Mapoly0028s0084



Description

Zeaxanthin epoxidase.

Reference DB

Database ID Description
EC 1.14.13.90 Zeaxanthin epoxidase.
GO GO:0005515 Protein binding
KEGGORTH K09838
KOG KOG2614 Kynurenine 3-monooxygenase and related flavoprotein monooxygenases
OrthoMCL OG5_131609
PFAM PF00498 FHA domain
PFAM PF01494 FAD binding domain
PANTHER PTHR13789 MONOOXYGENASE
PANTHER PTHR13789:SF186

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpABA1 zeaxanthin epoxidase Mapoly0028s0084.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0028s0084.1 scaffold_28:1022122..1029108  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0028s0084.1  

Gene structure:

mRNA scaffold_28:1022122..1029108  ( - strand )
three_prime_UTR scaffold_28:1022122..1022382  ( - strand )
CDS scaffold_28:1022383..1022460  ( - strand )
CDS scaffold_28:1022679..1022766  ( - strand )
CDS scaffold_28:1022929..1023017  ( - strand )
CDS scaffold_28:1023202..1023256  ( - strand )
CDS scaffold_28:1023463..1023573  ( - strand )
CDS scaffold_28:1023733..1023797  ( - strand )
CDS scaffold_28:1024125..1024170  ( - strand )
CDS scaffold_28:1024418..1024521  ( - strand )
CDS scaffold_28:1024634..1024748  ( - strand )
CDS scaffold_28:1025183..1025265  ( - strand )
CDS scaffold_28:1025509..1025720  ( - strand )
CDS scaffold_28:1026091..1026206  ( - strand )
CDS scaffold_28:1026465..1026565  ( - strand )
CDS scaffold_28:1027062..1027136  ( - strand )
CDS scaffold_28:1027458..1027620  ( - strand )
CDS scaffold_28:1028184..1028806  ( - strand )
five_prime_UTR scaffold_28:1028807..1029108  ( - strand )

Sequences:

