Mapoly0028s0100



Description

Helix-loop-helix DNA-binding domain

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_143051
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR31945 FAMILY NOT NAMED
PANTHER PTHR31945:SF5

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH48 transcription factor, bHLH Mapoly0028s0100.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0028s0100.1 scaffold_28:1124581..1130882  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0028s0100.1  

Gene structure:

mRNA scaffold_28:1124581..1130882  ( + strand )
five_prime_UTR scaffold_28:1124581..1125554  ( + strand )
five_prime_UTR scaffold_28:1125705..1127084  ( + strand )
CDS scaffold_28:1127085..1127984  ( + strand )
CDS scaffold_28:1128762..1129055  ( + strand )
CDS scaffold_28:1129974..1130144  ( + strand )
CDS scaffold_28:1130250..1130333  ( + strand )
three_prime_UTR scaffold_28:1130334..1130882  ( + strand )

Sequences:

Gene

>Mapoly0028s0100.1
ATGCGGCTCAGAATGTCCCCAACATGCACTTCAGTGAATCTTTGGGACATTCACCGAAGTGAATGTTCGGAAATTCGTGGGTGAAAGTCGAAGCAGTGGGAGCGCAATCTGAAGGGCATGACTTGTACTGGCATCGTGACCGGCCACTTCCAAGGATATGCCATTCTCGTCCGCGTCAGTCGAGGCGTTTACATGTAACCCTTCGGGATTATCTTGTGAGGAGCATTGAAGTCTCGTCGACCTCCACTTTGGGAAGGTCAAAGAGCTAGGAAATTATAGAGCCGAGGTTCCCTATTCCTCGGCCTAGAATCGAACGAGGAAGCCTGAAAAGGGATCTGCTGCTGTCGTGTCATAGTTGCACATGCCCTAATTCTCGAAAGGGGACCAAGTGGACAGACACCGAAAAAGATGGGAAGACCCCATCAAGCCGTCATCAGGCCTAACGGAGATTCGAAATTCCACCCGCGTCGTTTTTCTAATAATTTTCCACAATGATTGCCTTGTACAAGACTCGATCGACTCTTTCCCAGTTTTGCACCAGACTCTGTCCAAGTTTGCTGGGTGATCGATTTGCTCCATGCTTGTCGGTCGGCAATGCGTTCACCAAGATTGATGGGTGGAACAAGAAAGACAGTGAAACGGAAAGGGGGCGCCGCACGGGATAAGAAGCACGATGGCCGGATGAGAAGACCAGAGAAATTGGATGTTAATCGATATACTGTAATTCTTGGACATCAAGGTTGCCAGACCGAACCGGACCGGACCAGACCACCCGTGTGCATCCAACGGTGGGTTACCATTATGCACCGGGATATCGTTCGATGTCATCGAAACGACATAAAATGAATATATATTCAATAGACCTTTCCTCGCATGCACCGGAAGAAAAGTCCAACACTTGCCCTCGACACATGTTCGTCGTCTCCACGCTAGAGCTGCTTTAGCTCACTGACTTTCTCGAGCAATCGCAGAAGGTACTTACACGAAGCACCACTTAACCACAAACATTGCAATAAAGCATGCATAAGTTACGAATTTCGGTGTCGGGTATATCTTCCGTCTTCGCTATCCGATCTGCGCCAGGCAAGAACTCACCGTTTGTGCCGTGTCGAGATCCATGGCAGAAGTTCAGAAGGAAAAGGTCCGAGACGACAGAAAGACTCGAAGACTTGGCAACGGAAAACGAGCGTCCCACAAGGGCTACATTCTTGCACGACGGTGCGCATGCCGTGGAGCTGCGGTCGCAAGCTTGCGGGGCAGGGCAGGGCAGGGGAGGGCAGCGCCTTTCGAAGGGCACGCCACAATCAGGAGGAGCACAGAAGACGGTACATGCAGTACGGCAGGGCCTGACAGGAGGGAGCAGTGAAGGCAGAGGAGTCAGCAGCGGTACGGAGGAAACAGGGAAGGGCCTTGTGATTTCTCGGAGGAGGAGGAGGGCCTTTTGCTCGTCGAACGGGGGATGGTGGGAGAGTTCATAAATGACAGGAAGATCCATGTGAACACACCTTCCAGCACACAAGAGCAATACAAGGACTAAAATAATATTTCACCGCAGTAAAGGAACTCGGGTTGCAGGCTTTTGGGCGATGAGTAAAGCGACCCAGGGCCGTAGATCTCACTCCTCAATCGCAACGCATCGTCCGCCTGCTCGCTTTACTCTGGGGCGAGTCTAATTGATGGGCCCGCCGACGGCTGGTGGCAAGGCATTGGTGCCACAGAAAGGAAAGTCTCTCGTGGGTCTGGATTTGTATTGGCACCGGCGACCGCGGACCATCAGGCCAGGGGATGAACCATTAGTACCGCTGTGCTATTATGTTACTGTTGGGATTTGTTTAAGCGTTTTCTGCTTCGGTGGCATTGCGCCATTGCGCCCATGCTTTCCTCTCCTTTCGGGTCTGGAATGGGATCTCTCCTCTCGCGTCTCGACTCTGTCACCGTGCGCGAAAAGAACACCGCGAGAAAATCACGCCCATACAAGAGGAGCCAGGAGTAATTGGTTCGCATCAGGACCGAGAATCCGGAGTGAGCTCCAGCCTCTAGGCGCAGCGGGCTGCTTGCGATCCTTGCGAGTAGGGCAGCGGGGCAGGAACCGACGCCATCAGTCTTCAGCTCCGACGTTCTGATTTGTTGGTGTTGCTGCGACGGAGAGAGTGGCAGCGAGAGGAACGATAGACTTACGATGGCTTCTCGTTGTTGTGTCCTGTCCTGTGCTTGCGGAATCGCCGTCTCCTTTTACGAGTCTCCTCTCCTGATGATCTTTGCCGGCAGCCCCGTTTGACTAACATTCTGGATCAGCTCAGTGGTGCCGAGGGCTAAATTGCCGTGGCAACTCTGAGTGGTGTAATTTTAGCTCTGTGGATGTCACGTACCTCCTAAATTACAAGAAGGCGATTTTTGAGAAAAGACGGGGAGTGGGAGAGGGAAGGAGGCGCCAAGCAGTTGCTCGGTTTGTGTCGGTGTTTTGTCGGAGGGTTCTCGTGACTGAGTGGTGAAGCGCTTTTTTGATGGACAAAAAGCCTCTTATTATCCCTGGCGATAATCGACTCGACTCGTCACAGAATTTGCATCACTCTGTGCTCGTCGGAGCGGCGCATGAAATGTTTCAAAGTGGTCATGGTCTTGGGACTTCTTCAAACATGACTCCGGGCTCCATGTGCAATCTTCACCCTCCTTTGAGCTCTTTTGGTGCAGAGTCCAACTTACACGAGCTGCTCGCACACGCCAGTCCTCATGCTGGTTCTCATGCGCAATCTCTGAACCACTCTTCGAATCACCCTGCAGACTTTTTGGCCACTCTGGGTGATGGAGTGTTGGGTGAATCCAGTGACAATCATATGTTCCACAGGCAGATGGAGTTTTCAAAGCAAAAATGGACGACCCCTTCCAAGCTCACGCCGGGTCCCTTCTGGATGCTGCCGCACCATCTCGATCCAGCAAACTACCCTCTTCCCGGACTTGCTGTCAGCGGCACGAGCTCCCCAAAGACCAATGTTGGCCCTTCTGCTGGCGAGGACTCCTCTAACCCGAACAGACAGGTGTGGTGTGAAAGGGGTGCGAATCAAGTTCTAATGAAATCAGAGGATAATGTGGCTACTCTGAAGCTTCCGATGGTCGTCAAACCCGACAGGTCGCTGCTTTGTGATGGCTCCGGGGCTCCCGTGGATTCACCCAAAGGAGCGAATGGCAATCTGATCAACAGGGATACCTCTGATATGGATGCCAAGCAGCTAGATTCCTCCGATTGCAGTGATCATAACATGGATGAACAGGAGGAGAAGGATCAAGCAACACGAAACGGAGCCGGAAGGACGGTGTCCAAAAATCTAGTCTCTGAGCGGAAACGAAGAAAAAAACTCAATGATGGTCTTTACACTCTGCGTGCCCTTGTTCCGAAAATTAGCAAGGTTCTCTTCTGTCCTCTTTGCTCCTGATGCGTTTTTGTGATAGTTTCCTCTTCTAAGGGCTATGCACTGACTTCCTGTAACAATCGAGATGGAGATGATATGTCGTCTCCTGTGGCCCAACGGATGCTTATGTCTTTGGTAGCGCAACGGCTCTCACACTGAGCCTCATCGTTGTAAAAGTAGAAACTAGACTTGTTTCAGTACTAAACAAATTCTGAGCTTCCAAAAATTCGTTTCCTAAATTTTCTAAATTTCACAGTTCAGATTACCAGTAGTCACTATGGATAATAAATGACCCCCTCAGATGTGGTTCGTTCAATCTTTCAAGGAAACATGCTTAGAAGTTTCCATTTGCCTTTGTTTAGTTAGTCATTTGCTTTTATGGGATGTCATATGTCGAAAACTTGCGGTGAATCTCTAGAAGAGTTGTTTACTACTTGTGGAAGTCAGAACTTGTTGTAGATGGTGTAAAGTTTCTACCATGTTTTCTTATTGTTTGTTAGAACTCATGTTGTCCACCAGTCATAAAATAAGAAAGTTTTCACCCAAAACTTCATTTGTCTGCATCAACTTCAGCCTTGTTCCCCAGTACCCAAAGTTCGTCACCATATTAGGATTTAGAGATACAGCATTCTCATCACTCTTTAGCTCATTTCTCATTACCTTTATGGTCAGTCCGATTATCGTGGCGTCAATAATATACAGTGAGTACTTGTCTTTAGTCTCCAATTCGTTCTTGTTATCAATCTTGCTGAGCTGGATTTCTGGCATTTGCAGATGGACAAGGCATCAATTGTGGGTGATGCTATTGACTATGTGCGCGAGTTACAAAAGCAGGTTGAAGAGTTGCAGGCTGATATATCTGACATTGAATCAACCAAGCCTACAACCGGACCTGGAGGTGAAGCGTCATTATCATCTGTGGCAGAGCCAAGTACGGCTCAGGGTTCCACAGCTCCATCCAGCGGTCGTTCTTGGGAGGAAGAAGGCCACAGAACGTCTGAGGGTCAGCCTCGTCAAGAAATGAGCGAAGCTCCGTTTGAGGATACAACAGAACAGAAAATTCTCGAGGTAATTGTTATCTGTCAATACCATGAAAGTGATTCTCTATGCTCAGCTCGATGCAAATGCAATTACCGGGAGGCATTTGCATATGCAAATGTCTCCTCGTCTTTAGTAAATTGCCTAACTACATGCATGTGCATATACGGTCTTCGGAGACGTATTACTTTATTTTGTACTTCATTTTTTCACCCGAAAATACTCTTCGTGTATGACTTGCATTACTAACCTTATAGATCCGTTTCACATCCAGACGTGAATGTTGGTAAAAGCATTTGCATATGCATTAAGGTCCATCCAATAGTCTTTTTCTTTCTCCGTTTATGTGCCTGCGTTCCCATTACTTAAAAACCGGAACGTGCTCCAAGTGATCTATGTTTGTCCTGTTTCTGAAGTTTATGATCATCCCAAATTTACAATTTGACATGCGGTGCTTGTGAAATGTAACCCGATTCATCATGAATAGGAAGCTTAGTGTTATACATCTAAGTGCTTGTTTCAGAAACTGTGGTGGGTCTTAAACTGCCTTATTGCTAACCCTTGTCAAACCACTAAGCAAATAGAACAATACCTACTTGCATGACTGACATACCATCCTACTCCTCTGTCCTCATACTTTTCCTTGGAGGTCTGGTTTTTGATTATCATTGAATTGTGCAGGAGGTCTATGCTTCAGTCTATCCATTACCTATTGCAATTGGATATATGTTTTGGAGCTTTGGACAACTTTTTAAACAGGACTGTTTTTGCACAATTCTCTTCGTGATGAAGATAATATGTAAACTTACTTTGAATATAACGCTGACAAAGTCTGCTCTTTGGAGCACACAACACGACAAGTTCTTCCCTCACCAGGTAACCAACTTTGGTATGTGAAAGATCTCAGTACATTTACCAGTACTGATTCTGACACACCATTGGTTACAGTTGGATGTTGCGAAGATGGAAGAGCAGATCTATCATCTCCGAATCTTTTGTACCAAAGGACCCGGTGTATTTGTGCAATTGATGCAATCTTTGGAGGCCTTGGGTCTTGAAATACGCAATGCCAATCTGACATCATTCCAAGAAAATTTACTGAACACCTTCATTGCAGAGGTAAGTAAACGTTCATTCAACGCTATAAATATCTTGTTCCTGTATTTTGTTGTCAGTTAGTAGGTACTATTCTTTAGTGCTTATCTCATGTTTGCCTTCTTACAGATCAAAGACTGGGAGATGATGAAGACCGAAGAGGTTAAGAAGGCCATTCTGGATGTGGCTGCTCGTTTTGGTCTGCAACCTTAAGTTTATACAGAGATGAGCAGCTTTGCCAACCATATTTCTTCATCACTCCTTTTACGGCCCGTGTGATTGAGATATCTGTCACTTGAGTTTCAAATCCCAGATCAGGCTTCAGCTAGCATAGATACTTGGCGAAGAAAAGTGGAGGGAGTCCATTTGGAGCTGCAAGAAAGTAGTCAACATTAAAGCAAGTCGATCAAATACTTACATAAAACATTCCAAGTAAAGTGGAGGAAGAAGCTGGAATTGCATCCGGTTCTGTATATAGTTATCCCTTTTTGATAAACTCCCACTCCACCCTTGAGATAGAAGCAAGTCGATAGTCCGGGTGTATCTTGGAACGTTGTTAGTGAGATTCAATATTCTTCCATACTACTGTAGTAGTATTTTTTAGAAACATCTCTTCTATGTCAGGAACATTGGTTGAGGCACCTCCACTTGTTTCTACTTCGGGTGAAATAACACGCATTCAAGTGCTTAAATGTGCACGTTCCTTTGCCAAGGTTCATCCGTATTCACATTCATGTGTGGAGCCAATTCAGTAGCTTTTTG

