAGCCACCACATCGCTCCGTGATCGGTCGTCCTCCAGGAGCTCCCTTCGATCCGGAGCACACCTCGAAGACAATGAGATTTCCTCGGTTGCCAAAGTGTACGCGGATTGTCAAATATCTGAGCCCAAACTCGTCGCGGAAGCGGGGCGAGAATCCGACAGCAGGGTGTCGTCGGGTCGGCTTCGTCGCTCTCCATCTCCCAAGGAAATGTCACCAGATTCACTCTCGAGCTTGCCCAAGCCCAGGGCCCCTAGCCATGGCCTACAACAGCCTCTCATGTTTCACCCGGGTTCAACATCGGAACCAAGCCACCAACGACCACGATTGGAACGACAGAATTCCAGCACTCTGAAGCCCGCCGACTCCACTCCGGTGCTAGTGCAATTGGGTAACGTTTTGCAATTAGGAAACGCTTCCGGGCAAGTTGCAGAAGCTCCTCCCCAGGAGACCGACGAGGCAGCGGTGTCCCACATGCTGGCGGAGCGCAGACGAAGAATTAAACAGAATGAGAATTTCTCTCAGCTGAAAGCTCTGATCCCGAGTGCTACCAAGGTAAGAGGCGTTCAGATCTGTGACCGCTCGGTCCCGTGATTTGCTAGTTCCCGCGCGGTAGACGCACGGCCATGTCTTCATTGAGCTTTTAGAGCGCGACGCTGTAAAGGTTGTTCTGACGGACGATGATGATGATTTGTGATGGCATTGTTTGTGCTCAGATGGATAAAGCAACGGTGCTGGCTGAAACCATAGTTTATATTAATAGTCTGAAGGCGCGCCTCGAAGCTTTGGAGCAGTGCAATCAATCGCTGAAATTTTTGATCGGAGATCGGGCGACGGACATAGCCGGGCCCTCGAATGCACCCGCCATCCGGCTTCCCACTCCTCCTGTGCCGAGTTCACGAGAGCCGGAAAGGGTGGAGGTGACTCCTGACGGAGAAGGAAACTTGAGAATCGAGATAAGGAGCCCATGTGCTCAACCAGAGAATGCGATCCATATACTGACATCTCTGAAACAGATGCAACTCAGAGTCCTAAGTTCCCAGATGTCTATTGATGATAATAGGATCACTGCGACTTTTGTAGTTAAGGTACGTCAGACTGGCTACGGCATGGACATTGCACTCATCTGTCTTATGATTCATAACGCTAAGATTCCGATTCAATGGAATGATTCCTTGTCTTTCACGATTTTCACCAGACTCGTGTGTGTGTGTGTGTGTGTGTTTGGTAGCACCTGTTTTTGGTACCCGTTGCGCATTATAGACCTGGACAGTAGCTCTCTTTGCCATCCATACGCTGCCGGCAGGCACCCTTGACGTGTTAGACTCCAGTATGATCTCGTTAGCCGTACAGGCTCGTTCAAGTAATCAAGCTTCTGCAGTTCGTCCCCTAGGTGCCCCGGACAGACGAACCAGCGCAGAAGTGAGTTCTGCGGACGTAGCTAAGACGTTTTGACATCGGTTTGTGCAGATGAAAAGAAAGAATTCGACTGGCCAAAACGAAGTCTGTGCAAATGTGACAAGCGAACTCAGAAAATGCTTAGGGCTTTAAGTCTGAGCTCTCGTCGACAAATATTTACCTCTCAGTGCACTTAGAGCCGAAGGAAAGATGTACAAAGTATCCTCTTTTTTCTTAGTTTCTTTTCCCTACCGATGGTGTAAGAATTTCAAGCTCTGGTCGTAGCAGAGACACTCAGGCTCCTTTGCTTGTAAGATAGCAACAATCGAAGTCGATCTCGCCGGCATCATCTCGTTCTTCCCTAGTGTACATACGACCTAGGATCAAAGCTTTTAGAGATGACTGTCGTGCTGCCCGCCCCGAAAGAAAGAATCGAGGAAAGAGACAGCTCAACTTCAACTTCACCCATTCATTGATCTGGTCTGATCACACATGCACTCATGAAGATTTTGATCTCGTATCAGTTTTGAGCTCTTCGATCGTAGACAGACTGATCCCCTATTTGTTTCTGTAGTGCAGCCAAATAAAAAGTGGGCCTCGAATGTACACATATTTGCCGCTGGCATACCATATAAGTGAAACTTTGAAACTTTTTA