Gene

>Mapoly0028s0084.1
TGGACCACAAACATAGATATTCGCAACTGTGTCTGATCTCTCGTATCCCACTTCCTGGGCACTTATAATTGCAACGCAGCAGGAGATTCCATACTTGTGTATATTATAGGCCCGTAGTTTCGATCAGCAACGAGGTTGCGTTTCAGTCTGAAAACCGCTCGCTGGTTTAAAGGTCTGTGAGCGGTGGATGCGAGCCACGAGCAAAATCACGCCCCTGTCGGAAAATCAGCTTCTCGAGACTCTAATTGAGGAGCAGCTGCAATCGTAAAATCCGGGCTTTGGTTCTGAGTATTGTTGCCGTCATGGCGGCGAGAGTTGCACTCTCATCCTCCCGCCTTCAATGTTTAGTCGGTGGTGGACACAGTGGGAAATTGTCGGATTCCGAGAGCCTCAAATTGGCACGGCCCGCAAGCAGTTGTAGATGTGGGCATGTGGAGAATTCTTTGAGGTCGGACGCGTTTGTGGGGCAAAGGTTGAGGAGTAAGGACGGCGCGTTGAAGTTGAAAAAAGTCGTGAGTTCTACCGTCAGGGCAGAGGCCGTGCAAGAAGTCTCTACGGCGAATTTTAGCACCGCAGCTGACTCTCAAGCCTCGTTAGAATCCTCGTTCAAGTATTCCGACCAAATTAGCAAACTGGTCAGTGGCAACCCCACTCGTCCTCTCAGACTGATTATTGCCGGAGGAGGTATCGGAGGTCTGGTGCTTGCTCTCGCAGCCAAGAAGAAGGGGATAGATGTGAAGGTATTCGAGCGGGATTTGAGTGCAATTAAGGGTGAGGGTCAGTACAGAGGACCCATTCAGCTGCAGAGTAACGCGTTAGCCGCTTTGGAAGCAGTTGATGTCGATGTCGCCGAAGAGATCATGGCCAACGGTTGTGTCACCGGAGATCGAATTAATGGTTTGGTAGATGGTCTGACGGGAGCCTGGTTAGTCCACTTTGCCCCTCGATTGTCCTTTTCGAAATTGACGCATTCCGATGCTGACGAAGCGTTTAGTCAACTTGACTTTCTAAGCTTGCTCCTCAACAGAGGCACTTCTGACTTGCCAGTAGAAATATCGACAGAGCGTGTAGGACGAATTGAGCTTCTGGGAGGATTTATGCCCATTTCTGAATTCTAGAGTAAATTTAAGGAACTAGACCTGCTTCGAGGGCAGAGCTGGTTCCAGAAACTTTTACAAGTCGTAATGAGAGTTAGATTCGGCACATTAGAATTTTCATAAGATAATTCAATCGTGATACCTCGATCATACAAGTATTCTTGCTCAGGTTTCTAATTTGCCCAACACGCATCACAAAGTCTGGTGACAACAGGAAATTTTCTTCGGAGGATTTTCTTCTGAAGGCTCTACACTGTAGCCTCAAGCTCGTGCCTTGAAGCAATTCTGGGCGTTCTACAAATCACTCTACAAGCGTTGTGATAAGGGTCCTGAGCAAGGGAATTGATCTCTCCGTCTGACGGGGATGTTATCCACTTGCCCACATGCGCAGGTACTGTAAATTTGACACTTTCACACCCGCTGTGGAGAGAGGGCTTCCAGTCACAAGGGTGATTAGTAGAATGACTCTTCAACAAATATTGGCCCGTGCCGTTGGAGAGGAGATTATCGAGAACAGTTGCAACGTCGTCGACTTTGAGGATGGCGATGATAAGGTTCGTTCTTGCTGTGAAGTAGATACCATACTATGTTAGGTTGACGTACACACGGACCCTGATCCGTTGCGTATCTCGAAGTGAGTCCAGTTTACAGAACTCAATTTGACGAGCGATGAGATTAGCCACAATTGCAGGCTCTTCGCCGAGCTTACGTTAGCCGGAAATCAGATCTATCTTTGTACAGAATCGTGCTCCTTTCACAGATATCCCTGCACCCAATTTTGGCCTATCAGTTTTGAGACCCAATTGAAATCGATAGGATTTTCCTTTACTCTTGTAGACCTTGCTCTCAGTCCTTCCATCCTGAATTCCTGACAGGTTACAGTAGTACTCGAAGACGGCCGCCGCGTCGAAGGAGATCTGCTCGTCGGTGCAGATGGTATTCGTTCCAAGGTAAGATACCCTACTTTGTCATGGACTTCGAAACTTACACTGGCGATTACAGCGAGATGGCCATCTAGATCCAAACGAGAAAACACCTTTGCGAAAGTAAGTAATTGTCAGACATTTGAACGAAGTATATCAGGTTCCAAAGGGTTTTTCGCTGGATTCTCAAACGGGGTAACGAAGGCCGCAATAAGGTGAGAGGAAGTCTGTTGTAATCAGTACATGGAGAGTCAACACTTCACAGATAACTCAGAGCTATTTTAAAACTTCACGAACCAAAATGATGGAGGTAGCAGGCACTCCGATTCTTCTTATTTGTAGGACCGTGTGGATGGTACACGAAGGTTCTACTAGACTAGCACCCTAACAAGAGCGCAGGAGCTCGGGACAAGATCATTTTAAGAGGTGCACACACCCTGTAGCTCTCTATCCTGAGATACCATAAGCTTTGACACTGCTACAAATAATCTCTTGGGCTAACTTCAGTTTGGTCCTGTTATAGGTACGCACTAAACTACTTGGTCCCTCAGAGGCAACGTTTTCTCAGTACACATGCTACACGGGAATTGCCGACTTTGTGCCCGCCGATATTGAAACTGTCGGGTAAGTATGGTGTCGTCTGTCTCTCAAGACAGACAGTCTTAGATCTTCCACACTCCAGCCGGGCCTCTGAGTTCTGTAGACCATAGTTCGGGCACCCTACTTTCACCGTTTTCTAAGATGAGCAGCTACCTTTCAAACACGCTTAGGTCCCTATCACCTTTATCAGATTTGACGAAGACTGTTGTTGTGAAATTTCTGAAATAAAATTTCTAGGCTTCTATCATGACCAGTGAACTTTTCGTGTCTGTTGATGTCCAGATACCGAGTTTTCCTTGGAAACAAGAAGTATTTTGTCTCGTCTGATGTTGGACATGGCAAGATGCAATGGTATGCCTTTCACAATGAGCCAGCAGGAGGCGTCGATCCTCCAGGCGGTATGTTCTCTCTACCTGTGACGGGCGTCACTGATAGTCTTCGCCTCTAACCGACTAAGTGAATAATGTTTGCTGAAGGCACTTAACCTAGCGTCTTGGCCTAAAATTGTGAAGCCTTTGCTTAATCTTAGTGATTCCTAACGACCTTCTGTCAGCCCGACCAGTGGGCTGCCTACAGCTGTGTAAGGTCTCTCTTGTCTGTACTTAGCGGACTATGTGTTGCCTCACAAGCTCTAGGGAAACTAGTGGAAGCTGTCGTTCCAGTAGTTTGCTCACTAGGTCATTGCTTACGACCGTCCTTCTCATTCTAACTTGAATTACGCACTCTTGCCAACTGACCATGATGTTGTGTGTCCGTTGTTGTTTTCAGGAAGAAAGGACAGACTAATGGATCTTTTTGGACACTGGTGTGATGGGGTGGTGGACCTGCTTCTTGCCACTCCAGAGGAGCAAATTTTACGGCGCGATATTTACGACCGAGTTCCAATAATGACCTGGAGCAATGGCCGAGTTACTCTATTAGGTGACTCTGCTCATGCCATGCAGCCAAACATGGGGCAGGGCGGTTGTATGGCTATTGAGGTATGAAAAAATGGTTTCTTATCCTAAACTATCAAAATAGATTGGAGGATTCAAATTGGGCGTTGAGCTGGGTGATTCCAAAGCTTTAATTTTCTCTGCAGTCGAAGCGGCGCTATGCAGTACTCAAAGTTTGGGTCACGTCTTTGTGTTGAATTTATGTACATACAAGTAACTGCCAACAGCCAACAAAACCACAGTTTGTTGTTCCGACTTCTGAAAGATAGTCTCGAATTCGGTTTACAGGACAGTTATCAATTAGCCCTCGACCTGGAGAAGGCCATGGAGGGTGGAGATAAATCCGTCGACATTCCTGACATTCTCCGAAGGTATTTTGTCTATCTACGTGTGGTTTTCGACGAGTTCCGATGTAAACAGTCCAATATGAGGAAGTTACCTCGAAAACTACTACGTTTCATCTCGATTTAGTTTCGTCCTGCAATCCAGAATGATCATAGAAAAACACCCTGTTTCCATCAGGGTATGCTACTGAAGAAAACTTTAGTAAATTAGCTGGACATGTTCATCAGTCAAAATAGCGACCGATAAGCTGAGTATCTTCAGCACTTAGAATGTGAACTCCGGCTGATGGTTCATCCTGAACAAAAGGGACAGTACATCTTATGGACCAACTCTGAAGTTTGTAGCGCTCTTCTTAACTCACGTATGATGACTAGGTGTCGTAAGTGAGAGCAACGACTTACCGACTTCCTAATTTTCCCTTGTGTCATATCATTCCACTCACTATTAAAATCTATTGCAGATACGAAAGCCAGAGGAGAATGAGAGTTGCAGCTGTACATGGTATGGCTGGCATGGCTGCCATCATGGCGTCTACTTACAAAGCCTACCTTGGTGAAGGTCTTGGTCCTCTTTCGGTACGAATCCGAATGCTTTCTTGATAACGGCCTGTGATTTCTGTTTACAGCATATTCAGCTTGCGCTGTTTACCTGTTTACAGTTCATGACAATTTGTTTTCCATGTCCCAGGTCATACAAAAACTGAGGATACCCCACCCAGGAAGGGTTGCAGGACAGTTTTTCATCACTATTGGCATGCCTGTCATGCTCAGCTGGGTTCTTGGAGGCAACACGTAATGTTCATTTATCTCAGTACACGGAGTAACTTGCCTACATGTTGCGTGAATCGGTCGAATGTGCTTGAATGGTTAACTACGTTGTGGCAAGATCAGGAGATTATTACTCTGTGATGGAGCGTGCCTGTTTATTTGGCTCTCAGCTTTTCTCATATGAATGAATACCCCTTCTTTAACTATGATAAATCATCACCAAGCGCAGCTAGTCTCTTCAAAGCTAACTTCTCTATGACTTTCTTTTCAGGTTTGCTTTGGAAGGTCGGGCACCCCGATGCAGGTTAGAGGATAAGGTAAGAGTTCAAGCTATGTAGAATGCATGGAGAAGTTTAACTTGCTGTTTACTTTAGATCTGAATGATGTTTCTGACTTCTGCTCCGGAGCTTCCAAAACTGCATTCTTGGAGGGTTGTCATAATAATTCCATGTCTAGAACGCCATAAGGAACTTGTTGCTTATTTTGGGCAATTAACTATCTATGAGTTGTGCCAGCTTCCTAGGCCGTTTCCCAAGAGACTGAATAGTATTTTCACGTATGGTATCGCGCTCTCTCACTAATCAAAGAAAAACAAATTGTGGCATAGTACAATATTAACTGCTTATTATGTTTCATGCGTGCAGGCGGATGATAATTTGAGGAAGTGGTTCTCAGACGATGATGCGCTAGAGCGTGCTACAACTGCAGAGTAAGAAACCAGACTCAAGCCAGAATTTCCAGACCTTCTTCGCAGGATTATGCAGTGTAGAAACATCTTTTTCTTTAATCCTGAGAAGCATCTGCATCGCACACGAACTGCCACTGAATTCTCAAATGACATGACATTTGGTGGTGGGTGGTCCTGAAGGTGGTACTTGCTACCTGCGGGAGAGAGAATGCCAGTTGGAGACACGACTGCTTCTGGAAAGAAAATTATACGTATAGTAGGAATTGATTCCACGAAATCCACAGTTCTAGGGTAAGATTTCTTTCATCTTTCTTAATGCGCACCACATCAAGCACCGTTACTCTCAAAGTCTTTTCCTTTCCCGACGTATACTTTGATTCCTGGAGAAAAAAACTTCTTCAATCTTTTCTGAACAATCCGGACCACCCCTCATACTTTTGTAATGTGATGAACGCTCTTGTCTGTGATAACATGAACCGAGGTTTCCGTGTCTGCAGGTGTGAAGAATGCAAGGATTCGGACGTGTACGCTGCAGTCGTTGCTGCTCCCGGAGTATGACATCCTGCTTATCCCAGCCCACTTGTCGGACATTGTATTTGCTGGACGGATAAACACATACTGGGAGAAAATATTTTATTGACACCAACTGAGCCGTGCTTCTAGTTGTCTTCTCAAAATTATTGAAGCTTTATGTATGCTGTGTTCTCCGGTCTAACTTTACAAAATCTGACTGCAGGTTTCGGAACGACATGCTCGATTTGATTTCACAGATGGTGCAGTTTTCATCACTGATCTGCAGAGCAAAAGTGGCACTTGGATAACGAAGTAAGGAACCGTGGCTTTTACATTCCTGCATGAACTCATTTTGGACTAGATAGACTGAAGTAGTAACGAGCCTTAGCTCTTGTAAGACCGAAGTGTATCTGCTTGTCGAGATTTCTGCATGCAATCATCTCCTTACTCGACGCAATTCACTATGTTTTGCAGTATTGATGGAGCACGTTTCCAAGCACCACCATCAATCCCCGTACGAATTCACCAGGGCGACACCATCGAACTTGGTACATCTAAAGAGGTACGTCCAGCAGTCCCACACCCGATCGTGAGGGGATTCGGAGATTGATACTTTGGGTGTCATATTACCTTCAGTTGATCATTCAATAATGCTGAAACCAGGCTGGCTGCAAGTTAGTGTATTTTGCTTTAGGTGGGAGAATTAAACCATTTGCCTGAATTTGGCAGATGCGTACAATTGATTATCTCTTACTGTACCTGTGCTCTTTGTTGGATCAGGCTGCCTTTAGGGTCAAGCTGAGGAAGCCGGTGCAGGAAAGCGGGCAGGCTGCCCCATCTGAAGCAGTTGCCGCATAAGGGGGATTGAACAACTGTGTACTAGTAGCAAATGCCTCATTTATGAACACAAGATTCTTGTTTATACATCACTTAAATCGCGCCTTCCCACGAAGGTTTCTTTAGAAGCTTAACTGTATACTAGATGTGCACTTGTACGTTTCGAGTGCGCATACTATTGCTCAAATTGACATCAACGATATTCTCACACGGTTGTCTAGTAGAGTCTAAATTTTGATTGTACCATTTGTTGAATAATCAAATCCTTTTATTCTAGTCGGA