mRNA

>Mapoly0028s0100.1
ATGCGGCTCAGAATGTCCCCAACATGCACTTCAGTGAATCTTTGGGACATTCACCGAAGTGAATGTTCGGAAATTCGTGGGTGAAAGTCGAAGCAGTGGGAGCGCAATCTGAAGGGCATGACTTGTACTGGCATCGTGACCGGCCACTTCCAAGGATATGCCATTCTCGTCCGCGTCAGTCGAGGCGTTTACATGTAACCCTTCGGGATTATCTTGTGAGGAGCATTGAAGTCTCGTCGACCTCCACTTTGGGAAGGTCAAAGAGCTAGGAAATTATAGAGCCGAGGTTCCCTATTCCTCGGCCTAGAATCGAACGAGGAAGCCTGAAAAGGGATCTGCTGCTGTCGTGTCATAGTTGCACATGCCCTAATTCTCGAAAGGGGACCAAGTGGACAGACACCGAAAAAGATGGGAAGACCCCATCAAGCCGTCATCAGGCCTAACGGAGATTCGAAATTCCACCCGCGTCGTTTTTCTAATAATTTTCCACAATGATTGCCTTGTACAAGACTCGATCGACTCTTTCCCAGTTTTGCACCAGACTCTGTCCAAGTTTGCTGGGTGATCGATTTGCTCCATGCTTGTCGGTCGGCAATGCGTTCACCAAGATTGATGGGTGGAACAAGAAAGACAGTGAAACGGAAAGGGGGCGCCGCACGGGATAAGAAGCACGATGGCCGGATGAGAAGACCAGAGAAATTGGATGTTAATCGATATACTGTAATTCTTGGACATCAAGGTTGCCAGACCGAACCGGACCGGACCAGACCACCCGTGTGCATCCAACGGTGGGTTACCATTATGCACCGGGATATCGTTCGATGTCATCGAAACGACATAAAATGAATATATATTCAATAGACCTTTCCTCGCATGCACCGGAAGAAAAGTCCAACACTTGCCCTCGACACATGTTCGTCGTCTCCACGCTAGAGCTGCTTTAGCTCACTGACTTTCTCGAGCAATCGCAGAAGAAGTTCAGAAGGAAAAGGTCCGAGACGACAGAAAGACTCGAAGACTTGGCAACGGAAAACGAGCGTCCCACAAGGGCTACATTCTTGCACGACGGTGCGCATGCCGTGGAGCTGCGGTCGCAAGCTTGCGGGGCAGGGCAGGGCAGGGGAGGGCAGCGCCTTTCGAAGGGCACGCCACAATCAGGAGGAGCACAGAAGACGGTACATGCAGTACGGCAGGGCCTGACAGGAGGGAGCAGTGAAGGCAGAGGAGTCAGCAGCGGTACGGAGGAAACAGGGAAGGGCCTTGTGATTTCTCGGAGGAGGAGGAGGGCCTTTTGCTCGTCGAACGGGGGATGGTGGGAGAGTTCATAAATGACAGGAAGATCCATGTGAACACACCTTCCAGCACACAAGAGCAATACAAGGACTAAAATAATATTTCACCGCAGTAAAGGAACTCGGGTTGCAGGCTTTTGGGCGATGAGTAAAGCGACCCAGGGCCGTAGATCTCACTCCTCAATCGCAACGCATCGTCCGCCTGCTCGCTTTACTCTGGGGCGAGTCTAATTGATGGGCCCGCCGACGGCTGGTGGCAAGGCATTGGTGCCACAGAAAGGAAAGTCTCTCGTGGGTCTGGATTTGTATTGGCACCGGCGACCGCGGACCATCAGGCCAGGGGATGAACCATTAGTACCGCTGTGCTATTATGTTACTGTTGGGATTTGTTTAAGCGTTTTCTGCTTCGGTGGCATTGCGCCATTGCGCCCATGCTTTCCTCTCCTTTCGGGTCTGGAATGGGATCTCTCCTCTCGCGTCTCGACTCTGTCACCGTGCGCGAAAAGAACACCGCGAGAAAATCACGCCCATACAAGAGGAGCCAGGAGTAATTGGTTCGCATCAGGACCGAGAATCCGGAGTGAGCTCCAGCCTCTAGGCGCAGCGGGCTGCTTGCGATCCTTGCGAGTAGGGCAGCGGGGCAGGAACCGACGCCATCAGTCTTCAGCTCCGACGTTCTGATTTGTTGGTGTTGCTGCGACGGAGAGAGTGGCAGCGAGAGGAACGATAGACTTACGATGGCTTCTCGTTGTTGTGTCCTGTCCTGTGCTTGCGGAATCGCCGTCTCCTTTTACGAGTCTCCTCTCCTGATGATCTTTGCCGGCAGCCCCGTTTGACTAACATTCTGGATCAGCTCAGTGGTGCCGAGGGCTAAATTGCCGTGGCAACTCTGAGTGGTGTAATTTTAGCTCTGTGGATGTCACGTACCTCCTAAATTACAAGAAGGCGATTTTTGAGAAAAGACGGGGAGTGGGAGAGGGAAGGAGGCGCCAAGCAGTTGCTCGGTTTGTGTCGGTGTTTTGTCGGAGGGTTCTCGTGACTGAGTGGTGAAGCGCTTTTTTGATGGACAAAAAGCCTCTTATTATCCCTGGCGATAATCGACTCGACTCGTCACAGAATTTGCATCACTCTGTGCTCGTCGGAGCGGCGCATGAAATGTTTCAAAGTGGTCATGGTCTTGGGACTTCTTCAAACATGACTCCGGGCTCCATGTGCAATCTTCACCCTCCTTTGAGCTCTTTTGGTGCAGAGTCCAACTTACACGAGCTGCTCGCACACGCCAGTCCTCATGCTGGTTCTCATGCGCAATCTCTGAACCACTCTTCGAATCACCCTGCAGACTTTTTGGCCACTCTGGGTGATGGAGTGTTGGGTGAATCCAGTGACAATCATATGTTCCACAGGCAGATGGAGTTTTCAAAGCAAAAATGGACGACCCCTTCCAAGCTCACGCCGGGTCCCTTCTGGATGCTGCCGCACCATCTCGATCCAGCAAACTACCCTCTTCCCGGACTTGCTGTCAGCGGCACGAGCTCCCCAAAGACCAATGTTGGCCCTTCTGCTGGCGAGGACTCCTCTAACCCGAACAGACAGGTGTGGTGTGAAAGGGGTGCGAATCAAGTTCTAATGAAATCAGAGGATAATGTGGCTACTCTGAAGCTTCCGATGGTCGTCAAACCCGACAGGTCGCTGCTTTGTGATGGCTCCGGGGCTCCCGTGGATTCACCCAAAGGAGCGAATGGCAATCTGATCAACAGGGATACCTCTGATATGGATGCCAAGCAGCTAGATTCCTCCGATTGCAGTGATCATAACATGGATGAACAGGAGGAGAAGGATCAAGCAACACGAAACGGAGCCGGAAGGACGGTGTCCAAAAATCTAGTCTCTGAGCGGAAACGAAGAAAAAAACTCAATGATGGTCTTTACACTCTGCGTGCCCTTGTTCCGAAAATTAGCAAGATGGACAAGGCATCAATTGTGGGTGATGCTATTGACTATGTGCGCGAGTTACAAAAGCAGGTTGAAGAGTTGCAGGCTGATATATCTGACATTGAATCAACCAAGCCTACAACCGGACCTGGAGGTGAAGCGTCATTATCATCTGTGGCAGAGCCAAGTACGGCTCAGGGTTCCACAGCTCCATCCAGCGGTCGTTCTTGGGAGGAAGAAGGCCACAGAACGTCTGAGGGTCAGCCTCGTCAAGAAATGAGCGAAGCTCCGTTTGAGGATACAACAGAACAGAAAATTCTCGAGTTGGATGTTGCGAAGATGGAAGAGCAGATCTATCATCTCCGAATCTTTTGTACCAAAGGACCCGGTGTATTTGTGCAATTGATGCAATCTTTGGAGGCCTTGGGTCTTGAAATACGCAATGCCAATCTGACATCATTCCAAGAAAATTTACTGAACACCTTCATTGCAGAGATCAAAGACTGGGAGATGATGAAGACCGAAGAGGTTAAGAAGGCCATTCTGGATGTGGCTGCTCGTTTTGGTCTGCAACCTTAAGTTTATACAGAGATGAGCAGCTTTGCCAACCATATTTCTTCATCACTCCTTTTACGGCCCGTGTGATTGAGATATCTGTCACTTGAGTTTCAAATCCCAGATCAGGCTTCAGCTAGCATAGATACTTGGCGAAGAAAAGTGGAGGGAGTCCATTTGGAGCTGCAAGAAAGTAGTCAACATTAAAGCAAGTCGATCAAATACTTACATAAAACATTCCAAGTAAAGTGGAGGAAGAAGCTGGAATTGCATCCGGTTCTGTATATAGTTATCCCTTTTTGATAAACTCCCACTCCACCCTTGAGATAGAAGCAAGTCGATAGTCCGGGTGTATCTTGGAACGTTGTTAGTGAGATTCAATATTCTTCCATACTACTGTAGTAGTATTTTTTAGAAACATCTCTTCTATGTCAGGAACATTGGTTGAGGCACCTCCACTTGTTTCTACTTCGGGTGAAATAACACGCATTCAAGTGCTTAAATGTGCACGTTCCTTTGCCAAGGTTCATCCGTATTCACATTCATGTGTGGAGCCAATTCAGTAGCTTTTTG