mRNA

>Mapoly0028s0062.1
CGTTGTGTTGCGCAGCGAAGGTGCAGCGTTAGAGGAGGAGGAGGAGCAGATGAGCGAGAGGGACGGAAGGCCCAGGAAGGAAGCAAAGGGTCGCCAGGACAGGGTGAGAAGCGGGTTCGTGTTGAGGGGGCGCTCGTGTCCGCGTAGAAGCTAGTAGTCACATGGCAGAAATGCTACGTTGCCGCGTTATGGTGCCATGCTCAAAAGCACTGGATTGCCAGTGGCACAATCCAGTATGCGAACATTCAGCGGTTCAAGAAGTGGAAGAAGAAGAAGAATCAGAGGCTGGTGATAACTCCACTCTGGCTTCTGTCTCTGCTGACACTTGAGAACGAGCGGAAGTGTTGACACAGAAAGTCGCATCGTAGATTCTTGAACTCGAATTCTGAATTTTCTGTCGCAGATTCAGCGATCCCAGCTCGAATTGTAGATTCGTCGGAGTGTTTCGGTGGTTGGACAGGCAGGTCAGAGGGCAGAGCAGTGAGTAGACGCACAGATAGGAGCGCCGCCGCAGCAGCAGGAGCAAAAGAAGAAGAAGAAGAACAAGCTGATTGTTACTCCGACAGACAGTCGATAGGGTAGCGGTGTCAAAGGGAAATCCACCGGGTAGAGGAATTTGACAACCGCGAATGAGTCGTACATGAGAGTAGAGCGAACGGCGACTCAGGAAGAGCCTCGTTGGTACTTGCCCATTGCCCGGGCACCCTCTGAGACCAACACCTAACACCAGAACAGCGCTGCAGCCTTCGCTGCTGCGCAAGGATTTTTCCTCTGGAGCAAACAACAATTCTCAACCGGATAATGGCAGAGCTCAACACCACGCTCTGGGACCTTCTCCAGACCATTCAATGGTCCTACGCTGCGCTCTGGACCCTGACCCCCGATCGAAGGATGCTCAAGTGGCAGGAAGGGTGGTTCAACCTGAAAGCGGCGGGAGACAGCAATGGAAGCGACTCAGATAATAAGAATGCAGAGCTTTTCTACTTCCTATACAATCAGTTGACATTTGCCCCGGGCGTCGGGTTTGCAGGTCATGCTCTCCAACATATGGGCGACAGAATTCTCTGGTTGGCTGGAGATATGGCTTTGGGTAGCATTCCCAATCCAGTTGAGAAGCAGAGCTTTTTCATAAAGGCAGCTGGAATCCAGACCACAATCTGCATCCCGTTGGAGGACAAGGTGTTGGAGCTCGGCACGATCAACTTGGTTCCGGAAAATGATGAAATAGCTCACTGCATCAAGAAGATTATGTACAGCCTTTTGGACCGCTACTTGAAGAAGCCTGAGCCTTGCCACTTCCCCGACATTCAGTTCGGGCTGGAAATGAACAATTTAACCCCGACATCGTCCGGAGCTGGGCCATCGATGGTGATACCACTTCCGAATGATTTCTCCTCGCTGTCATCGAAACCAATGAATCTGATGGCTATGAACTTGCCCACAGTTTACGACGACCTGGATGCGAGCTACATTGTGCCGCCAGTGGCAATGTCTGCTCCAGAATTGATGCAGAGCCGATTATCTTGGACTCCAGAGCAACTGTCGATGCCATTGGGTCACAATGACTTGGACATATGGAGCACAGCATCCACTTTAGCGGCACTGCAATCTCATGGGATTTCTACCTCGTCCGCATCATCGACCCTCATGGTGGACCATATCGAACAGGCTCTTCCAGGGTTCACATTGCCAATGCCGTTCATCGAGAGCGACGTGACATTATTGGCACCTTCTCCTTCCCCTCCTATAGTAGAAGCCACCACATCGCTCCGTGATCGGTCGTCCTCCAGGAGCTCCCTTCGATCCGGAGCACACCTCGAAGACAATGAGATTTCCTCGGTTGCCAAAGTGTACGCGGATTGTCAAATATCTGAGCCCAAACTCGTCGCGGAAGCGGGGCGAGAATCCGACAGCAGGGTGTCGTCGGGTCGGCTTCGTCGCTCTCCATCTCCCAAGGAAATGTCACCAGATTCACTCTCGAGCTTGCCCAAGCCCAGGGCCCCTAGCCATGGCCTACAACAGCCTCTCATGTTTCACCCGGGTTCAACATCGGAACCAAGCCACCAACGACCACGATTGGAACGACAGAATTCCAGCACTCTGAAGCCCGCCGACTCCACTCCGGTGCTAGTGCAATTGGGTAACGTTTTGCAATTAGGAAACGCTTCCGGGCAAGTTGCAGAAGCTCCTCCCCAGGAGACCGACGAGGCAGCGGTGTCCCACATGCTGGCGGAGCGCAGACGAAGAATTAAACAGAATGAGAATTTCTCTCAGCTGAAAGCTCTGATCCCGAGTGCTACCAAGATGGATAAAGCAACGGTGCTGGCTGAAACCATAGTTTATATTAATAGTCTGAAGGCGCGCCTCGAAGCTTTGGAGCAGTGCAATCAATCGCTGAAATTTTTGATCGGAGATCGGGCGACGGACATAGCCGGGCCCTCGAATGCACCCGCCATCCGGCTTCCCACTCCTCCTGTGCCGAGTTCACGAGAGCCGGAAAGGGTGGAGGTGACTCCTGACGGAGAAGGAAACTTGAGAATCGAGATAAGGAGCCCATGTGCTCAACCAGAGAATGCGATCCATATACTGACATCTCTGAAACAGATGCAACTCAGAGTCCTAAGTTCCCAGATGTCTATTGATGATAATAGGATCACTGCGACTTTTGTAGTTAAGGTACGTCAGACTGGCTACGGCATGGACATTGCACTCATCTGTCTTATGATTCATAACGCTAAGATTCCGATTCAATGGAATGATTCCTTGTCTTTCACGATTTTCACCAGACTCGTGTGTGTGTGTGTGTGTGTGTTTGGTAGCACCTGTTTTTGGTACCCGTTGCGCATTATAGACCTGGACAGTAGCTCTCTTTGCCATCCATACGCTGCCGGCAGGCACCCTTGACGTGTTAGACTCCAGTATGATCTCGTTAGCCGTACAGGCTCGTTCAAGTAATCAAGCTTCTGCAGTTCGTCCCCTAGGTGCCCCGGACAGACGAACCAGCGCAGAAGTGAGTTCTGCGGACGTAGCTAAGACGTTTTGACATCGGTTTGTGCAGATGAAAAGAAAGAATTCGACTGGCCAAAACGAAGTCTGTGCAAATGTGACAAGCGAACTCAGAAAATGCTTAGGGCTTTAAGTCTGAGCTCTCGTCGACAAATATTTACCTCTCAGTGCACTTAGAGCCGAAGGAAAGATGTACAAAGTATCCTCTTTTTTCTTAGTTTCTTTTCCCTACCGATGGTGTAAGAATTTCAAGCTCTGGTCGTAGCAGAGACACTCAGGCTCCTTTGCTTGTAAGATAGCAACAATCGAAGTCGATCTCGCCGGCATCATCTCGTTCTTCCCTAGTGTACATACGACCTAGGATCAAAGCTTTTAGAGATGACTGTCGTGCTGCCCGCCCCGAAAGAAAGAATCGAGGAAAGAGACAGCTCAACTTCAACTTCACCCATTCATTGATCTGGTCTGATCACACATGCACTCATGAAGATTTTGATCTCGTATCAGTTTTGAGCTCTTCGATCGTAGACAGACTGATCCCCTATTTGTTTCTGTAGTGCAGCCAAATAAAAAGTGGGCCTCGAATGTACACATATTTGCCGCTGGCATACCATATAAGTGAAACTTTGAAACTTTTTA

