Mapoly0028s0101



Description

NAI1, DNA BINDING / TRANSCRIPTION FACTOR

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_162137
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR23042 CIRCADIAN PROTEIN CLOCK/ARNT/BMAL/PAS
PANTHER PTHR23042:SF25 NAI1, DNA BINDING / TRANSCRIPTION FACTOR

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH47 transcription factor, bHLH Mapoly0028s0101.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0028s0101.1 scaffold_28:1149742..1155318  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0028s0101.2 scaffold_28:1149742..1156115  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0028s0101.3 scaffold_28:1149742..1154265  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0028s0101.4 scaffold_28:1149742..1154265  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0028s0101.1  

Gene structure:

mRNA scaffold_28:1149742..1155318  ( + strand )
five_prime_UTR scaffold_28:1149742..1150370  ( + strand )
CDS scaffold_28:1150371..1151159  ( + strand )
CDS scaffold_28:1151390..1151845  ( + strand )
CDS scaffold_28:1152922..1152996  ( + strand )
three_prime_UTR scaffold_28:1152997..1153053  ( + strand )
three_prime_UTR scaffold_28:1153858..1155318  ( + strand )

Sequences:

Gene

>Mapoly0028s0101.1
GCAACAGCTGCAGCGTTCCGGTCCCGATTCGAGGGCGAGGTCCTCAATACTGCGTCTGGTTCCGAGGCCCGGGAGCAGATGCAAGCAGGCGAGCGAGCATGGTTGCACCGTGGCAGGCAAGCCTCCCTCTAGCGTTTTCGGCGCCTCACCGGTGACTGGTTGGGCCGGCTGGGGTTGGACTGGACTTGTCCGTAAGAGGCTCGATCGTTGGCCCGCTGGCTGGCTGGCTGGCTGGCTGGACGCAATCGAAACGTGGCGAGCACTATATCTGGTCATCAGTCCGTCTGCCTTCGTCTGAGAGCGATGGAAGGAGTAAGGGGCTGATTGTGCGATTTCGGCTTTCTCGGATTTTCGCTGGATGCCTTGATTGATCGTGAGGCAGAAAAGATTTCGATCCATTAGCGTTCGCATTTTGGACTTCGGACCGATGGTGGTGGTTTTTTGCAATGTGCTTGTAAATTGTCGTCGGATAACCTTTTCTGCAAGCCGATCAGCTGGTCCTGGTCCGAGCCGCTGTTGATGCCGTGTTGCGGTCTGTTCGCATATCTGGCCCCGCGAACACGGTCTTGGTTTTGTTGACGTGCGTTCTCTTCTCAGACGCATCGTCCGGAGCGCGAGAGCTCGTCAAGATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGGTATCCATTATTAGTCATTTGTCTCGGCGATGTCAGATTTCTAGCCTGAATGGGATGCGATGGAACAGTTTCCCACTTGCAGCAGATGCGAACTTGCTTGATGCCTGCTTGCGGTCCATGACAAAAGTGCTTTCCATGCTAGAGAGACACAGTCCCTGCAGGCTGTAACGGGTTTCTGTTGTCGTTTCTGAAATCTGTGCTGATTGGGTAACTCGTGTTTGGACTTGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGGTTAGTACATATTTTGGCCTCATCCCAAACATGTCATATGTCCGATACCTGTGCACGTGAAATAGGATCGTTTTACTTAGAGTCCACTATTCATAGCGTTTAGTCAAGCCGAATGTCAATATATCTCACAGAAAATCAGGCATCATTAGAGCTGGTCCGGCTGTCATATTTCTTGTTATTCCATGATACGATAACAATTTGGAGCCATTCCGGGTTGGGTCTTTTGTTAACAAGTTAAATAATCGTTAAAAAGAAGAATTAGCGAATTGAATATTGTAGATACACAAGGTGCTTGAGTTTAAAAGAAGTGAATTTTGTTACATCAATCTCTATAATTTAAACCGCGAGGCTCGAAGCTCAGCTGTTGCAATTGCGACTGCTATCTAGATGATGACGTATTTCATGTTTGCTACAAGTTATGAAGTCAAACTAGAAAACCAAAATTGAAAACCAGTGTAGCGTATACAGAGCAGAGTCCAGGTTGTTCAAAAAAGACGCCTTGGTTTGATGAACTTCTCCTCGTGATGATTGTTACAACATCTAAATTTGTCATAAGAACCTAGAGTTCTTTCACACTTGTGCTTCTCTCACACCACATCCCCGACAAACTGTCCATTTCGTACCTAAGGCAGGTACGTATAACACCCTTTGGCACGGGAATAGCAAATTCAACTTACCTTCAGTGAGCTTTCCACCGTAGGTACGCCTACCACCAACCTGATTTTGTTCATTCTCACTCATTTGCTAGCTTAGTAGTAGTCGATAATCTCTTTTACCCTGACTTCTAAAAACCATCTTCGCCGACAACTCACAAACTGCTGCATTCGTGGTGTCTACGTGAGTGCAGATGAGTGTCGGAAAAGTTCCTGCTATTGAGGGGTGAGGTAGAGCAATGAACAGCAACATGCGCTGTTAGCCTGTTAAGCAGTGCATCATGTGATATCCCCCACTGCAATAGCGTTTCATCGGTCGGTGGTCCGGTTTGTATTTCTCTTTTGATCTGAGTGCTTAAGCAAAATTTTTATACGCAAGGGAGCGGTCTTCACACCTGTAATGTCCTTTGTGGTTATGTGCAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGATGGAGAAGTATTCCTGATGGCAATGGATGCACACGGCTGATGAAGGATTCTGAGATGGTACCATGTTCTCCTCTTTATCCAAGTGGTTGTTGTAGAATACAATACCTACTTCTTGTCAAGTTCATTGTGGTAGCTCTTTAACAAGCGTTTCCAGTAAAGGTGCTCTAACTAACTGATTAGAGCATCATCCTTGTATCTAACTCCTGAAACTGATCCATCTGCCATGCGTATATCGCCGCTTCATCCCATACTCACTCGCAGGGGTCACATGTAGTTTCTGCTGTAAGTTTCACCTGTTATGACACTGCTGACCACGTTGCCAGTTCTAGCATTGCTCGGCAAGTAAGGAGTCCAGATTGGCCTTTACTTCTGAGTACGGTGACCCGAGAGAATTTTGTGATGACAGGAGATGTACAGATACCTTGAGCAATGTGAGAGTGAGCAACTACCGCAACCCTCATCGTTTATTTGCTAGATCCCCAAAGCTCTGACCTGCAAGTGTCCCGACAAAGATGATGCCAGGATCTTTAGATACTGCTCTATTCTTGTGGACGTAGTGGCACGTGTTTGACAAAAATCAACGCGCTTTTCCATAGGAAGCAGATAAAGATTGTGGACGGTGTATATTAACTTTTGCTCCAGTGTAAATGAATCGATGTACGGGCTTTCCTTGTCCCTTTGGTATGTGTGTACTCATGGAAAATGTCTGCAGTGAAGTAATTTCGCTGTAGAGCAGATGCTATTCGCCGAGACCATCGAGCGCAGAACCGAAAGGCAGATGAGCCTAGCTGAGAAGATTCTGGATAGTATCATAATCCAACATTCTTATAGTGAACAATTCTCTTGTATGTTTGTATGAAGGTAAGCAATTCTCCGGAGCAAGCTCAACATATTCATCTTTGCAAAATGAGACCAGCGTTGAAGACATATGTTTCTACTTGACTTTCCCTCTTTGGCAAGTGCAGAATTCTTTACCTTATATCCTTGCTCTGCATATGATGATAATGCTAAATGTTATATTCGTTATTTCATTGACGTAGATTTCTTGGTGGGTAAATTATGCAACTCTTGCAAGGAGGTTGTTAGTCTTTCGTTGTCATGCGTGGGGATGGTTGAACTGTCCAGGAACTCAGGCTGTTAGATTGTTGAGTTCTTATTTTAGAGTGTATAGATGATTTGTGTTGTGTTTGCTTAGATGACATGTATCATACTTAAATGTTAGATGTTGTTTGGCAGTACAGTTTTGGTTGATGGAAATTTTTAATAGAGGATATCAAATTTAATCCATGTCAAAATTTCTGGGGACTGAATGAATTATAATTGACTCTTTTCATGACGTGGAAATCTTGGTCATTTGTAATGAATAGCTGCACCTGATCATTGAGAATTGAGTGTAAGCTTTGATCTGTTATATTGTGTAAATGGACGTAGATTTTGTCTCACTTAATTACGAACATCATTCTCTAGTTTATCTCGGGGTCTTGAACATCTTGCAAACGGGGCGAGATTGTCACATTGAAACTCAAATTCATTTGTATCAATATATACGAGGAACATTTCAAGTAAATAGAACTTTTCAACAGGCTCACATTCCGAATCAGATGTATTCGATACAAATTATGAGTTAACTAAAGAGAATATAAGTTCAGCTCAGAAAGGATCGCTTTGAAAATGTATATCTGTAACCATTAGTTCAATTCAAATTATGATAAAAAAGGACAGGATAACGATATATGACTTTCTAAAAAAATGGTGGATCACTACATCATGTTAAAACAACAGTAATTTTCTAAATAAATGGTGGATCACTACATCATGTTTAAACAACAGTAATTTTCTAGAATATTGTCTGATTAAAGACTTAACATAAATAATTCCTAGAAACACAGAAGTTTGTAGAACTGTTTCTATTACGGATACAAAATAGTAACATTGATAGTAACAATTAAACATATGTAACGATGAATAATAACTTAGAACTTTCAAAAAAAAGAAAAAAAAGAAAATGATTCATACTAGTATGAAACATAAACGGAAATATACTCAGATCGTTAAAAATACATGTAACGTTCTAATTTAGTAACGTGGTCATATAAGTAAATTTAATTCTACTTTGATTCAGTCAACCTCAAAAATTTTTGTTGACATTTTTTATCGCATGAAAAATAGATCCTACATTTGATTAGAATTAAATTTCTACGATATTTTAATAAATGTAGAAATATTTTTCTACAATCGCATTCATTGATGCTAAAGTATTTAAAATTTATATTTAATATAAAATTAAATCATAAATAAATTTTTTTTGATTCATTAAAAAAG