mRNA

>Mapoly0028s0084.1
TGGACCACAAACATAGATATTCGCAACTGTGTCTGATCTCTCGTATCCCACTTCCTGGGCACTTATAATTGCAACGCAGCAGGAGATTCCATACTTGTGTATATTATAGGCCCGTAGTTTCGATCAGCAACGAGGTTGCGTTTCAGTCTGAAAACCGCTCGCTGGTTTAAAGGTCTGTGAGCGGTGGATGCGAGCCACGAGCAAAATCACGCCCCTGTCGGAAAATCAGCTTCTCGAGACTCTAATTGAGGAGCAGCTGCAATCGTAAAATCCGGGCTTTGGTTCTGAGTATTGTTGCCGTCATGGCGGCGAGAGTTGCACTCTCATCCTCCCGCCTTCAATGTTTAGTCGGTGGTGGACACAGTGGGAAATTGTCGGATTCCGAGAGCCTCAAATTGGCACGGCCCGCAAGCAGTTGTAGATGTGGGCATGTGGAGAATTCTTTGAGGTCGGACGCGTTTGTGGGGCAAAGGTTGAGGAGTAAGGACGGCGCGTTGAAGTTGAAAAAAGTCGTGAGTTCTACCGTCAGGGCAGAGGCCGTGCAAGAAGTCTCTACGGCGAATTTTAGCACCGCAGCTGACTCTCAAGCCTCGTTAGAATCCTCGTTCAAGTATTCCGACCAAATTAGCAAACTGGTCAGTGGCAACCCCACTCGTCCTCTCAGACTGATTATTGCCGGAGGAGGTATCGGAGGTCTGGTGCTTGCTCTCGCAGCCAAGAAGAAGGGGATAGATGTGAAGGTATTCGAGCGGGATTTGAGTGCAATTAAGGGTGAGGGTCAGTACAGAGGACCCATTCAGCTGCAGAGTAACGCGTTAGCCGCTTTGGAAGCAGTTGATGTCGATGTCGCCGAAGAGATCATGGCCAACGGTTGTGTCACCGGAGATCGAATTAATGGTTTGGTAGATGGTCTGACGGGAGCCTGGTACTGTAAATTTGACACTTTCACACCCGCTGTGGAGAGAGGGCTTCCAGTCACAAGGGTGATTAGTAGAATGACTCTTCAACAAATATTGGCCCGTGCCGTTGGAGAGGAGATTATCGAGAACAGTTGCAACGTCGTCGACTTTGAGGATGGCGATGATAAGGTTACAGTAGTACTCGAAGACGGCCGCCGCGTCGAAGGAGATCTGCTCGTCGGTGCAGATGGTATTCGTTCCAAGGTACGCACTAAACTACTTGGTCCCTCAGAGGCAACGTTTTCTCAGTACACATGCTACACGGGAATTGCCGACTTTGTGCCCGCCGATATTGAAACTGTCGGATACCGAGTTTTCCTTGGAAACAAGAAGTATTTTGTCTCGTCTGATGTTGGACATGGCAAGATGCAATGGTATGCCTTTCACAATGAGCCAGCAGGAGGCGTCGATCCTCCAGGCGGAAGAAAGGACAGACTAATGGATCTTTTTGGACACTGGTGTGATGGGGTGGTGGACCTGCTTCTTGCCACTCCAGAGGAGCAAATTTTACGGCGCGATATTTACGACCGAGTTCCAATAATGACCTGGAGCAATGGCCGAGTTACTCTATTAGGTGACTCTGCTCATGCCATGCAGCCAAACATGGGGCAGGGCGGTTGTATGGCTATTGAGGACAGTTATCAATTAGCCCTCGACCTGGAGAAGGCCATGGAGGGTGGAGATAAATCCGTCGACATTCCTGACATTCTCCGAAGATACGAAAGCCAGAGGAGAATGAGAGTTGCAGCTGTACATGGTATGGCTGGCATGGCTGCCATCATGGCGTCTACTTACAAAGCCTACCTTGGTGAAGGTCTTGGTCCTCTTTCGGTCATACAAAAACTGAGGATACCCCACCCAGGAAGGGTTGCAGGACAGTTTTTCATCACTATTGGCATGCCTGTCATGCTCAGCTGGGTTCTTGGAGGCAACACGTTTGCTTTGGAAGGTCGGGCACCCCGATGCAGGTTAGAGGATAAGGCGGATGATAATTTGAGGAAGTGGTTCTCAGACGATGATGCGCTAGAGCGTGCTACAACTGCAGAGTGGTACTTGCTACCTGCGGGAGAGAGAATGCCAGTTGGAGACACGACTGCTTCTGGAAAGAAAATTATACGTATAGTAGGAATTGATTCCACGAAATCCACAGTTCTAGGGTGTGAAGAATGCAAGGATTCGGACGTGTACGCTGCAGTCGTTGCTGCTCCCGGAGTTTCGGAACGACATGCTCGATTTGATTTCACAGATGGTGCAGTTTTCATCACTGATCTGCAGAGCAAAAGTGGCACTTGGATAACGAATATTGATGGAGCACGTTTCCAAGCACCACCATCAATCCCCGTACGAATTCACCAGGGCGACACCATCGAACTTGGTACATCTAAAGAGGCTGCCTTTAGGGTCAAGCTGAGGAAGCCGGTGCAGGAAAGCGGGCAGGCTGCCCCATCTGAAGCAGTTGCCGCATAAGGGGGATTGAACAACTGTGTACTAGTAGCAAATGCCTCATTTATGAACACAAGATTCTTGTTTATACATCACTTAAATCGCGCCTTCCCACGAAGGTTTCTTTAGAAGCTTAACTGTATACTAGATGTGCACTTGTACGTTTCGAGTGCGCATACTATTGCTCAAATTGACATCAACGATATTCTCACACGGTTGTCTAGTAGAGTCTAAATTTTGATTGTACCATTTGTTGAATAATCAAATCCTTTTATTCTAGTCGGA