CDS

>Mapoly0028s0062.1
ATGGCAGAGCTCAACACCACGCTCTGGGACCTTCTCCAGACCATTCAATGGTCCTACGCTGCGCTCTGGACCCTGACCCCCGATCGAAGGATGCTCAAGTGGCAGGAAGGGTGGTTCAACCTGAAAGCGGCGGGAGACAGCAATGGAAGCGACTCAGATAATAAGAATGCAGAGCTTTTCTACTTCCTATACAATCAGTTGACATTTGCCCCGGGCGTCGGGTTTGCAGGTCATGCTCTCCAACATATGGGCGACAGAATTCTCTGGTTGGCTGGAGATATGGCTTTGGGTAGCATTCCCAATCCAGTTGAGAAGCAGAGCTTTTTCATAAAGGCAGCTGGAATCCAGACCACAATCTGCATCCCGTTGGAGGACAAGGTGTTGGAGCTCGGCACGATCAACTTGGTTCCGGAAAATGATGAAATAGCTCACTGCATCAAGAAGATTATGTACAGCCTTTTGGACCGCTACTTGAAGAAGCCTGAGCCTTGCCACTTCCCCGACATTCAGTTCGGGCTGGAAATGAACAATTTAACCCCGACATCGTCCGGAGCTGGGCCATCGATGGTGATACCACTTCCGAATGATTTCTCCTCGCTGTCATCGAAACCAATGAATCTGATGGCTATGAACTTGCCCACAGTTTACGACGACCTGGATGCGAGCTACATTGTGCCGCCAGTGGCAATGTCTGCTCCAGAATTGATGCAGAGCCGATTATCTTGGACTCCAGAGCAACTGTCGATGCCATTGGGTCACAATGACTTGGACATATGGAGCACAGCATCCACTTTAGCGGCACTGCAATCTCATGGGATTTCTACCTCGTCCGCATCATCGACCCTCATGGTGGACCATATCGAACAGGCTCTTCCAGGGTTCACATTGCCAATGCCGTTCATCGAGAGCGACGTGACATTATTGGCACCTTCTCCTTCCCCTCCTATAGTAGAAGCCACCACATCGCTCCGTGATCGGTCGTCCTCCAGGAGCTCCCTTCGATCCGGAGCACACCTCGAAGACAATGAGATTTCCTCGGTTGCCAAAGTGTACGCGGATTGTCAAATATCTGAGCCCAAACTCGTCGCGGAAGCGGGGCGAGAATCCGACAGCAGGGTGTCGTCGGGTCGGCTTCGTCGCTCTCCATCTCCCAAGGAAATGTCACCAGATTCACTCTCGAGCTTGCCCAAGCCCAGGGCCCCTAGCCATGGCCTACAACAGCCTCTCATGTTTCACCCGGGTTCAACATCGGAACCAAGCCACCAACGACCACGATTGGAACGACAGAATTCCAGCACTCTGAAGCCCGCCGACTCCACTCCGGTGCTAGTGCAATTGGGTAACGTTTTGCAATTAGGAAACGCTTCCGGGCAAGTTGCAGAAGCTCCTCCCCAGGAGACCGACGAGGCAGCGGTGTCCCACATGCTGGCGGAGCGCAGACGAAGAATTAAACAGAATGAGAATTTCTCTCAGCTGAAAGCTCTGATCCCGAGTGCTACCAAGATGGATAAAGCAACGGTGCTGGCTGAAACCATAGTTTATATTAATAGTCTGAAGGCGCGCCTCGAAGCTTTGGAGCAGTGCAATCAATCGCTGAAATTTTTGATCGGAGATCGGGCGACGGACATAGCCGGGCCCTCGAATGCACCCGCCATCCGGCTTCCCACTCCTCCTGTGCCGAGTTCACGAGAGCCGGAAAGGGTGGAGGTGACTCCTGACGGAGAAGGAAACTTGAGAATCGAGATAAGGAGCCCATGTGCTCAACCAGAGAATGCGATCCATATACTGACATCTCTGAAACAGATGCAACTCAGAGTCCTAAGTTCCCAGATGTCTATTGATGATAATAGGATCACTGCGACTTTTGTAGTTAAGGTACGTCAGACTGGCTACGGCATGGACATTGCACTCATCTGTCTTATGATTCATAACGCTAAGATTCCGATTCAATGGAATGATTCCTTGTCTTTCACGATTTTCACCAGACTCGTGTGTGTGTGTGTGTGTGTGTTTGGTAGCACCTGTTTTTGGTACCCGTTGCGCATTATAGACCTGGACAGTAGCTCTCTTTGCCATCCATACGCTGCCGGCAGGCACCCTTGA