mRNA

>Mapoly0028s0101.1
GCAACAGCTGCAGCGTTCCGGTCCCGATTCGAGGGCGAGGTCCTCAATACTGCGTCTGGTTCCGAGGCCCGGGAGCAGATGCAAGCAGGCGAGCGAGCATGGTTGCACCGTGGCAGGCAAGCCTCCCTCTAGCGTTTTCGGCGCCTCACCGGTGACTGGTTGGGCCGGCTGGGGTTGGACTGGACTTGTCCGTAAGAGGCTCGATCGTTGGCCCGCTGGCTGGCTGGCTGGCTGGCTGGACGCAATCGAAACGTGGCGAGCACTATATCTGGTCATCAGTCCGTCTGCCTTCGTCTGAGAGCGATGGAAGGAGTAAGGGGCTGATTGTGCGATTTCGGCTTTCTCGGATTTTCGCTGGATGCCTTGATTGATCGTGAGGCAGAAAAGATTTCGATCCATTAGCGTTCGCATTTTGGACTTCGGACCGATGGTGGTGGTTTTTTGCAATGTGCTTGTAAATTGTCGTCGGATAACCTTTTCTGCAAGCCGATCAGCTGGTCCTGGTCCGAGCCGCTGTTGATGCCGTGTTGCGGTCTGTTCGCATATCTGGCCCCGCGAACACGGTCTTGGTTTTGTTGACGTGCGTTCTCTTCTCAGACGCATCGTCCGGAGCGCGAGAGCTCGTCAAGATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGATGGAGAAGTATTCCTGATGGCAATGGATGCACACGGCTGATGAAGGATTCTGAGATGGTAAGCAATTCTCCGGAGCAAGCTCAACATATTCATCTTTGCAAAATGAGACCAGCGTTGAAGACATATGTTTCTACTTGACTTTCCCTCTTTGGCAAGTGCAGAATTCTTTACCTTATATCCTTGCTCTGCATATGATGATAATGCTAAATGTTATATTCGTTATTTCATTGACGTAGATTTCTTGGTGGGTAAATTATGCAACTCTTGCAAGGAGGTTGTTAGTCTTTCGTTGTCATGCGTGGGGATGGTTGAACTGTCCAGGAACTCAGGCTGTTAGATTGTTGAGTTCTTATTTTAGAGTGTATAGATGATTTGTGTTGTGTTTGCTTAGATGACATGTATCATACTTAAATGTTAGATGTTGTTTGGCAGTACAGTTTTGGTTGATGGAAATTTTTAATAGAGGATATCAAATTTAATCCATGTCAAAATTTCTGGGGACTGAATGAATTATAATTGACTCTTTTCATGACGTGGAAATCTTGGTCATTTGTAATGAATAGCTGCACCTGATCATTGAGAATTGAGTGTAAGCTTTGATCTGTTATATTGTGTAAATGGACGTAGATTTTGTCTCACTTAATTACGAACATCATTCTCTAGTTTATCTCGGGGTCTTGAACATCTTGCAAACGGGGCGAGATTGTCACATTGAAACTCAAATTCATTTGTATCAATATATACGAGGAACATTTCAAGTAAATAGAACTTTTCAACAGGCTCACATTCCGAATCAGATGTATTCGATACAAATTATGAGTTAACTAAAGAGAATATAAGTTCAGCTCAGAAAGGATCGCTTTGAAAATGTATATCTGTAACCATTAGTTCAATTCAAATTATGATAAAAAAGGACAGGATAACGATATATGACTTTCTAAAAAAATGGTGGATCACTACATCATGTTAAAACAACAGTAATTTTCTAAATAAATGGTGGATCACTACATCATGTTTAAACAACAGTAATTTTCTAGAATATTGTCTGATTAAAGACTTAACATAAATAATTCCTAGAAACACAGAAGTTTGTAGAACTGTTTCTATTACGGATACAAAATAGTAACATTGATAGTAACAATTAAACATATGTAACGATGAATAATAACTTAGAACTTTCAAAAAAAAGAAAAAAAAGAAAATGATTCATACTAGTATGAAACATAAACGGAAATATACTCAGATCGTTAAAAATACATGTAACGTTCTAATTTAGTAACGTGGTCATATAAGTAAATTTAATTCTACTTTGATTCAGTCAACCTCAAAAATTTTTGTTGACATTTTTTATCGCATGAAAAATAGATCCTACATTTGATTAGAATTAAATTTCTACGATATTTTAATAAATGTAGAAATATTTTTCTACAATCGCATTCATTGATGCTAAAGTATTTAAAATTTATATTTAATATAAAATTAAATCATAAATAAATTTTTTTTGATTCATTAAAAAAG