CDS

>Mapoly0028s0084.1
ATGGCGGCGAGAGTTGCACTCTCATCCTCCCGCCTTCAATGTTTAGTCGGTGGTGGACACAGTGGGAAATTGTCGGATTCCGAGAGCCTCAAATTGGCACGGCCCGCAAGCAGTTGTAGATGTGGGCATGTGGAGAATTCTTTGAGGTCGGACGCGTTTGTGGGGCAAAGGTTGAGGAGTAAGGACGGCGCGTTGAAGTTGAAAAAAGTCGTGAGTTCTACCGTCAGGGCAGAGGCCGTGCAAGAAGTCTCTACGGCGAATTTTAGCACCGCAGCTGACTCTCAAGCCTCGTTAGAATCCTCGTTCAAGTATTCCGACCAAATTAGCAAACTGGTCAGTGGCAACCCCACTCGTCCTCTCAGACTGATTATTGCCGGAGGAGGTATCGGAGGTCTGGTGCTTGCTCTCGCAGCCAAGAAGAAGGGGATAGATGTGAAGGTATTCGAGCGGGATTTGAGTGCAATTAAGGGTGAGGGTCAGTACAGAGGACCCATTCAGCTGCAGAGTAACGCGTTAGCCGCTTTGGAAGCAGTTGATGTCGATGTCGCCGAAGAGATCATGGCCAACGGTTGTGTCACCGGAGATCGAATTAATGGTTTGGTAGATGGTCTGACGGGAGCCTGGTACTGTAAATTTGACACTTTCACACCCGCTGTGGAGAGAGGGCTTCCAGTCACAAGGGTGATTAGTAGAATGACTCTTCAACAAATATTGGCCCGTGCCGTTGGAGAGGAGATTATCGAGAACAGTTGCAACGTCGTCGACTTTGAGGATGGCGATGATAAGGTTACAGTAGTACTCGAAGACGGCCGCCGCGTCGAAGGAGATCTGCTCGTCGGTGCAGATGGTATTCGTTCCAAGGTACGCACTAAACTACTTGGTCCCTCAGAGGCAACGTTTTCTCAGTACACATGCTACACGGGAATTGCCGACTTTGTGCCCGCCGATATTGAAACTGTCGGATACCGAGTTTTCCTTGGAAACAAGAAGTATTTTGTCTCGTCTGATGTTGGACATGGCAAGATGCAATGGTATGCCTTTCACAATGAGCCAGCAGGAGGCGTCGATCCTCCAGGCGGAAGAAAGGACAGACTAATGGATCTTTTTGGACACTGGTGTGATGGGGTGGTGGACCTGCTTCTTGCCACTCCAGAGGAGCAAATTTTACGGCGCGATATTTACGACCGAGTTCCAATAATGACCTGGAGCAATGGCCGAGTTACTCTATTAGGTGACTCTGCTCATGCCATGCAGCCAAACATGGGGCAGGGCGGTTGTATGGCTATTGAGGACAGTTATCAATTAGCCCTCGACCTGGAGAAGGCCATGGAGGGTGGAGATAAATCCGTCGACATTCCTGACATTCTCCGAAGATACGAAAGCCAGAGGAGAATGAGAGTTGCAGCTGTACATGGTATGGCTGGCATGGCTGCCATCATGGCGTCTACTTACAAAGCCTACCTTGGTGAAGGTCTTGGTCCTCTTTCGGTCATACAAAAACTGAGGATACCCCACCCAGGAAGGGTTGCAGGACAGTTTTTCATCACTATTGGCATGCCTGTCATGCTCAGCTGGGTTCTTGGAGGCAACACGTTTGCTTTGGAAGGTCGGGCACCCCGATGCAGGTTAGAGGATAAGGCGGATGATAATTTGAGGAAGTGGTTCTCAGACGATGATGCGCTAGAGCGTGCTACAACTGCAGAGTGGTACTTGCTACCTGCGGGAGAGAGAATGCCAGTTGGAGACACGACTGCTTCTGGAAAGAAAATTATACGTATAGTAGGAATTGATTCCACGAAATCCACAGTTCTAGGGTGTGAAGAATGCAAGGATTCGGACGTGTACGCTGCAGTCGTTGCTGCTCCCGGAGTTTCGGAACGACATGCTCGATTTGATTTCACAGATGGTGCAGTTTTCATCACTGATCTGCAGAGCAAAAGTGGCACTTGGATAACGAATATTGATGGAGCACGTTTCCAAGCACCACCATCAATCCCCGTACGAATTCACCAGGGCGACACCATCGAACTTGGTACATCTAAAGAGGCTGCCTTTAGGGTCAAGCTGAGGAAGCCGGTGCAGGAAAGCGGGCAGGCTGCCCCATCTGAAGCAGTTGCCGCATAA

Protein

>Mapoly0028s0084.1
MAARVALSSSRLQCLVGGGHSGKLSDSESLKLARPASSCRCGHVENSLRSDAFVGQRLRSKDGALKLKKVVSSTVRAEAVQEVSTANFSTAADSQASLESSFKYSDQISKLVSGNPTRPLRLIIAGGGIGGLVLALAAKKKGIDVKVFERDLSAIKGEGQYRGPIQLQSNALAALEAVDVDVAEEIMANGCVTGDRINGLVDGLTGAWYCKFDTFTPAVERGLPVTRVISRMTLQQILARAVGEEIIENSCNVVDFEDGDDKVTVVLEDGRRVEGDLLVGADGIRSKVRTKLLGPSEATFSQYTCYTGIADFVPADIETVGYRVFLGNKKYFVSSDVGHGKMQWYAFHNEPAGGVDPPGGRKDRLMDLFGHWCDGVVDLLLATPEEQILRRDIYDRVPIMTWSNGRVTLLGDSAHAMQPNMGQGGCMAIEDSYQLALDLEKAMEGGDKSVDIPDILRRYESQRRMRVAAVHGMAGMAAIMASTYKAYLGEGLGPLSVIQKLRIPHPGRVAGQFFITIGMPVMLSWVLGGNTFALEGRAPRCRLEDKADDNLRKWFSDDDALERATTAEWYLLPAGERMPVGDTTASGKKIIRIVGIDSTKSTVLGCEECKDSDVYAAVVAAPGVSERHARFDFTDGAVFITDLQSKSGTWITNIDGARFQAPPSIPVRIHQGDTIELGTSKEAAFRVKLRKPVQESGQAAPSEAVAA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>