CDS

>Mapoly0028s0100.1
ATGGACAAAAAGCCTCTTATTATCCCTGGCGATAATCGACTCGACTCGTCACAGAATTTGCATCACTCTGTGCTCGTCGGAGCGGCGCATGAAATGTTTCAAAGTGGTCATGGTCTTGGGACTTCTTCAAACATGACTCCGGGCTCCATGTGCAATCTTCACCCTCCTTTGAGCTCTTTTGGTGCAGAGTCCAACTTACACGAGCTGCTCGCACACGCCAGTCCTCATGCTGGTTCTCATGCGCAATCTCTGAACCACTCTTCGAATCACCCTGCAGACTTTTTGGCCACTCTGGGTGATGGAGTGTTGGGTGAATCCAGTGACAATCATATGTTCCACAGGCAGATGGAGTTTTCAAAGCAAAAATGGACGACCCCTTCCAAGCTCACGCCGGGTCCCTTCTGGATGCTGCCGCACCATCTCGATCCAGCAAACTACCCTCTTCCCGGACTTGCTGTCAGCGGCACGAGCTCCCCAAAGACCAATGTTGGCCCTTCTGCTGGCGAGGACTCCTCTAACCCGAACAGACAGGTGTGGTGTGAAAGGGGTGCGAATCAAGTTCTAATGAAATCAGAGGATAATGTGGCTACTCTGAAGCTTCCGATGGTCGTCAAACCCGACAGGTCGCTGCTTTGTGATGGCTCCGGGGCTCCCGTGGATTCACCCAAAGGAGCGAATGGCAATCTGATCAACAGGGATACCTCTGATATGGATGCCAAGCAGCTAGATTCCTCCGATTGCAGTGATCATAACATGGATGAACAGGAGGAGAAGGATCAAGCAACACGAAACGGAGCCGGAAGGACGGTGTCCAAAAATCTAGTCTCTGAGCGGAAACGAAGAAAAAAACTCAATGATGGTCTTTACACTCTGCGTGCCCTTGTTCCGAAAATTAGCAAGATGGACAAGGCATCAATTGTGGGTGATGCTATTGACTATGTGCGCGAGTTACAAAAGCAGGTTGAAGAGTTGCAGGCTGATATATCTGACATTGAATCAACCAAGCCTACAACCGGACCTGGAGGTGAAGCGTCATTATCATCTGTGGCAGAGCCAAGTACGGCTCAGGGTTCCACAGCTCCATCCAGCGGTCGTTCTTGGGAGGAAGAAGGCCACAGAACGTCTGAGGGTCAGCCTCGTCAAGAAATGAGCGAAGCTCCGTTTGAGGATACAACAGAACAGAAAATTCTCGAGTTGGATGTTGCGAAGATGGAAGAGCAGATCTATCATCTCCGAATCTTTTGTACCAAAGGACCCGGTGTATTTGTGCAATTGATGCAATCTTTGGAGGCCTTGGGTCTTGAAATACGCAATGCCAATCTGACATCATTCCAAGAAAATTTACTGAACACCTTCATTGCAGAGATCAAAGACTGGGAGATGATGAAGACCGAAGAGGTTAAGAAGGCCATTCTGGATGTGGCTGCTCGTTTTGGTCTGCAACCTTAA

Protein

>Mapoly0028s0100.1
MDKKPLIIPGDNRLDSSQNLHHSVLVGAAHEMFQSGHGLGTSSNMTPGSMCNLHPPLSSFGAESNLHELLAHASPHAGSHAQSLNHSSNHPADFLATLGDGVLGESSDNHMFHRQMEFSKQKWTTPSKLTPGPFWMLPHHLDPANYPLPGLAVSGTSSPKTNVGPSAGEDSSNPNRQVWCERGANQVLMKSEDNVATLKLPMVVKPDRSLLCDGSGAPVDSPKGANGNLINRDTSDMDAKQLDSSDCSDHNMDEQEEKDQATRNGAGRTVSKNLVSERKRRKKLNDGLYTLRALVPKISKMDKASIVGDAIDYVRELQKQVEELQADISDIESTKPTTGPGGEASLSSVAEPSTAQGSTAPSSGRSWEEEGHRTSEGQPRQEMSEAPFEDTTEQKILELDVAKMEEQIYHLRIFCTKGPGVFVQLMQSLEALGLEIRNANLTSFQENLLNTFIAEIKDWEMMKTEEVKKAILDVAARFGLQP

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>