CDS

>Mapoly0028s0101.1
ATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGA

Protein

>Mapoly0028s0101.1
MCPDVIRGPYSRPGIFFPQETFQKCDSQQGFFNAAFDSLFELHDDRRSALLLSCERAQQQIHDPGNYANYQPMHCDSPPLTEIDTGWMSDVFEGLPVISQEMTHVPVAEISAPFSNYSPFNSPLPVSLDLLSSEAEEGQSNQQSSPTCAGAVPLPLDIDQTGPICPDSNHSVLEAAAFSPPCPQSLGATSPPAAAVVPKPLKARGSKRCDRGQQKPKRMPKWAREVTLAPSEQVEHVLRERQRRDDMSCKIAILEGLLPPCPKRDRASIVHDSVQYVKSLQQGVEELQKKLVALKRSNGSPATTITTTITTTQISSLPQLAKATSPSSSPARDSTSPAIDAGVEDTETVPPKLFHLVEFHVQLEGCSEAAKLTRCKCRSDYLSSTMRVLEQLNVEVSRCSVTKMFDHFMCVIVAKPRVSAVPAPTSTSIATSLKKAVEL

Mapoly0028s0101.2  

Gene structure:

mRNA scaffold_28:1149742..1156115  ( + strand )
five_prime_UTR scaffold_28:1149742..1150370  ( + strand )
CDS scaffold_28:1150371..1151159  ( + strand )
CDS scaffold_28:1151390..1151845  ( + strand )
CDS scaffold_28:1152922..1152996  ( + strand )
three_prime_UTR scaffold_28:1152997..1153053  ( + strand )
three_prime_UTR scaffold_28:1153858..1153951  ( + strand )
three_prime_UTR scaffold_28:1155646..1156115  ( + strand )

Sequences:

Gene

>Mapoly0028s0101.2
GCAACAGCTGCAGCGTTCCGGTCCCGATTCGAGGGCGAGGTCCTCAATACTGCGTCTGGTTCCGAGGCCCGGGAGCAGATGCAAGCAGGCGAGCGAGCATGGTTGCACCGTGGCAGGCAAGCCTCCCTCTAGCGTTTTCGGCGCCTCACCGGTGACTGGTTGGGCCGGCTGGGGTTGGACTGGACTTGTCCGTAAGAGGCTCGATCGTTGGCCCGCTGGCTGGCTGGCTGGCTGGCTGGACGCAATCGAAACGTGGCGAGCACTATATCTGGTCATCAGTCCGTCTGCCTTCGTCTGAGAGCGATGGAAGGAGTAAGGGGCTGATTGTGCGATTTCGGCTTTCTCGGATTTTCGCTGGATGCCTTGATTGATCGTGAGGCAGAAAAGATTTCGATCCATTAGCGTTCGCATTTTGGACTTCGGACCGATGGTGGTGGTTTTTTGCAATGTGCTTGTAAATTGTCGTCGGATAACCTTTTCTGCAAGCCGATCAGCTGGTCCTGGTCCGAGCCGCTGTTGATGCCGTGTTGCGGTCTGTTCGCATATCTGGCCCCGCGAACACGGTCTTGGTTTTGTTGACGTGCGTTCTCTTCTCAGACGCATCGTCCGGAGCGCGAGAGCTCGTCAAGATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGGTATCCATTATTAGTCATTTGTCTCGGCGATGTCAGATTTCTAGCCTGAATGGGATGCGATGGAACAGTTTCCCACTTGCAGCAGATGCGAACTTGCTTGATGCCTGCTTGCGGTCCATGACAAAAGTGCTTTCCATGCTAGAGAGACACAGTCCCTGCAGGCTGTAACGGGTTTCTGTTGTCGTTTCTGAAATCTGTGCTGATTGGGTAACTCGTGTTTGGACTTGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGGTTAGTACATATTTTGGCCTCATCCCAAACATGTCATATGTCCGATACCTGTGCACGTGAAATAGGATCGTTTTACTTAGAGTCCACTATTCATAGCGTTTAGTCAAGCCGAATGTCAATATATCTCACAGAAAATCAGGCATCATTAGAGCTGGTCCGGCTGTCATATTTCTTGTTATTCCATGATACGATAACAATTTGGAGCCATTCCGGGTTGGGTCTTTTGTTAACAAGTTAAATAATCGTTAAAAAGAAGAATTAGCGAATTGAATATTGTAGATACACAAGGTGCTTGAGTTTAAAAGAAGTGAATTTTGTTACATCAATCTCTATAATTTAAACCGCGAGGCTCGAAGCTCAGCTGTTGCAATTGCGACTGCTATCTAGATGATGACGTATTTCATGTTTGCTACAAGTTATGAAGTCAAACTAGAAAACCAAAATTGAAAACCAGTGTAGCGTATACAGAGCAGAGTCCAGGTTGTTCAAAAAAGACGCCTTGGTTTGATGAACTTCTCCTCGTGATGATTGTTACAACATCTAAATTTGTCATAAGAACCTAGAGTTCTTTCACACTTGTGCTTCTCTCACACCACATCCCCGACAAACTGTCCATTTCGTACCTAAGGCAGGTACGTATAACACCCTTTGGCACGGGAATAGCAAATTCAACTTACCTTCAGTGAGCTTTCCACCGTAGGTACGCCTACCACCAACCTGATTTTGTTCATTCTCACTCATTTGCTAGCTTAGTAGTAGTCGATAATCTCTTTTACCCTGACTTCTAAAAACCATCTTCGCCGACAACTCACAAACTGCTGCATTCGTGGTGTCTACGTGAGTGCAGATGAGTGTCGGAAAAGTTCCTGCTATTGAGGGGTGAGGTAGAGCAATGAACAGCAACATGCGCTGTTAGCCTGTTAAGCAGTGCATCATGTGATATCCCCCACTGCAATAGCGTTTCATCGGTCGGTGGTCCGGTTTGTATTTCTCTTTTGATCTGAGTGCTTAAGCAAAATTTTTATACGCAAGGGAGCGGTCTTCACACCTGTAATGTCCTTTGTGGTTATGTGCAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGATGGAGAAGTATTCCTGATGGCAATGGATGCACACGGCTGATGAAGGATTCTGAGATGGTACCATGTTCTCCTCTTTATCCAAGTGGTTGTTGTAGAATACAATACCTACTTCTTGTCAAGTTCATTGTGGTAGCTCTTTAACAAGCGTTTCCAGTAAAGGTGCTCTAACTAACTGATTAGAGCATCATCCTTGTATCTAACTCCTGAAACTGATCCATCTGCCATGCGTATATCGCCGCTTCATCCCATACTCACTCGCAGGGGTCACATGTAGTTTCTGCTGTAAGTTTCACCTGTTATGACACTGCTGACCACGTTGCCAGTTCTAGCATTGCTCGGCAAGTAAGGAGTCCAGATTGGCCTTTACTTCTGAGTACGGTGACCCGAGAGAATTTTGTGATGACAGGAGATGTACAGATACCTTGAGCAATGTGAGAGTGAGCAACTACCGCAACCCTCATCGTTTATTTGCTAGATCCCCAAAGCTCTGACCTGCAAGTGTCCCGACAAAGATGATGCCAGGATCTTTAGATACTGCTCTATTCTTGTGGACGTAGTGGCACGTGTTTGACAAAAATCAACGCGCTTTTCCATAGGAAGCAGATAAAGATTGTGGACGGTGTATATTAACTTTTGCTCCAGTGTAAATGAATCGATGTACGGGCTTTCCTTGTCCCTTTGGTATGTGTGTACTCATGGAAAATGTCTGCAGTGAAGTAATTTCGCTGTAGAGCAGATGCTATTCGCCGAGACCATCGAGCGCAGAACCGAAAGGCAGATGAGCCTAGCTGAGAAGATTCTGGATAGTATCATAATCCAACATTCTTATAGTGAACAATTCTCTTGTATGTTTGTATGAAGGTAAGCAATTCTCCGGAGCAAGCTCAACATATTCATCTTTGCAAAATGAGACCAGCGTTGAAGACATATGTTTCTACTTGACTTTCCCTCTTTGGCAAGTGCAGAATTCTTTACCTTATATCCTTGCTCTGCATATGATGATAATGCTAAATGTTATATTCGTTATTTCATTGACGTAGATTTCTTGGTGGGTAAATTATGCAACTCTTGCAAGGAGGTTGTTAGTCTTTCGTTGTCATGCGTGGGGATGGTTGAACTGTCCAGGAACTCAGGCTGTTAGATTGTTGAGTTCTTATTTTAGAGTGTATAGATGATTTGTGTTGTGTTTGCTTAGATGACATGTATCATACTTAAATGTTAGATGTTGTTTGGCAGTACAGTTTTGGTTGATGGAAATTTTTAATAGAGGATATCAAATTTAATCCATGTCAAAATTTCTGGGGACTGAATGAATTATAATTGACTCTTTTCATGACGTGGAAATCTTGGTCATTTGTAATGAATAGCTGCACCTGATCATTGAGAATTGAGTGTAAGCTTTGATCTGTTATATTGTGTAAATGGACGTAGATTTTGTCTCACTTAATTACGAACATCATTCTCTAGTTTATCTCGGGGTCTTGAACATCTTGCAAACGGGGCGAGATTGTCACATTGAAACTCAAATTCATTTGTATCAATATATACGAGGAACATTTCAAGTAAATAGAACTTTTCAACAGGCTCACATTCCGAATCAGATGTATTCGATACAAATTATGAGTTAACTAAAGAGAATATAAGTTCAGCTCAGAAAGGATCGCTTTGAAAATGTATATCTGTAACCATTAGTTCAATTCAAATTATGATAAAAAAGGACAGGATAACGATATATGACTTTCTAAAAAAATGGTGGATCACTACATCATGTTAAAACAACAGTAATTTTCTAAATAAATGGTGGATCACTACATCATGTTTAAACAACAGTAATTTTCTAGAATATTGTCTGATTAAAGACTTAACATAAATAATTCCTAGAAACACAGAAGTTTGTAGAACTGTTTCTATTACGGATACAAAATAGTAACATTGATAGTAACAATTAAACATATGTAACGATGAATAATAACTTAGAACTTTCAAAAAAAAGAAAAAAAAGAAAATGATTCATACTAGTATGAAACATAAACGGAAATATACTCAGATCGTTAAAAATACATGTAACGTTCTAATTTAGTAACGTGGTCATATAAGTAAATTTAATTCTACTTTGATTCAGTCAACCTCAAAAATTTTTGTTGACATTTTTTATCGCATGAAAAATAGATCCTACATTTGATTAGAATTAAATTTCTACGATATTTTAATAAATGTAGAAATATTTTTCTACAATCGCATTCATTGATGCTAAAGTATTTAAAATTTATATTTAATATAAAATTAAATCATAAATAAATTTTTTTTGATTCATTAAAAAAGAATTTTTGAAATGTGACCTAATTTCAAAAAATAGATTGAAAATTTTAATTAAAATTTTTACTTAAAAAAAGAATAAGAAATAAAATTTAACAAATACTATTATATCCAAGAATATTAGATATATTTATTTTATAAAAATTTAAAAAATAAAATAAAATAAATAAAATAATTATAGAAAAGAGAGAACAATATGAGACCGAACACATTACGAACCATATCATGAATATTTGCTTTGCGACAGAAAAGGTTTCGGATCTGCTTCCGATGACAATTTGTAGTCGCAATAAATGTCTTGGTGACTAAGAGAGACATGTCTGTATGATGCAGGAGGTTGATGAATACACTGCCGTTTGTGGTGAAATATGGAGATGAATGTTGAGTGAGTTTTCATTTCGAAAGAGAATAATGTCAACTGTACATTGTTTTCATCAAGAACCGTACTCGAGCAAGCAGAATAAATCAGTCATATCCCATATTTCAGCAACTCTACTTATTATTGAGGTTGCAGATAAATTTCTCTAGCGATTACTTATTAACTGGTTGTTGGATGTCATTAAGAGCCATCCGCAGGGGCAGCTTCATACAGTTCTATGTTTCCATTCAAAGTTTGAAGGAGTTATTATAGGAAATAATACTGTCCGAAATTTTCGCCCACTCCGGTTATTCTCAATCAGCTCGACTTTCGCGCATTGTTTCATGTCGGTTTTGTCTTGTTATTCTCAATGTTTCATCCACTTGAACTTACTTTCATCCTCAGAAATTAAATTTATTCACAATGATCTATTTTTTGAAAATTT