Protein

>Mapoly0028s0062.1
MAELNTTLWDLLQTIQWSYAALWTLTPDRRMLKWQEGWFNLKAAGDSNGSDSDNKNAELFYFLYNQLTFAPGVGFAGHALQHMGDRILWLAGDMALGSIPNPVEKQSFFIKAAGIQTTICIPLEDKVLELGTINLVPENDEIAHCIKKIMYSLLDRYLKKPEPCHFPDIQFGLEMNNLTPTSSGAGPSMVIPLPNDFSSLSSKPMNLMAMNLPTVYDDLDASYIVPPVAMSAPELMQSRLSWTPEQLSMPLGHNDLDIWSTASTLAALQSHGISTSSASSTLMVDHIEQALPGFTLPMPFIESDVTLLAPSPSPPIVEATTSLRDRSSSRSSLRSGAHLEDNEISSVAKVYADCQISEPKLVAEAGRESDSRVSSGRLRRSPSPKEMSPDSLSSLPKPRAPSHGLQQPLMFHPGSTSEPSHQRPRLERQNSSTLKPADSTPVLVQLGNVLQLGNASGQVAEAPPQETDEAAVSHMLAERRRRIKQNENFSQLKALIPSATKMDKATVLAETIVYINSLKARLEALEQCNQSLKFLIGDRATDIAGPSNAPAIRLPTPPVPSSREPERVEVTPDGEGNLRIEIRSPCAQPENAIHILTSLKQMQLRVLSSQMSIDDNRITATFVVKVRQTGYGMDIALICLMIHNAKIPIQWNDSLSFTIFTRLVCVCVCVFGSTCFWYPLRIIDLDSSSLCHPYAAGRHP

Mapoly0028s0062.2  

Gene structure:

mRNA scaffold_28:680028..684774  ( - strand )
three_prime_UTR scaffold_28:680028..680530  ( - strand )
CDS scaffold_28:680531..680611  ( - strand )
CDS scaffold_28:680994..681365  ( - strand )
CDS scaffold_28:681527..682624  ( - strand )
CDS scaffold_28:682740..682811  ( - strand )
CDS scaffold_28:683330..683441  ( - strand )
CDS scaffold_28:683630..683761  ( - strand )
CDS scaffold_28:683885..683973  ( - strand )
five_prime_UTR scaffold_28:683974..684774  ( - strand )

Sequences:

Gene

>Mapoly0028s0062.2
CGTTGTGTTGCGCAGCGAAGGTGCAGCGTTAGAGGAGGAGGAGGAGCAGATGAGCGAGAGGGACGGAAGGCCCAGGAAGGAAGCAAAGGGTCGCCAGGACAGGGTGAGAAGCGGGTTCGTGTTGAGGGGGCGCTCGTGTCCGCGTAGAAGCTAGTAGTCACATGGCAGAAATGCTACGTTGCCGCGTTATGGTGCCATGCTCAAAAGCACTGGATTGCCAGTGGCACAATCCAGTATGCGAACATTCAGCGGTTCAAGAAGTGGAAGAAGAAGAAGAATCAGAGGCTGGTGATAACTCCACTCTGGCTTCTGTCTCTGCTGACACTTGAGAACGAGCGGAAGTGTTGACACAGAAAGTCGCATCGTAGATTCTTGAACTCGAATTCTGAATTTTCTGTCGCAGATTCAGCGATCCCAGCTCGAATTGTAGATTCGTCGGAGTGTTTCGGTGGTTGGACAGGCAGGTCAGAGGGCAGAGCAGTGAGTAGACGCACAGATAGGAGCGCCGCCGCAGCAGCAGGAGCAAAAGAAGAAGAAGAAGAACAAGCTGATTGTTACTCCGACAGACAGTCGATAGGGTAGCGGTGTCAAAGGGAAATCCACCGGGTAGAGGAATTTGACAACCGCGAATGAGTCGTACATGAGAGTAGAGCGAACGGCGACTCAGGAAGAGCCTCGTTGGTACTTGCCCATTGCCCGGGCACCCTCTGAGACCAACACCTAACACCAGAACAGCGCTGCAGCCTTCGCTGCTGCGCAAGGATTTTTCCTCTGGAGCAAACAACAATTCTCAACCGGATAATGGCAGAGCTCAACACCACGCTCTGGGACCTTCTCCAGACCATTCAATGGTCCTACGCTGCGCTCTGGACCCTGACCCCCGATCGAAGGTGGGTTTGAGTTCGCCCAGATACCTAGTCTTGCAACTCGCAATTAATCGGTGATCAGAGCGGTTGGGTGGGATGGGGTGGGGTTTTACATTTCTGACCTCACCTTGCTCGTTCAACTTGCAGGATGCTCAAGTGGCAGGAAGGGTGGTTCAACCTGAAAGCGGCGGGAGACAGCAATGGAAGCGACTCAGATAATAAGAATGCAGAGCTTTTCTACTTCCTATACAATCAGTTGACATTTGCCCCGGGCGTCGGGTACATTCCAATTCCCTCTGGCACTGTCAATTTGGCCGGAAAACCAATTCAGAGTTAGCAATTCGTCGGAACTGGACCAGAATTTTTAATTTCTATGCGCATTCAGTAGAACAACTTTTTGTGCAGGATTCCAGGTCGAATGGCAGCTAAATTGGAACGCATCCTGCTTGGTTATTTTTCGTCCGCAGGTTTGCAGGTCATGCTCTCCAACATATGGGCGACAGAATTCTCTGGTTGGCTGGAGATATGGCTTTGGGTAGCATTCCCAATCCAGTTGAGAAGCAGAGCTTTTTCATAAAGGTAGACCAGACCTCCACCTCCTCGTAGTCGGTTCAAGTCATAGGCTCAAATTCAATCATTCAGGGCACTCGCGCTGGCACCCAGGCTCTTTGTTCTCGCCGTGATGGGAGCGGAGCTCAGTCACTCCGTTATCCTTTGATAGATGGCCAATTAAGTTTCGACATAGTAAACATCAGCACAACTCTCGCTTTTGAACCAATTCGCATTCTCCACAATCCCAGAGGGCTGGCGGAAGGTCGAATGGGACTGTGGGATCCCATTCCTCGGGAGCTGGCCTTCAAGGAATTTGCTGCTGGCCAGGGAATTGGCTTCCGGGATTCCTTGATGCTAGGAAAGGCTGGATCCCTGCGGTGTTGTCTGTTGTCTATTTATATTCTATTAAAAGTAGGTCCCTGAATTGGGGCTGAGACCAGTTTGGCATTAGGGGTAATCTGGCATAAATAATGCATGATCCGCGAATTTGACGTCAACCACCAGGATTGAGCGTTTTTTGTGTGCTGAACGTCTTATCCCCACAGGCAGCTGGAATCCAGACCACAATCTGCATCCCGTTGGAGGACAAGGTGTTGGAGCTCGGCACGATCAACTTGGTAGATTCCGCCTTCCTCTGTTTGACACGCTGGGCTTTGCTTTGTTTGTGTATTGGGCCGATTTGTTCGCATTTCTGGACAGTCTTCTGATGCCTCGCTTTGACCGCCGACACAGGTTCCGGAAAATGATGAAATAGCTCACTGCATCAAGAAGATTATGTACAGCCTTTTGGACCGCTACTTGAAGAAGCCTGAGCCTTGCCACTTCCCCGACATTCAGTTCGGGCTGGAAATGAACAATTTAACCCCGACATCGTCCGGAGCTGGGCCATCGATGGTGATACCACTTCCGAATGATTTCTCCTCGCTGTCATCGAAACCAATGAATCTGATGGCTATGAACTTGCCCACAGTTTACGACGACCTGGATGCGAGCTACATTGTGCCGCCAGTGGCAATGTCTGCTCCAGAATTGATGCAGAGCCGATTATCTTGGACTCCAGAGCAACTGTCGATGCCATTGGGTCACAATGACTTGGACATATGGAGCACAGCATCCACTTTAGCGGCACTGCAATCTCATGGGATTTCTACCTCGTCCGCATCATCGACCCTCATGGTGGACCATATCGAACAGGCTCTTCCAGGGTTCACATTGCCAATGCCGTTCATCGAGAGCGACGTGACATTATTGGCACCTTCTCCTTCCCCTCCTATAGTAGAAGCCACCACATCGCTCCGTGATCGGTCGTCCTCCAGGAGCTCCCTTCGATCCGGAGCACACCTCGAAGACAATGAGATTTCCTCGGTTGCCAAAGTGTACGCGGATTGTCAAATATCTGAGCCCAAACTCGTCGCGGAAGCGGGGCGAGAATCCGACAGCAGGGTGTCGTCGGGTCGGCTTCGTCGCTCTCCATCTCCCAAGGAAATGTCACCAGATTCACTCTCGAGCTTGCCCAAGCCCAGGGCCCCTAGCCATGGCCTACAACAGCCTCTCATGTTTCACCCGGGTTCAACATCGGAACCAAGCCACCAACGACCACGATTGGAACGACAGAATTCCAGCACTCTGAAGCCCGCCGACTCCACTCCGGTGCTAGTGCAATTGGGTAACGTTTTGCAATTAGGAAACGCTTCCGGGCAAGTTGCAGAAGCTCCTCCCCAGGAGACCGACGAGGCAGCGGTGTCCCACATGCTGGCGGAGCGCAGACGAAGAATTAAACAGAATGAGAATTTCTCTCAGCTGAAAGCTCTGATCCCGAGTGCTACCAAGGTAAGAGGCGTTCAGATCTGTGACCGCTCGGTCCCGTGATTTGCTAGTTCCCGCGCGGTAGACGCACGGCCATGTCTTCATTGAGCTTTTAGAGCGCGACGCTGTAAAGGTTGTTCTGACGGACGATGATGATGATTTGTGATGGCATTGTTTGTGCTCAGATGGATAAAGCAACGGTGCTGGCTGAAACCATAGTTTATATTAATAGTCTGAAGGCGCGCCTCGAAGCTTTGGAGCAGTGCAATCAATCGCTGAAATTTTTGATCGGAGATCGGGCGACGGACATAGCCGGGCCCTCGAATGCACCCGCCATCCGGCTTCCCACTCCTCCTGTGCCGAGTTCACGAGAGCCGGAAAGGGTGGAGGTGACTCCTGACGGAGAAGGAAACTTGAGAATCGAGATAAGGAGCCCATGTGCTCAACCAGAGAATGCGATCCATATACTGACATCTCTGAAACAGATGCAACTCAGAGTCCTAAGTTCCCAGATGTCTATTGATGATAATAGGATCACTGCGACTTTTGTAGTTAAGGTACGTCAGACTGGCTACGGCATGGACATTGCACTCATCTGTCTTATGATTCATAACGCTAAGATTCCGATTCAATGGAATGATTCCTTGTCTTTCACGATTTTCACCAGACTCGTGTGTGTGTGTGTGTGTGTGTTTGGTAGCACCTGTTTTTGGTACCCGTTGCGCATTATAGACCTGGACAGTAGCTCTCTTTGCCATCCATACGCTGCCGGCAGGCACCCTTGACGTGTTAGACTCCAGTATGATCTCGTTAGCCGTACAGGCTCGTTCAAGTAATCAAGCTTCTGCAGTTCGTCCCCTAGGTGCCCCGGACAGACGAACCAGCGCAGAAGTGAGTTCTGCGGACGTAGCTAAGACGTTTTGACATCGGTTTGTGCAGATGAAAAGAAAGAATTCGACTGGCCAAAACGAAGTCTGTGCAAATGTGACAAGCGAACTCAGAAAATGCTTAGGGCTTTAAGTCTGAGCTCTCGTCGACAAATATTTACCTCTCAGTGCACTTAGAGCCGAAGGAAAGATGTACAAAGTATCCTCTTTTTTCTTAGTTTCTTTTCCCTACCGATGGTGTAAGAATTTCAAGCTCTGGTCGTAGCAGAGACACTCAGGCTCCTTTGCTTGTAAGATAGCAACAATCGAAGTCGATCTCGCCGGCATCATCTCGTTCTTCCCTAGTGTACATACGACCTAGGATCAAAGCTTTTAGAGATGACTGTCGTGCTGCCCGCCCCGAAAGAAAGAATCGAGGAAAGAGACAGCTCAACTTCAACTTCACCCATTCATTGATCTGGTCTGATCACACATGCACTCATGAAGATTTTGATCTCGTATCAGTTTTGAGCTCTTCGATCGTAGACAGACTGATCCCCTATTTGTTTCTGTAGTGCAGCCAAATAAAAAGTGGGCCTCGAATGTACACATATTTGCCGCTGGCATACCATATAAGTGAAACTTTGAAACTTTTTA

