Mapoly0029s0022



Description

Zinc knuckle // Plant specific eukaryotic initiation factor 4B

Reference DB

Database ID Description
GO GO:0003676 Nucleic acid binding
GO GO:0008270 Zinc ion binding
OrthoMCL OG5_168503
PFAM PF00098 Zinc knuckle
PFAM PF06273 Plant specific eukaryotic initiation factor 4B
PANTHER PTHR23002 ZINC FINGER CCHC DOMAIN CONTAINING PROTEIN

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpC2H2-6 transcription factor, C2H2-ZnF Mapoly0029s0022.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0029s0022.1 scaffold_29:203628..208973  ( + strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0029s0022.1  

Gene structure:

mRNA scaffold_29:203628..208973  ( + strand )
five_prime_UTR scaffold_29:203628..204050  ( + strand )
five_prime_UTR scaffold_29:204648..204680  ( + strand )
CDS scaffold_29:204681..204785  ( + strand )
CDS scaffold_29:205397..205507  ( + strand )
CDS scaffold_29:206776..206943  ( + strand )
CDS scaffold_29:207456..207722  ( + strand )
CDS scaffold_29:207865..208266  ( + strand )
three_prime_UTR scaffold_29:208267..208973  ( + strand )

Sequences:

Gene

>Mapoly0029s0022.1
GCAGAGGAAAACGCTCCGCGGGCTAACCGCCAAGCTGCCACTAATCGCAATCACGACCGGCTCCGACGAAGGAAGGAGCCGTGCATTAGAGCTCCGCGATTAGGGTAACCCGGTGCCGGGCGTCGCGCTGTTGCGTGCACGCAGAGCGGGTACCGGCCCGGCCCGGCCCGTGGCGACGAGGGCGGAGGAGGGTCGAGGCAGGCAGGCGGGCGGGCGGGCGGGTCCGAGGGAGCAGCTGCCGCTGAAGGCGAGGCGAGGCCGCGAGACCTGACCAGAGGAGACCAGCCACAGCGCACCTCCCTTCCTTCTTCCTTCTTTGAACAACAAGAGTGCCGGAGCGCAGCCGTGAGTCGATTTCTTTTACATATTGCGCGCTTTACTACGCTGCCGCGGCGTTGAGCAATCCTTCCATTGTTCAGTCAGGTGAGCAGCACGCCTTGCGTTTCGAGGGAAAGCATGGCATGAAATGGAATGGAATGGAATGGGCTGGGATGGTTGGGGTGGGGGTGGCAAAGAAGAGCTCGGGACGGGCGGGGAAAAAGATGGAGGGAAGGAGGATCTGGTTAATTCGAGTTTCGGGGCTATTTTTTTCTTCTTCTCGGGGCTCGCATGCTTCCGGGTGTTGCTCGATAGGCTGAGCACGACCGAGTATGAACATGCTTGGGCAGTAGGGGAAATCTCCATATCTTAGCGTAGCCAGCGTCAACGGTTGGGTCCTGATTTGAGAATTGTGGAATCTTGTAGCGTCCGCGGCTGATTGATTGATTGATTGACAGTGACATTCCGGTCAGCAGTTGGCGGTATCGGTTGTTCTTGTTGTTGCTTCTGTTTCTTTTTCCCGTTTCGGCCCGTTCACTCTTCTTTCTTCTGCGCGCGGGGTTTCTGATCTACCCCGTTTTTGTTCTAGGTAGTTGACATTTTTGTTTATTCATCGTTCGCCACGAGGCATGTTGTGGCCTCTGTCTTGTCTCAGAGTCATCTCGATGTTGTTGAATGGTAAGGATTGGATTGTTGTGACAGGTTCTCAAGAAGGAACGTGGAAGTGGAGTGACAATGAGCTACGCAGAGGACGAGGGTTCAGGCAGGCCCAAGCTTAGCCTGCAGCCAAGAGGATCTGGAGCCGATCAAGCACCCTCTACACCTTCCAAAACTAGCAAGGCATAACTACTTTCCGATCTGTATTCCTAGTTTCGACCATCTTAGGTTTCACACTCCAGGTTCTATTTGCGAGATGTAATACCGTAGAGTGCTTGAATGGTTGTACAGACTTCTGTATCTTTCCACCCGTTTCGATCTGCTGCTCAATACCTGCAGGAAGTACCGAGAGCTTGGTACATACTGCTCAGATGTCGATGTTAGCTTTATGATCTTTTATGGTGACGTAGCATGGATGTCGTCGGTTGCTTTAATGATATCTTTCTTCCATCAACGGCATCTTGACCATCCATCTCAGATGCGAAGGTTATAGTCGGATCCTGATTGGCATCACAGTTGTACAGGGTTTCATGGCATAGAACCCTGGCCTACTGGAATGTTGGGGAATAGTACCTGGATGGCGGAGTATGTGACCTGTAGAAATTGAACCCACGTCGAACATCGTGCCTGACTTTACAATCTGAGCTAACTCTGCGTTATTACTCTTCTGCTTTTGGCCCTTTGCTTAAATGAATGTTCATCGTTTTCCTGGAATTTCTGGTTCAATGCGGGTCACACAAGCGATTATTTGGAGAGGAATGACAGTCTTATATCCTGTTTTGTCAAATTTGCAGCCCAACCCTTTTGGTGCGGCACGACCTCGAGAACAAGTAATTGCTGAAAGAGAAGGCAAGAAGGAGACTGAAGTTCTGAGAGAGCAAGCACAAAAGGAATGGAAGCCAAGTGTGAGTACTTTGCTCTGAATCCATGTTTTGTCGACAGCAATTTGGGGCACAAAGCTTTCTGTGGGGAATGATGTGTTGCAAGGTTAGCAGGGCGACCAGTTTTTACCTCACAATTTTCATTGGTAGAAAAGGTTTCTGATTTGCCAATCCGTGAACGATAGTGTAAATCTCGCCTTTCGTGTCCGGAGAAATTGGCAGATTTTGCGAAATTTCGTTTTCCCTATGGAGACGATTTTCAGACAAATGCGGAATGACTAAGCAGATTGTTCAGTTCATCGTTCATAAAAATATTGAAGCCTAGGGTTAATTTCAATCTCATCGTACAGAGTAGGTTCGTTTATCTGAGTCATTATAAGAGAGGTCAACGGTCGAACTTTCAGGACACCCATGTTCCATTAGTTGGATCGTTCTATCCCTGGCATTTCTCCTGTTACCATATTTCCACTGAAGAGGAAAGAACATTCATCCAGCCGAAGAGCCCATGTTATTTCAGTTCTGAAGTAGTACATTGCAAAGAATGAAACTAATCGCAACAATGGCTTGACGAAGCTTTTCAAGCTACCGTCTCGTTGAGACATTCACTTAGCTATCCTCTCCTTGCTCATGTAAGGAGAAGCTTTCAAAGAACGGGCTGGATGATCTGGTGATCTCTTTCAGTATGTGTATGAGTGGCAGTCTGAATTCTTCTGTGAGGTCCTTCGCTTTTTGGTTGCCAGAGAATCGCTTCCTAAACCTTTCAATTCTCTTTTAAATAGAATCAAAAGTAGAAATTATCTACGCTTGGTCTTGTTCATACTTATTCTCACAACAAAGCTTTCCGCTGTATGATATTCCACTGTGGCCCGAGTCGTTTGGTCCTCATGTTCCTCATGGTTAAGTCCTGGAGATTGATCCTTGCGGTTGCGGTTTATGCAGCATAAATCTTGTTCAAATTTAAACTCTAGCTTGTCATTTCGACCACTATAGTTTTGAAATTGTCAGAGGAAGGAGAACAAACCTGTTCTGACCTAGAATCCTGTGCGTTACTTATTTGAAATTTTTCTCAAATGTGTGCTCTGCCTTTGTACGCTAGAAGGGCGGAACTATTAGCGCTTAGTGCCTTGCCTTCAATAACCTAACTTATTGTGTTGAAAATAATTGTAGAACCCATAGTGTTGATGATTTCCCTAGCAGTTTGTGGTGGTTTTTACTTCGGCATGGAGATAGAAATTTTGTTGTTGGTGTGCAGTATAACTGACTTGTGATCCATTTGTCTTTTTCCGTCTCAGATCGTCTTATCAGAGTCTCAACGAGAAGAGAAAAAAGCGGTTGAAGCAGAGCTTGCGTTTGCAAAAAGTGAACTCAAGAAGGAAGTCGATCCTGTCAAATCTAAACTTATGAAAGAGGAAGTTGCGAATATGGAGAAAAAGCTTGAGGAGCTTTTGGCATCTTTTGAGGTACTCCAGCTCTACTTCATCCTCGTTTAGTGTCAGTAGAGTAAATTGTGTATACTTCATCTTGATTCTTAGTTGTTATCCGGGTGGGGTAAGATCAACATCCGGATTTTCAACACCGTTTGAAATTGTCGGACTGCGAATTTCACGAGACCTAGGCTGTCTGAATGGAGAGTTTATCGTAGCGCCTGTTAGATTTGGCCCCTAAAAGGAAGAACGTGCTCTACATGCTCGACTTACAGTTTCCTACACTGTCCAACGCATTGATTTCGATAGGTAGCACTTTGGTGGGCTGGACGCCAGGGTTGTGTCATGCTTGCTGTCAAACATAGGAATGTTGTACTCAACATGCCACCTTCGTGGCATGTTGAGTAGAACAAGTGGATCAAGTTGAGTGCTGGAAATGAGAAACTAAGACCTGTGCCTGTAGTAACGGGTGCCTTGGAAGATAACCGAATTCAATGATTTGTGTTGGCTGTTCAGCAAAGTATTATAATATATCTTCTGGCATGCAGAAAATGGCAGTCCAAACCGCTCAGACCGGTGGTCTAAGACGCCCATACGAAAAGAGGAGAGACGATGAGCGATTACCTGCAGCTGCCTTGCCTGTCGGGGGCGGTTATGGCGGGGTTGAAAGTCACGATAGTTATAACAACTTTGGTAGGAGCAAAGATCGTGACTCTGACAGGGTAGGATCTTATGGTGATACCTGGAGTGCCAAAGGAGGCGGTGGTGCCGGAGGTGGCAAGGGTGCTGGCTCACAGTGTTTCAGTTGTGGAGAGGTATAAACGTGCTGCTTGGCTCAGACGTTTGGACGTCGTTTTGCTTGATACTTTTAGTTTGTGACGTCTTGTCAAAACCTGACCTCTTGCTTGCATGTTTTTTTACATACGAGCTTCTGACACGAGTGTTGAGTTTTGGCAGATGGGACACTTTTCGCGGGAATGCCCAAGTGGAGGAGTCGGTGGTGGTAGAGGAGGGTATGGAGGTAACTTTGGAGGCGGAGGTGGCAGGAGTGGATCGCGCGCTTGTTATACCTGTGGCCAAGAGGGTCACATCTCTCGGGAATGTCCGCAGGCCGGAAGTGGAGGATATGGAGCCCGTGGGGGTGGCGGTTATGGTTCTGCCGGGGGTAGCTATGGCGCGTCATACGGTGGAGGTTATGGTAGCAGTGCCCCAGATTATGACACTGGAGCATCTTATGGCCCAGCTAGTCAAGGGGGAGGTGCTTACGCCGCCGGAGGTACTTATGACGACCGTGTGTCATATGGGGGTACGGGTGCTCGTGGAAGTGCAGGTGGTTACTCAAGATGGGAAGGTCATTAACTGCGAGAAGGTTGCTGCGGTATAATTTCTCGGTCAGACACATTTCTGAACACCAGCGAACGATGTACAGTCACTGTGAATGTCTGTTGATGAGAGTCGTACTTATTGGATAGATACATTTCCCAACTTGGCAGTACCCACTTTGTGGGTGTTAAAAATGCTCTTCTTTTAGTGTCATTGTCTGAAGAGCCCTAGGTCTAAGGATGGTTATATGCATCTCTGCGCAGTCTCGTTTAATGTCTCGCAGAATTGCCTGCAGTTTAGTCGCTTGTATTTTTTGTCTTTTCTTGGAAAGGACAGTGACTCTTAAACTAATTTTGAAAGAGCAGGTTTTTAGGACGCTTTGCAATCGTCTTTTTTTCTCGAATTTGGAGTATGGTTCAGCTCAAATGCCCGGTTTAATGTTTGGTCAACCTTGCGTTTCAAAGCCCAGGTTGGTTGAACATTGCACGGGATCTGTGAGTCCACTGTGAGTTTTCCACGCCACTTGTCTGAAGGAGGACGGTGACGTCAAGTAGTTCACAATCTAGTTTGTCTTCAGCCGATACTGAACAATTCGTAGCAGGTTCGGTCTACCAGCATAGAGGACAGAAATCAGAGACTCCTGCCTTGAACATTTTGCTGGTCGTTCTCCGAGATAAGCACAGATCGTCGATACATGTAGCCTGTGTAAAGGACCGGCATCTTCAGCTTAATTCGAATAAACT