mRNA

>Mapoly0028s0101.2
GCAACAGCTGCAGCGTTCCGGTCCCGATTCGAGGGCGAGGTCCTCAATACTGCGTCTGGTTCCGAGGCCCGGGAGCAGATGCAAGCAGGCGAGCGAGCATGGTTGCACCGTGGCAGGCAAGCCTCCCTCTAGCGTTTTCGGCGCCTCACCGGTGACTGGTTGGGCCGGCTGGGGTTGGACTGGACTTGTCCGTAAGAGGCTCGATCGTTGGCCCGCTGGCTGGCTGGCTGGCTGGCTGGACGCAATCGAAACGTGGCGAGCACTATATCTGGTCATCAGTCCGTCTGCCTTCGTCTGAGAGCGATGGAAGGAGTAAGGGGCTGATTGTGCGATTTCGGCTTTCTCGGATTTTCGCTGGATGCCTTGATTGATCGTGAGGCAGAAAAGATTTCGATCCATTAGCGTTCGCATTTTGGACTTCGGACCGATGGTGGTGGTTTTTTGCAATGTGCTTGTAAATTGTCGTCGGATAACCTTTTCTGCAAGCCGATCAGCTGGTCCTGGTCCGAGCCGCTGTTGATGCCGTGTTGCGGTCTGTTCGCATATCTGGCCCCGCGAACACGGTCTTGGTTTTGTTGACGTGCGTTCTCTTCTCAGACGCATCGTCCGGAGCGCGAGAGCTCGTCAAGATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGATGGAGAAGTATTCCTGATGGCAATGGATGCACACGGCTGATGAAGGATTCTGAGATGGTAAGCAATTCTCCGGAGCAAGCTCAACATATTCATCTTTGCAAAATGAGACCAGCGTTGAAGACATATGTTTCTACTTGACTTTCCCTCTTTGGAGGTTGATGAATACACTGCCGTTTGTGGTGAAATATGGAGATGAATGTTGAGTGAGTTTTCATTTCGAAAGAGAATAATGTCAACTGTACATTGTTTTCATCAAGAACCGTACTCGAGCAAGCAGAATAAATCAGTCATATCCCATATTTCAGCAACTCTACTTATTATTGAGGTTGCAGATAAATTTCTCTAGCGATTACTTATTAACTGGTTGTTGGATGTCATTAAGAGCCATCCGCAGGGGCAGCTTCATACAGTTCTATGTTTCCATTCAAAGTTTGAAGGAGTTATTATAGGAAATAATACTGTCCGAAATTTTCGCCCACTCCGGTTATTCTCAATCAGCTCGACTTTCGCGCATTGTTTCATGTCGGTTTTGTCTTGTTATTCTCAATGTTTCATCCACTTGAACTTACTTTCATCCTCAGAAATTAAATTTATTCACAATGATCTATTTTTTGAAAATTT