mRNA

>Mapoly0028s0062.2
CGTTGTGTTGCGCAGCGAAGGTGCAGCGTTAGAGGAGGAGGAGGAGCAGATGAGCGAGAGGGACGGAAGGCCCAGGAAGGAAGCAAAGGGTCGCCAGGACAGGGTGAGAAGCGGGTTCGTGTTGAGGGGGCGCTCGTGTCCGCGTAGAAGCTAGTAGTCACATGGCAGAAATGCTACGTTGCCGCGTTATGGTGCCATGCTCAAAAGCACTGGATTGCCAGTGGCACAATCCAGTATGCGAACATTCAGCGGTTCAAGAAGTGGAAGAAGAAGAAGAATCAGAGGCTGGTGATAACTCCACTCTGGCTTCTGTCTCTGCTGACACTTGAGAACGAGCGGAAGTGTTGACACAGAAAGTCGCATCGTAGATTCTTGAACTCGAATTCTGAATTTTCTGTCGCAGATTCAGCGATCCCAGCTCGAATTGTAGATTCGTCGGAGTGTTTCGGTGGTTGGACAGGCAGGTCAGAGGGCAGAGCAGTGAGTAGACGCACAGATAGGAGCGCCGCCGCAGCAGCAGGAGCAAAAGAAGAAGAAGAAGAACAAGCTGATTGTTACTCCGACAGACAGTCGATAGGGTAGCGGTGTCAAAGGGAAATCCACCGGGTAGAGGAATTTGACAACCGCGAATGAGTCGTACATGAGAGTAGAGCGAACGGCGACTCAGGAAGAGCCTCGTTGGTACTTGCCCATTGCCCGGGCACCCTCTGAGACCAACACCTAACACCAGAACAGCGCTGCAGCCTTCGCTGCTGCGCAAGGATTTTTCCTCTGGAGCAAACAACAATTCTCAACCGGATAATGGCAGAGCTCAACACCACGCTCTGGGACCTTCTCCAGACCATTCAATGGTCCTACGCTGCGCTCTGGACCCTGACCCCCGATCGAAGGATGCTCAAGTGGCAGGAAGGGTGGTTCAACCTGAAAGCGGCGGGAGACAGCAATGGAAGCGACTCAGATAATAAGAATGCAGAGCTTTTCTACTTCCTATACAATCAGTTGACATTTGCCCCGGGCGTCGGGTTTGCAGGTCATGCTCTCCAACATATGGGCGACAGAATTCTCTGGTTGGCTGGAGATATGGCTTTGGGTAGCATTCCCAATCCAGTTGAGAAGCAGAGCTTTTTCATAAAGGCAGCTGGAATCCAGACCACAATCTGCATCCCGTTGGAGGACAAGGTGTTGGAGCTCGGCACGATCAACTTGGTTCCGGAAAATGATGAAATAGCTCACTGCATCAAGAAGATTATGTACAGCCTTTTGGACCGCTACTTGAAGAAGCCTGAGCCTTGCCACTTCCCCGACATTCAGTTCGGGCTGGAAATGAACAATTTAACCCCGACATCGTCCGGAGCTGGGCCATCGATGGTGATACCACTTCCGAATGATTTCTCCTCGCTGTCATCGAAACCAATGAATCTGATGGCTATGAACTTGCCCACAGTTTACGACGACCTGGATGCGAGCTACATTGTGCCGCCAGTGGCAATGTCTGCTCCAGAATTGATGCAGAGCCGATTATCTTGGACTCCAGAGCAACTGTCGATGCCATTGGGTCACAATGACTTGGACATATGGAGCACAGCATCCACTTTAGCGGCACTGCAATCTCATGGGATTTCTACCTCGTCCGCATCATCGACCCTCATGGTGGACCATATCGAACAGGCTCTTCCAGGGTTCACATTGCCAATGCCGTTCATCGAGAGCGACGTGACATTATTGGCACCTTCTCCTTCCCCTCCTATAGTAGAAGCCACCACATCGCTCCGTGATCGGTCGTCCTCCAGGAGCTCCCTTCGATCCGGAGCACACCTCGAAGACAATGAGATTTCCTCGGTTGCCAAAGTGTACGCGGATTGTCAAATATCTGAGCCCAAACTCGTCGCGGAAGCGGGGCGAGAATCCGACAGCAGGGTGTCGTCGGGTCGGCTTCGTCGCTCTCCATCTCCCAAGGAAATGTCACCAGATTCACTCTCGAGCTTGCCCAAGCCCAGGGCCCCTAGCCATGGCCTACAACAGCCTCTCATGTTTCACCCGGGTTCAACATCGGAACCAAGCCACCAACGACCACGATTGGAACGACAGAATTCCAGCACTCTGAAGCCCGCCGACTCCACTCCGGTGCTAGTGCAATTGGGTAACGTTTTGCAATTAGGAAACGCTTCCGGGCAAGTTGCAGAAGCTCCTCCCCAGGAGACCGACGAGGCAGCGGTGTCCCACATGCTGGCGGAGCGCAGACGAAGAATTAAACAGAATGAGAATTTCTCTCAGCTGAAAGCTCTGATCCCGAGTGCTACCAAGATGGATAAAGCAACGGTGCTGGCTGAAACCATAGTTTATATTAATAGTCTGAAGGCGCGCCTCGAAGCTTTGGAGCAGTGCAATCAATCGCTGAAATTTTTGATCGGAGATCGGGCGACGGACATAGCCGGGCCCTCGAATGCACCCGCCATCCGGCTTCCCACTCCTCCTGTGCCGAGTTCACGAGAGCCGGAAAGGGTGGAGGTGACTCCTGACGGAGAAGGAAACTTGAGAATCGAGATAAGGAGCCCATGTGCTCAACCAGAGAATGCGATCCATATACTGACATCTCTGAAACAGATGCAACTCAGAGTCCTAAGTTCCCAGATGTCTATTGATGATAATAGGATCACTGCGACTTTTGTAGTTAAGATGAAAAGAAAGAATTCGACTGGCCAAAACGAAGTCTGTGCAAATGTGACAAGCGAACTCAGAAAATGCTTAGGGCTTTAAGTCTGAGCTCTCGTCGACAAATATTTACCTCTCAGTGCACTTAGAGCCGAAGGAAAGATGTACAAAGTATCCTCTTTTTTCTTAGTTTCTTTTCCCTACCGATGGTGTAAGAATTTCAAGCTCTGGTCGTAGCAGAGACACTCAGGCTCCTTTGCTTGTAAGATAGCAACAATCGAAGTCGATCTCGCCGGCATCATCTCGTTCTTCCCTAGTGTACATACGACCTAGGATCAAAGCTTTTAGAGATGACTGTCGTGCTGCCCGCCCCGAAAGAAAGAATCGAGGAAAGAGACAGCTCAACTTCAACTTCACCCATTCATTGATCTGGTCTGATCACACATGCACTCATGAAGATTTTGATCTCGTATCAGTTTTGAGCTCTTCGATCGTAGACAGACTGATCCCCTATTTGTTTCTGTAGTGCAGCCAAATAAAAAGTGGGCCTCGAATGTACACATATTTGCCGCTGGCATACCATATAAGTGAAACTTTGAAACTTTTTA