mRNA

>Mapoly0029s0022.1
GCAGAGGAAAACGCTCCGCGGGCTAACCGCCAAGCTGCCACTAATCGCAATCACGACCGGCTCCGACGAAGGAAGGAGCCGTGCATTAGAGCTCCGCGATTAGGGTAACCCGGTGCCGGGCGTCGCGCTGTTGCGTGCACGCAGAGCGGGTACCGGCCCGGCCCGGCCCGTGGCGACGAGGGCGGAGGAGGGTCGAGGCAGGCAGGCGGGCGGGCGGGCGGGTCCGAGGGAGCAGCTGCCGCTGAAGGCGAGGCGAGGCCGCGAGACCTGACCAGAGGAGACCAGCCACAGCGCACCTCCCTTCCTTCTTCCTTCTTTGAACAACAAGAGTGCCGGAGCGCAGCCGTGAGTCGATTTCTTTTACATATTGCGCGCTTTACTACGCTGCCGCGGCGTTGAGCAATCCTTCCATTGTTCAGTCAGGTTCTCAAGAAGGAACGTGGAAGTGGAGTGACAATGAGCTACGCAGAGGACGAGGGTTCAGGCAGGCCCAAGCTTAGCCTGCAGCCAAGAGGATCTGGAGCCGATCAAGCACCCTCTACACCTTCCAAAACTAGCAAGCCCAACCCTTTTGGTGCGGCACGACCTCGAGAACAAGTAATTGCTGAAAGAGAAGGCAAGAAGGAGACTGAAGTTCTGAGAGAGCAAGCACAAAAGGAATGGAAGCCAAGTATCGTCTTATCAGAGTCTCAACGAGAAGAGAAAAAAGCGGTTGAAGCAGAGCTTGCGTTTGCAAAAAGTGAACTCAAGAAGGAAGTCGATCCTGTCAAATCTAAACTTATGAAAGAGGAAGTTGCGAATATGGAGAAAAAGCTTGAGGAGCTTTTGGCATCTTTTGAGAAAATGGCAGTCCAAACCGCTCAGACCGGTGGTCTAAGACGCCCATACGAAAAGAGGAGAGACGATGAGCGATTACCTGCAGCTGCCTTGCCTGTCGGGGGCGGTTATGGCGGGGTTGAAAGTCACGATAGTTATAACAACTTTGGTAGGAGCAAAGATCGTGACTCTGACAGGGTAGGATCTTATGGTGATACCTGGAGTGCCAAAGGAGGCGGTGGTGCCGGAGGTGGCAAGGGTGCTGGCTCACAGTGTTTCAGTTGTGGAGAGATGGGACACTTTTCGCGGGAATGCCCAAGTGGAGGAGTCGGTGGTGGTAGAGGAGGGTATGGAGGTAACTTTGGAGGCGGAGGTGGCAGGAGTGGATCGCGCGCTTGTTATACCTGTGGCCAAGAGGGTCACATCTCTCGGGAATGTCCGCAGGCCGGAAGTGGAGGATATGGAGCCCGTGGGGGTGGCGGTTATGGTTCTGCCGGGGGTAGCTATGGCGCGTCATACGGTGGAGGTTATGGTAGCAGTGCCCCAGATTATGACACTGGAGCATCTTATGGCCCAGCTAGTCAAGGGGGAGGTGCTTACGCCGCCGGAGGTACTTATGACGACCGTGTGTCATATGGGGGTACGGGTGCTCGTGGAAGTGCAGGTGGTTACTCAAGATGGGAAGGTCATTAACTGCGAGAAGGTTGCTGCGGTATAATTTCTCGGTCAGACACATTTCTGAACACCAGCGAACGATGTACAGTCACTGTGAATGTCTGTTGATGAGAGTCGTACTTATTGGATAGATACATTTCCCAACTTGGCAGTACCCACTTTGTGGGTGTTAAAAATGCTCTTCTTTTAGTGTCATTGTCTGAAGAGCCCTAGGTCTAAGGATGGTTATATGCATCTCTGCGCAGTCTCGTTTAATGTCTCGCAGAATTGCCTGCAGTTTAGTCGCTTGTATTTTTTGTCTTTTCTTGGAAAGGACAGTGACTCTTAAACTAATTTTGAAAGAGCAGGTTTTTAGGACGCTTTGCAATCGTCTTTTTTTCTCGAATTTGGAGTATGGTTCAGCTCAAATGCCCGGTTTAATGTTTGGTCAACCTTGCGTTTCAAAGCCCAGGTTGGTTGAACATTGCACGGGATCTGTGAGTCCACTGTGAGTTTTCCACGCCACTTGTCTGAAGGAGGACGGTGACGTCAAGTAGTTCACAATCTAGTTTGTCTTCAGCCGATACTGAACAATTCGTAGCAGGTTCGGTCTACCAGCATAGAGGACAGAAATCAGAGACTCCTGCCTTGAACATTTTGCTGGTCGTTCTCCGAGATAAGCACAGATCGTCGATACATGTAGCCTGTGTAAAGGACCGGCATCTTCAGCTTAATTCGAATAAACT