CDS

>Mapoly0028s0101.2
ATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGA

Protein

>Mapoly0028s0101.2
MCPDVIRGPYSRPGIFFPQETFQKCDSQQGFFNAAFDSLFELHDDRRSALLLSCERAQQQIHDPGNYANYQPMHCDSPPLTEIDTGWMSDVFEGLPVISQEMTHVPVAEISAPFSNYSPFNSPLPVSLDLLSSEAEEGQSNQQSSPTCAGAVPLPLDIDQTGPICPDSNHSVLEAAAFSPPCPQSLGATSPPAAAVVPKPLKARGSKRCDRGQQKPKRMPKWAREVTLAPSEQVEHVLRERQRRDDMSCKIAILEGLLPPCPKRDRASIVHDSVQYVKSLQQGVEELQKKLVALKRSNGSPATTITTTITTTQISSLPQLAKATSPSSSPARDSTSPAIDAGVEDTETVPPKLFHLVEFHVQLEGCSEAAKLTRCKCRSDYLSSTMRVLEQLNVEVSRCSVTKMFDHFMCVIVAKPRVSAVPAPTSTSIATSLKKAVEL

Mapoly0028s0101.3  

Gene structure:

mRNA scaffold_28:1149742..1154265  ( + strand )
five_prime_UTR scaffold_28:1149742..1150370  ( + strand )
CDS scaffold_28:1150371..1151159  ( + strand )
CDS scaffold_28:1151390..1151845  ( + strand )
CDS scaffold_28:1152922..1152996  ( + strand )
three_prime_UTR scaffold_28:1152997..1154265  ( + strand )

Sequences:

Gene

>Mapoly0028s0101.3
GCAACAGCTGCAGCGTTCCGGTCCCGATTCGAGGGCGAGGTCCTCAATACTGCGTCTGGTTCCGAGGCCCGGGAGCAGATGCAAGCAGGCGAGCGAGCATGGTTGCACCGTGGCAGGCAAGCCTCCCTCTAGCGTTTTCGGCGCCTCACCGGTGACTGGTTGGGCCGGCTGGGGTTGGACTGGACTTGTCCGTAAGAGGCTCGATCGTTGGCCCGCTGGCTGGCTGGCTGGCTGGCTGGACGCAATCGAAACGTGGCGAGCACTATATCTGGTCATCAGTCCGTCTGCCTTCGTCTGAGAGCGATGGAAGGAGTAAGGGGCTGATTGTGCGATTTCGGCTTTCTCGGATTTTCGCTGGATGCCTTGATTGATCGTGAGGCAGAAAAGATTTCGATCCATTAGCGTTCGCATTTTGGACTTCGGACCGATGGTGGTGGTTTTTTGCAATGTGCTTGTAAATTGTCGTCGGATAACCTTTTCTGCAAGCCGATCAGCTGGTCCTGGTCCGAGCCGCTGTTGATGCCGTGTTGCGGTCTGTTCGCATATCTGGCCCCGCGAACACGGTCTTGGTTTTGTTGACGTGCGTTCTCTTCTCAGACGCATCGTCCGGAGCGCGAGAGCTCGTCAAGATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGGTATCCATTATTAGTCATTTGTCTCGGCGATGTCAGATTTCTAGCCTGAATGGGATGCGATGGAACAGTTTCCCACTTGCAGCAGATGCGAACTTGCTTGATGCCTGCTTGCGGTCCATGACAAAAGTGCTTTCCATGCTAGAGAGACACAGTCCCTGCAGGCTGTAACGGGTTTCTGTTGTCGTTTCTGAAATCTGTGCTGATTGGGTAACTCGTGTTTGGACTTGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGGTTAGTACATATTTTGGCCTCATCCCAAACATGTCATATGTCCGATACCTGTGCACGTGAAATAGGATCGTTTTACTTAGAGTCCACTATTCATAGCGTTTAGTCAAGCCGAATGTCAATATATCTCACAGAAAATCAGGCATCATTAGAGCTGGTCCGGCTGTCATATTTCTTGTTATTCCATGATACGATAACAATTTGGAGCCATTCCGGGTTGGGTCTTTTGTTAACAAGTTAAATAATCGTTAAAAAGAAGAATTAGCGAATTGAATATTGTAGATACACAAGGTGCTTGAGTTTAAAAGAAGTGAATTTTGTTACATCAATCTCTATAATTTAAACCGCGAGGCTCGAAGCTCAGCTGTTGCAATTGCGACTGCTATCTAGATGATGACGTATTTCATGTTTGCTACAAGTTATGAAGTCAAACTAGAAAACCAAAATTGAAAACCAGTGTAGCGTATACAGAGCAGAGTCCAGGTTGTTCAAAAAAGACGCCTTGGTTTGATGAACTTCTCCTCGTGATGATTGTTACAACATCTAAATTTGTCATAAGAACCTAGAGTTCTTTCACACTTGTGCTTCTCTCACACCACATCCCCGACAAACTGTCCATTTCGTACCTAAGGCAGGTACGTATAACACCCTTTGGCACGGGAATAGCAAATTCAACTTACCTTCAGTGAGCTTTCCACCGTAGGTACGCCTACCACCAACCTGATTTTGTTCATTCTCACTCATTTGCTAGCTTAGTAGTAGTCGATAATCTCTTTTACCCTGACTTCTAAAAACCATCTTCGCCGACAACTCACAAACTGCTGCATTCGTGGTGTCTACGTGAGTGCAGATGAGTGTCGGAAAAGTTCCTGCTATTGAGGGGTGAGGTAGAGCAATGAACAGCAACATGCGCTGTTAGCCTGTTAAGCAGTGCATCATGTGATATCCCCCACTGCAATAGCGTTTCATCGGTCGGTGGTCCGGTTTGTATTTCTCTTTTGATCTGAGTGCTTAAGCAAAATTTTTATACGCAAGGGAGCGGTCTTCACACCTGTAATGTCCTTTGTGGTTATGTGCAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGATGGAGAAGTATTCCTGATGGCAATGGATGCACACGGCTGATGAAGGATTCTGAGATGGTACCATGTTCTCCTCTTTATCCAAGTGGTTGTTGTAGAATACAATACCTACTTCTTGTCAAGTTCATTGTGGTAGCTCTTTAACAAGCGTTTCCAGTAAAGGTGCTCTAACTAACTGATTAGAGCATCATCCTTGTATCTAACTCCTGAAACTGATCCATCTGCCATGCGTATATCGCCGCTTCATCCCATACTCACTCGCAGGGGTCACATGTAGTTTCTGCTGTAAGTTTCACCTGTTATGACACTGCTGACCACGTTGCCAGTTCTAGCATTGCTCGGCAAGTAAGGAGTCCAGATTGGCCTTTACTTCTGAGTACGGTGACCCGAGAGAATTTTGTGATGACAGGAGATGTACAGATACCTTGAGCAATGTGAGAGTGAGCAACTACCGCAACCCTCATCGTTTATTTGCTAGATCCCCAAAGCTCTGACCTGCAAGTGTCCCGACAAAGATGATGCCAGGATCTTTAGATACTGCTCTATTCTTGTGGACGTAGTGGCACGTGTTTGACAAAAATCAACGCGCTTTTCCATAGGAAGCAGATAAAGATTGTGGACGGTGTATATTAACTTTTGCTCCAGTGTAAATGAATCGATGTACGGGCTTTCCTTGTCCCTTTGGTATGTGTGTACTCATGGAAAATGTCTGCAGTGAAGTAATTTCGCTGTAGAGCAGATGCTATTCGCCGAGACCATCGAGCGCAGAACCGAAAGGCAGATGAGCCTAGCTGAGAAGATTCTGGATAGTATCATAATCCAACATTCTTATAGTGAACAATTCTCTTGTATGTTTGTATGAAGGTAAGCAATTCTCCGGAGCAAGCTCAACATATTCATCTTTGCAAAATGAGACCAGCGTTGAAGACATATGTTTCTACTTGACTTTCCCTCTTTGGCAAGTGCAGAATTCTTTACCTTATATCCTTGCTCTGCATATGATGATAATGCTAAATGTTATATTCGTTATTTCATTGACGTAGATTTCTTGGTGGGTAAATTATGCAACTCTTGCAAGGAGGTTGTTAGTCTTTCGTTGTCATGCGTGGGGATGGTTGAACTGTCCAGGAACTCAGGCTGTTAGATTGTTGAGTTCTTATTTTAGAGTGTATAGATGATTTGTGTTGTGTTTGCTTAGATGACATGTATCATACTTAAATGTTAGATGTTGTTTGGCAGTACAGTTTTGGTTGATGGAAATTTTTAATAGAG