CDS

>Mapoly0028s0062.2
ATGGCAGAGCTCAACACCACGCTCTGGGACCTTCTCCAGACCATTCAATGGTCCTACGCTGCGCTCTGGACCCTGACCCCCGATCGAAGGATGCTCAAGTGGCAGGAAGGGTGGTTCAACCTGAAAGCGGCGGGAGACAGCAATGGAAGCGACTCAGATAATAAGAATGCAGAGCTTTTCTACTTCCTATACAATCAGTTGACATTTGCCCCGGGCGTCGGGTTTGCAGGTCATGCTCTCCAACATATGGGCGACAGAATTCTCTGGTTGGCTGGAGATATGGCTTTGGGTAGCATTCCCAATCCAGTTGAGAAGCAGAGCTTTTTCATAAAGGCAGCTGGAATCCAGACCACAATCTGCATCCCGTTGGAGGACAAGGTGTTGGAGCTCGGCACGATCAACTTGGTTCCGGAAAATGATGAAATAGCTCACTGCATCAAGAAGATTATGTACAGCCTTTTGGACCGCTACTTGAAGAAGCCTGAGCCTTGCCACTTCCCCGACATTCAGTTCGGGCTGGAAATGAACAATTTAACCCCGACATCGTCCGGAGCTGGGCCATCGATGGTGATACCACTTCCGAATGATTTCTCCTCGCTGTCATCGAAACCAATGAATCTGATGGCTATGAACTTGCCCACAGTTTACGACGACCTGGATGCGAGCTACATTGTGCCGCCAGTGGCAATGTCTGCTCCAGAATTGATGCAGAGCCGATTATCTTGGACTCCAGAGCAACTGTCGATGCCATTGGGTCACAATGACTTGGACATATGGAGCACAGCATCCACTTTAGCGGCACTGCAATCTCATGGGATTTCTACCTCGTCCGCATCATCGACCCTCATGGTGGACCATATCGAACAGGCTCTTCCAGGGTTCACATTGCCAATGCCGTTCATCGAGAGCGACGTGACATTATTGGCACCTTCTCCTTCCCCTCCTATAGTAGAAGCCACCACATCGCTCCGTGATCGGTCGTCCTCCAGGAGCTCCCTTCGATCCGGAGCACACCTCGAAGACAATGAGATTTCCTCGGTTGCCAAAGTGTACGCGGATTGTCAAATATCTGAGCCCAAACTCGTCGCGGAAGCGGGGCGAGAATCCGACAGCAGGGTGTCGTCGGGTCGGCTTCGTCGCTCTCCATCTCCCAAGGAAATGTCACCAGATTCACTCTCGAGCTTGCCCAAGCCCAGGGCCCCTAGCCATGGCCTACAACAGCCTCTCATGTTTCACCCGGGTTCAACATCGGAACCAAGCCACCAACGACCACGATTGGAACGACAGAATTCCAGCACTCTGAAGCCCGCCGACTCCACTCCGGTGCTAGTGCAATTGGGTAACGTTTTGCAATTAGGAAACGCTTCCGGGCAAGTTGCAGAAGCTCCTCCCCAGGAGACCGACGAGGCAGCGGTGTCCCACATGCTGGCGGAGCGCAGACGAAGAATTAAACAGAATGAGAATTTCTCTCAGCTGAAAGCTCTGATCCCGAGTGCTACCAAGATGGATAAAGCAACGGTGCTGGCTGAAACCATAGTTTATATTAATAGTCTGAAGGCGCGCCTCGAAGCTTTGGAGCAGTGCAATCAATCGCTGAAATTTTTGATCGGAGATCGGGCGACGGACATAGCCGGGCCCTCGAATGCACCCGCCATCCGGCTTCCCACTCCTCCTGTGCCGAGTTCACGAGAGCCGGAAAGGGTGGAGGTGACTCCTGACGGAGAAGGAAACTTGAGAATCGAGATAAGGAGCCCATGTGCTCAACCAGAGAATGCGATCCATATACTGACATCTCTGAAACAGATGCAACTCAGAGTCCTAAGTTCCCAGATGTCTATTGATGATAATAGGATCACTGCGACTTTTGTAGTTAAGATGAAAAGAAAGAATTCGACTGGCCAAAACGAAGTCTGTGCAAATGTGACAAGCGAACTCAGAAAATGCTTAGGGCTTTAA

Protein

>Mapoly0028s0062.2
MAELNTTLWDLLQTIQWSYAALWTLTPDRRMLKWQEGWFNLKAAGDSNGSDSDNKNAELFYFLYNQLTFAPGVGFAGHALQHMGDRILWLAGDMALGSIPNPVEKQSFFIKAAGIQTTICIPLEDKVLELGTINLVPENDEIAHCIKKIMYSLLDRYLKKPEPCHFPDIQFGLEMNNLTPTSSGAGPSMVIPLPNDFSSLSSKPMNLMAMNLPTVYDDLDASYIVPPVAMSAPELMQSRLSWTPEQLSMPLGHNDLDIWSTASTLAALQSHGISTSSASSTLMVDHIEQALPGFTLPMPFIESDVTLLAPSPSPPIVEATTSLRDRSSSRSSLRSGAHLEDNEISSVAKVYADCQISEPKLVAEAGRESDSRVSSGRLRRSPSPKEMSPDSLSSLPKPRAPSHGLQQPLMFHPGSTSEPSHQRPRLERQNSSTLKPADSTPVLVQLGNVLQLGNASGQVAEAPPQETDEAAVSHMLAERRRRIKQNENFSQLKALIPSATKMDKATVLAETIVYINSLKARLEALEQCNQSLKFLIGDRATDIAGPSNAPAIRLPTPPVPSSREPERVEVTPDGEGNLRIEIRSPCAQPENAIHILTSLKQMQLRVLSSQMSIDDNRITATFVVKMKRKNSTGQNEVCANVTSELRKCLGL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>