CDS

>Mapoly0029s0022.1
ATGAGCTACGCAGAGGACGAGGGTTCAGGCAGGCCCAAGCTTAGCCTGCAGCCAAGAGGATCTGGAGCCGATCAAGCACCCTCTACACCTTCCAAAACTAGCAAGCCCAACCCTTTTGGTGCGGCACGACCTCGAGAACAAGTAATTGCTGAAAGAGAAGGCAAGAAGGAGACTGAAGTTCTGAGAGAGCAAGCACAAAAGGAATGGAAGCCAAGTATCGTCTTATCAGAGTCTCAACGAGAAGAGAAAAAAGCGGTTGAAGCAGAGCTTGCGTTTGCAAAAAGTGAACTCAAGAAGGAAGTCGATCCTGTCAAATCTAAACTTATGAAAGAGGAAGTTGCGAATATGGAGAAAAAGCTTGAGGAGCTTTTGGCATCTTTTGAGAAAATGGCAGTCCAAACCGCTCAGACCGGTGGTCTAAGACGCCCATACGAAAAGAGGAGAGACGATGAGCGATTACCTGCAGCTGCCTTGCCTGTCGGGGGCGGTTATGGCGGGGTTGAAAGTCACGATAGTTATAACAACTTTGGTAGGAGCAAAGATCGTGACTCTGACAGGGTAGGATCTTATGGTGATACCTGGAGTGCCAAAGGAGGCGGTGGTGCCGGAGGTGGCAAGGGTGCTGGCTCACAGTGTTTCAGTTGTGGAGAGATGGGACACTTTTCGCGGGAATGCCCAAGTGGAGGAGTCGGTGGTGGTAGAGGAGGGTATGGAGGTAACTTTGGAGGCGGAGGTGGCAGGAGTGGATCGCGCGCTTGTTATACCTGTGGCCAAGAGGGTCACATCTCTCGGGAATGTCCGCAGGCCGGAAGTGGAGGATATGGAGCCCGTGGGGGTGGCGGTTATGGTTCTGCCGGGGGTAGCTATGGCGCGTCATACGGTGGAGGTTATGGTAGCAGTGCCCCAGATTATGACACTGGAGCATCTTATGGCCCAGCTAGTCAAGGGGGAGGTGCTTACGCCGCCGGAGGTACTTATGACGACCGTGTGTCATATGGGGGTACGGGTGCTCGTGGAAGTGCAGGTGGTTACTCAAGATGGGAAGGTCATTAA

Protein

>Mapoly0029s0022.1
MSYAEDEGSGRPKLSLQPRGSGADQAPSTPSKTSKPNPFGAARPREQVIAEREGKKETEVLREQAQKEWKPSIVLSESQREEKKAVEAELAFAKSELKKEVDPVKSKLMKEEVANMEKKLEELLASFEKMAVQTAQTGGLRRPYEKRRDDERLPAAALPVGGGYGGVESHDSYNNFGRSKDRDSDRVGSYGDTWSAKGGGGAGGGKGAGSQCFSCGEMGHFSRECPSGGVGGGRGGYGGNFGGGGGRSGSRACYTCGQEGHISRECPQAGSGGYGARGGGGYGSAGGSYGASYGGGYGSSAPDYDTGASYGPASQGGGAYAAGGTYDDRVSYGGTGARGSAGGYSRWEGH

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>