mRNA

>Mapoly0028s0101.3
GCAACAGCTGCAGCGTTCCGGTCCCGATTCGAGGGCGAGGTCCTCAATACTGCGTCTGGTTCCGAGGCCCGGGAGCAGATGCAAGCAGGCGAGCGAGCATGGTTGCACCGTGGCAGGCAAGCCTCCCTCTAGCGTTTTCGGCGCCTCACCGGTGACTGGTTGGGCCGGCTGGGGTTGGACTGGACTTGTCCGTAAGAGGCTCGATCGTTGGCCCGCTGGCTGGCTGGCTGGCTGGCTGGACGCAATCGAAACGTGGCGAGCACTATATCTGGTCATCAGTCCGTCTGCCTTCGTCTGAGAGCGATGGAAGGAGTAAGGGGCTGATTGTGCGATTTCGGCTTTCTCGGATTTTCGCTGGATGCCTTGATTGATCGTGAGGCAGAAAAGATTTCGATCCATTAGCGTTCGCATTTTGGACTTCGGACCGATGGTGGTGGTTTTTTGCAATGTGCTTGTAAATTGTCGTCGGATAACCTTTTCTGCAAGCCGATCAGCTGGTCCTGGTCCGAGCCGCTGTTGATGCCGTGTTGCGGTCTGTTCGCATATCTGGCCCCGCGAACACGGTCTTGGTTTTGTTGACGTGCGTTCTCTTCTCAGACGCATCGTCCGGAGCGCGAGAGCTCGTCAAGATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGATGGAGAAGTATTCCTGATGGCAATGGATGCACACGGCTGATGAAGGATTCTGAGATGGTACCATGTTCTCCTCTTTATCCAAGTGGTTGTTGTAGAATACAATACCTACTTCTTGTCAAGTTCATTGTGGTAGCTCTTTAACAAGCGTTTCCAGTAAAGGTGCTCTAACTAACTGATTAGAGCATCATCCTTGTATCTAACTCCTGAAACTGATCCATCTGCCATGCGTATATCGCCGCTTCATCCCATACTCACTCGCAGGGGTCACATGTAGTTTCTGCTGTAAGTTTCACCTGTTATGACACTGCTGACCACGTTGCCAGTTCTAGCATTGCTCGGCAAGTAAGGAGTCCAGATTGGCCTTTACTTCTGAGTACGGTGACCCGAGAGAATTTTGTGATGACAGGAGATGTACAGATACCTTGAGCAATGTGAGAGTGAGCAACTACCGCAACCCTCATCGTTTATTTGCTAGATCCCCAAAGCTCTGACCTGCAAGTGTCCCGACAAAGATGATGCCAGGATCTTTAGATACTGCTCTATTCTTGTGGACGTAGTGGCACGTGTTTGACAAAAATCAACGCGCTTTTCCATAGGAAGCAGATAAAGATTGTGGACGGTGTATATTAACTTTTGCTCCAGTGTAAATGAATCGATGTACGGGCTTTCCTTGTCCCTTTGGTATGTGTGTACTCATGGAAAATGTCTGCAGTGAAGTAATTTCGCTGTAGAGCAGATGCTATTCGCCGAGACCATCGAGCGCAGAACCGAAAGGCAGATGAGCCTAGCTGAGAAGATTCTGGATAGTATCATAATCCAACATTCTTATAGTGAACAATTCTCTTGTATGTTTGTATGAAGGTAAGCAATTCTCCGGAGCAAGCTCAACATATTCATCTTTGCAAAATGAGACCAGCGTTGAAGACATATGTTTCTACTTGACTTTCCCTCTTTGGCAAGTGCAGAATTCTTTACCTTATATCCTTGCTCTGCATATGATGATAATGCTAAATGTTATATTCGTTATTTCATTGACGTAGATTTCTTGGTGGGTAAATTATGCAACTCTTGCAAGGAGGTTGTTAGTCTTTCGTTGTCATGCGTGGGGATGGTTGAACTGTCCAGGAACTCAGGCTGTTAGATTGTTGAGTTCTTATTTTAGAGTGTATAGATGATTTGTGTTGTGTTTGCTTAGATGACATGTATCATACTTAAATGTTAGATGTTGTTTGGCAGTACAGTTTTGGTTGATGGAAATTTTTAATAGAG

CDS

>Mapoly0028s0101.3
ATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGA

Protein

>Mapoly0028s0101.3
MCPDVIRGPYSRPGIFFPQETFQKCDSQQGFFNAAFDSLFELHDDRRSALLLSCERAQQQIHDPGNYANYQPMHCDSPPLTEIDTGWMSDVFEGLPVISQEMTHVPVAEISAPFSNYSPFNSPLPVSLDLLSSEAEEGQSNQQSSPTCAGAVPLPLDIDQTGPICPDSNHSVLEAAAFSPPCPQSLGATSPPAAAVVPKPLKARGSKRCDRGQQKPKRMPKWAREVTLAPSEQVEHVLRERQRRDDMSCKIAILEGLLPPCPKRDRASIVHDSVQYVKSLQQGVEELQKKLVALKRSNGSPATTITTTITTTQISSLPQLAKATSPSSSPARDSTSPAIDAGVEDTETVPPKLFHLVEFHVQLEGCSEAAKLTRCKCRSDYLSSTMRVLEQLNVEVSRCSVTKMFDHFMCVIVAKPRVSAVPAPTSTSIATSLKKAVEL

Mapoly0028s0101.4  

Gene structure:

mRNA scaffold_28:1149742..1154265  ( + strand )
five_prime_UTR scaffold_28:1149742..1150370  ( + strand )
CDS scaffold_28:1150371..1151159  ( + strand )
CDS scaffold_28:1151390..1151845  ( + strand )
CDS scaffold_28:1152922..1152996  ( + strand )
three_prime_UTR scaffold_28:1152997..1153053  ( + strand )
three_prime_UTR scaffold_28:1153403..1154265  ( + strand )

Sequences:

Gene

>Mapoly0028s0101.4
GCAACAGCTGCAGCGTTCCGGTCCCGATTCGAGGGCGAGGTCCTCAATACTGCGTCTGGTTCCGAGGCCCGGGAGCAGATGCAAGCAGGCGAGCGAGCATGGTTGCACCGTGGCAGGCAAGCCTCCCTCTAGCGTTTTCGGCGCCTCACCGGTGACTGGTTGGGCCGGCTGGGGTTGGACTGGACTTGTCCGTAAGAGGCTCGATCGTTGGCCCGCTGGCTGGCTGGCTGGCTGGCTGGACGCAATCGAAACGTGGCGAGCACTATATCTGGTCATCAGTCCGTCTGCCTTCGTCTGAGAGCGATGGAAGGAGTAAGGGGCTGATTGTGCGATTTCGGCTTTCTCGGATTTTCGCTGGATGCCTTGATTGATCGTGAGGCAGAAAAGATTTCGATCCATTAGCGTTCGCATTTTGGACTTCGGACCGATGGTGGTGGTTTTTTGCAATGTGCTTGTAAATTGTCGTCGGATAACCTTTTCTGCAAGCCGATCAGCTGGTCCTGGTCCGAGCCGCTGTTGATGCCGTGTTGCGGTCTGTTCGCATATCTGGCCCCGCGAACACGGTCTTGGTTTTGTTGACGTGCGTTCTCTTCTCAGACGCATCGTCCGGAGCGCGAGAGCTCGTCAAGATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGGTATCCATTATTAGTCATTTGTCTCGGCGATGTCAGATTTCTAGCCTGAATGGGATGCGATGGAACAGTTTCCCACTTGCAGCAGATGCGAACTTGCTTGATGCCTGCTTGCGGTCCATGACAAAAGTGCTTTCCATGCTAGAGAGACACAGTCCCTGCAGGCTGTAACGGGTTTCTGTTGTCGTTTCTGAAATCTGTGCTGATTGGGTAACTCGTGTTTGGACTTGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGGTTAGTACATATTTTGGCCTCATCCCAAACATGTCATATGTCCGATACCTGTGCACGTGAAATAGGATCGTTTTACTTAGAGTCCACTATTCATAGCGTTTAGTCAAGCCGAATGTCAATATATCTCACAGAAAATCAGGCATCATTAGAGCTGGTCCGGCTGTCATATTTCTTGTTATTCCATGATACGATAACAATTTGGAGCCATTCCGGGTTGGGTCTTTTGTTAACAAGTTAAATAATCGTTAAAAAGAAGAATTAGCGAATTGAATATTGTAGATACACAAGGTGCTTGAGTTTAAAAGAAGTGAATTTTGTTACATCAATCTCTATAATTTAAACCGCGAGGCTCGAAGCTCAGCTGTTGCAATTGCGACTGCTATCTAGATGATGACGTATTTCATGTTTGCTACAAGTTATGAAGTCAAACTAGAAAACCAAAATTGAAAACCAGTGTAGCGTATACAGAGCAGAGTCCAGGTTGTTCAAAAAAGACGCCTTGGTTTGATGAACTTCTCCTCGTGATGATTGTTACAACATCTAAATTTGTCATAAGAACCTAGAGTTCTTTCACACTTGTGCTTCTCTCACACCACATCCCCGACAAACTGTCCATTTCGTACCTAAGGCAGGTACGTATAACACCCTTTGGCACGGGAATAGCAAATTCAACTTACCTTCAGTGAGCTTTCCACCGTAGGTACGCCTACCACCAACCTGATTTTGTTCATTCTCACTCATTTGCTAGCTTAGTAGTAGTCGATAATCTCTTTTACCCTGACTTCTAAAAACCATCTTCGCCGACAACTCACAAACTGCTGCATTCGTGGTGTCTACGTGAGTGCAGATGAGTGTCGGAAAAGTTCCTGCTATTGAGGGGTGAGGTAGAGCAATGAACAGCAACATGCGCTGTTAGCCTGTTAAGCAGTGCATCATGTGATATCCCCCACTGCAATAGCGTTTCATCGGTCGGTGGTCCGGTTTGTATTTCTCTTTTGATCTGAGTGCTTAAGCAAAATTTTTATACGCAAGGGAGCGGTCTTCACACCTGTAATGTCCTTTGTGGTTATGTGCAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGATGGAGAAGTATTCCTGATGGCAATGGATGCACACGGCTGATGAAGGATTCTGAGATGGTACCATGTTCTCCTCTTTATCCAAGTGGTTGTTGTAGAATACAATACCTACTTCTTGTCAAGTTCATTGTGGTAGCTCTTTAACAAGCGTTTCCAGTAAAGGTGCTCTAACTAACTGATTAGAGCATCATCCTTGTATCTAACTCCTGAAACTGATCCATCTGCCATGCGTATATCGCCGCTTCATCCCATACTCACTCGCAGGGGTCACATGTAGTTTCTGCTGTAAGTTTCACCTGTTATGACACTGCTGACCACGTTGCCAGTTCTAGCATTGCTCGGCAAGTAAGGAGTCCAGATTGGCCTTTACTTCTGAGTACGGTGACCCGAGAGAATTTTGTGATGACAGGAGATGTACAGATACCTTGAGCAATGTGAGAGTGAGCAACTACCGCAACCCTCATCGTTTATTTGCTAGATCCCCAAAGCTCTGACCTGCAAGTGTCCCGACAAAGATGATGCCAGGATCTTTAGATACTGCTCTATTCTTGTGGACGTAGTGGCACGTGTTTGACAAAAATCAACGCGCTTTTCCATAGGAAGCAGATAAAGATTGTGGACGGTGTATATTAACTTTTGCTCCAGTGTAAATGAATCGATGTACGGGCTTTCCTTGTCCCTTTGGTATGTGTGTACTCATGGAAAATGTCTGCAGTGAAGTAATTTCGCTGTAGAGCAGATGCTATTCGCCGAGACCATCGAGCGCAGAACCGAAAGGCAGATGAGCCTAGCTGAGAAGATTCTGGATAGTATCATAATCCAACATTCTTATAGTGAACAATTCTCTTGTATGTTTGTATGAAGGTAAGCAATTCTCCGGAGCAAGCTCAACATATTCATCTTTGCAAAATGAGACCAGCGTTGAAGACATATGTTTCTACTTGACTTTCCCTCTTTGGCAAGTGCAGAATTCTTTACCTTATATCCTTGCTCTGCATATGATGATAATGCTAAATGTTATATTCGTTATTTCATTGACGTAGATTTCTTGGTGGGTAAATTATGCAACTCTTGCAAGGAGGTTGTTAGTCTTTCGTTGTCATGCGTGGGGATGGTTGAACTGTCCAGGAACTCAGGCTGTTAGATTGTTGAGTTCTTATTTTAGAGTGTATAGATGATTTGTGTTGTGTTTGCTTAGATGACATGTATCATACTTAAATGTTAGATGTTGTTTGGCAGTACAGTTTTGGTTGATGGAAATTTTTAATAGAG

mRNA

>Mapoly0028s0101.4
GCAACAGCTGCAGCGTTCCGGTCCCGATTCGAGGGCGAGGTCCTCAATACTGCGTCTGGTTCCGAGGCCCGGGAGCAGATGCAAGCAGGCGAGCGAGCATGGTTGCACCGTGGCAGGCAAGCCTCCCTCTAGCGTTTTCGGCGCCTCACCGGTGACTGGTTGGGCCGGCTGGGGTTGGACTGGACTTGTCCGTAAGAGGCTCGATCGTTGGCCCGCTGGCTGGCTGGCTGGCTGGCTGGACGCAATCGAAACGTGGCGAGCACTATATCTGGTCATCAGTCCGTCTGCCTTCGTCTGAGAGCGATGGAAGGAGTAAGGGGCTGATTGTGCGATTTCGGCTTTCTCGGATTTTCGCTGGATGCCTTGATTGATCGTGAGGCAGAAAAGATTTCGATCCATTAGCGTTCGCATTTTGGACTTCGGACCGATGGTGGTGGTTTTTTGCAATGTGCTTGTAAATTGTCGTCGGATAACCTTTTCTGCAAGCCGATCAGCTGGTCCTGGTCCGAGCCGCTGTTGATGCCGTGTTGCGGTCTGTTCGCATATCTGGCCCCGCGAACACGGTCTTGGTTTTGTTGACGTGCGTTCTCTTCTCAGACGCATCGTCCGGAGCGCGAGAGCTCGTCAAGATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGATGGAGAAGTATTCCTGATGGCAATGGATGCACACGGCTGATGAAGGATTCTGAGATGGAGATGTACAGATACCTTGAGCAATGTGAGAGTGAGCAACTACCGCAACCCTCATCGTTTATTTGCTAGATCCCCAAAGCTCTGACCTGCAAGTGTCCCGACAAAGATGATGCCAGGATCTTTAGATACTGCTCTATTCTTGTGGACGTAGTGGCACGTGTTTGACAAAAATCAACGCGCTTTTCCATAGGAAGCAGATAAAGATTGTGGACGGTGTATATTAACTTTTGCTCCAGTGTAAATGAATCGATGTACGGGCTTTCCTTGTCCCTTTGGTATGTGTGTACTCATGGAAAATGTCTGCAGTGAAGTAATTTCGCTGTAGAGCAGATGCTATTCGCCGAGACCATCGAGCGCAGAACCGAAAGGCAGATGAGCCTAGCTGAGAAGATTCTGGATAGTATCATAATCCAACATTCTTATAGTGAACAATTCTCTTGTATGTTTGTATGAAGGTAAGCAATTCTCCGGAGCAAGCTCAACATATTCATCTTTGCAAAATGAGACCAGCGTTGAAGACATATGTTTCTACTTGACTTTCCCTCTTTGGCAAGTGCAGAATTCTTTACCTTATATCCTTGCTCTGCATATGATGATAATGCTAAATGTTATATTCGTTATTTCATTGACGTAGATTTCTTGGTGGGTAAATTATGCAACTCTTGCAAGGAGGTTGTTAGTCTTTCGTTGTCATGCGTGGGGATGGTTGAACTGTCCAGGAACTCAGGCTGTTAGATTGTTGAGTTCTTATTTTAGAGTGTATAGATGATTTGTGTTGTGTTTGCTTAGATGACATGTATCATACTTAAATGTTAGATGTTGTTTGGCAGTACAGTTTTGGTTGATGGAAATTTTTAATAGAG

CDS

>Mapoly0028s0101.4
ATGTGTCCCGACGTGATTAGAGGTCCCTACTCGAGGCCTGGGATTTTCTTCCCGCAAGAAACGTTTCAGAAATGTGATTCCCAACAAGGCTTTTTCAACGCGGCCTTCGATTCCCTCTTCGAGCTGCACGATGACCGGAGGAGCGCTCTTCTTCTGAGCTGTGAGCGAGCGCAGCAGCAGATCCACGACCCTGGCAATTACGCAAATTATCAACCTATGCATTGCGACAGCCCACCCCTGACCGAGATTGACACGGGCTGGATGAGTGATGTTTTCGAGGGTCTACCCGTTATCAGTCAAGAAATGACGCATGTACCCGTGGCGGAGATCTCCGCGCCCTTCTCGAACTATTCGCCGTTCAATTCCCCTCTCCCAGTGTCGCTGGACCTCTTGAGCTCTGAAGCGGAGGAGGGCCAAAGTAATCAGCAGTCGTCCCCGACTTGTGCCGGAGCTGTGCCGTTACCGCTGGACATCGATCAGACGGGTCCAATCTGCCCCGATTCCAATCACTCTGTGCTCGAGGCTGCTGCATTTTCTCCTCCCTGCCCGCAGAGCCTGGGCGCGACGTCTCCTCCCGCTGCTGCTGTTGTCCCCAAACCTTTGAAAGCACGTGGCTCCAAGCGTTGTGACAGAGGGCAGCAAAAGCCAAAGAGAATGCCAAAATGGGCGAGAGAGGTGACCCTCGCTCCTTCCGAACAAGTAGAGCATGTGTTACGGGAACGGCAGCGCAGAGACGACATGAGCTGTAAAATTGCCATTCTGGAGGGGCTACTTCCGCCGTGCCCGAAGCGAGACAGGGCATCCATCGTTCATGACAGTGTTCAGTACGTGAAGAGTTTGCAACAAGGAGTGGAAGAACTGCAGAAGAAGCTCGTCGCCCTGAAGCGGAGCAACGGAAGTCCTGCAACGACTATCACTACGACCATCACGACCACTCAGATCAGCAGCCTTCCTCAGCTAGCCAAGGCTACCAGTCCCAGCAGTTCACCCGCACGTGACTCTACCAGTCCAGCTATCGACGCTGGCGTGGAAGACACGGAAACAGTTCCACCAAAACTGTTCCATCTGGTGGAATTCCACGTCCAGCTGGAGGGTTGCAGTGAGGCAGCGAAATTGACCAGATGCAAATGTCGATCCGACTATTTAAGCAGTACAATGAGAGTGCTCGAGCAACTGAATGTTGAAGTCTCCAGATGCAGTGTGACGAAAATGTTTGATCACTTCATGTGCGTTATTGTCGCCAAGCCACGCGTGTCAGCAGTTCCAGCTCCCACATCAACGTCGATTGCGACCAGTCTCAAGAAAGCTGTTGAACTCTGA

Protein

>Mapoly0028s0101.4
MCPDVIRGPYSRPGIFFPQETFQKCDSQQGFFNAAFDSLFELHDDRRSALLLSCERAQQQIHDPGNYANYQPMHCDSPPLTEIDTGWMSDVFEGLPVISQEMTHVPVAEISAPFSNYSPFNSPLPVSLDLLSSEAEEGQSNQQSSPTCAGAVPLPLDIDQTGPICPDSNHSVLEAAAFSPPCPQSLGATSPPAAAVVPKPLKARGSKRCDRGQQKPKRMPKWAREVTLAPSEQVEHVLRERQRRDDMSCKIAILEGLLPPCPKRDRASIVHDSVQYVKSLQQGVEELQKKLVALKRSNGSPATTITTTITTTQISSLPQLAKATSPSSSPARDSTSPAIDAGVEDTETVPPKLFHLVEFHVQLEGCSEAAKLTRCKCRSDYLSSTMRVLEQLNVEVSRCSVTKMFDHFMCVIVAKPRVSAVPAPTSTSIATSLKKAVEL

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>