Mapoly0029s0130



Description

MYC

Reference DB

Database ID Description
GO GO:0046983 Protein dimerization activity
OrthoMCL OG5_144516
PFAM PF00010 Helix-loop-helix DNA-binding domain
PANTHER PTHR11514 MYC
PANTHER PTHR11514:SF33

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH34 transcription factor, bHLH Mapoly0029s0130.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0029s0130.1 scaffold_29:1352929..1361714  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)
Mapoly0029s0130.2 scaffold_29:1352929..1361707  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0029s0130.1  

Gene structure:

mRNA scaffold_29:1352929..1361714  ( - strand )
three_prime_UTR scaffold_29:1352929..1353700  ( - strand )
three_prime_UTR scaffold_29:1354136..1355675  ( - strand )
CDS scaffold_29:1355676..1355762  ( - strand )
CDS scaffold_29:1356325..1356546  ( - strand )
CDS scaffold_29:1357051..1357383  ( - strand )
CDS scaffold_29:1358415..1359188  ( - strand )
five_prime_UTR scaffold_29:1359189..1359235  ( - strand )
five_prime_UTR scaffold_29:1359584..1361714  ( - strand )

Sequences:

Gene

>Mapoly0029s0130.1
CGGAAGGTTGCAGGCACTGCGGCGGGAAAGGGTAGAATGTAGGGAGTGGTGTACACGTCAACGAGGAGGAGCGTAATGCAGCAGAGTAGATGATGAGCGAGGAGAGGAGAGGAGAGGTGATAATGCGAGCGCAGGCGTGACTAGCCGAGACGTCGAGTGTTGGTTGAGGATGGTACTCGTCGGATGGGATGGCGATCTGGAGCCAGAAACGCGAAGATTTGATGTGATTCCAGATAGTTGAGAGGCGAGACGCGAGTTGTTGTGAGCGTGTACATTTTACTGCCGACCTTACGTTCGTTCGGCAGGATAGACAGACGGGCTGAGCTTCTCGGAACCTCATGTAGACGTATTAGGTAGGGCTTGCCGCTTGCCATGGAGTTGCAGCGACCTCCTCGTCCTCGTCCTCTTTTTCCTCGTCCTGTACATGTGACTCCGAATGCTTGGTTCCTCGTCCTATCCATACAGCTTCCTTCCTTTTGCTTCGAATGCCCGAATGGGCCGAACGAACTCCTCTAGAATGATGCAATCATTAGGCACGTCAAGTCTACCTCACTCTGCCGGTGCGGATTTCGGCTCCCTGCGTGACTGAGTCGAGGGCCAAAATCCAATCCCCATCATCTCGCCCTTGCGCTGTCGAAAGGATATCGAAGGTCGATCGAGGGGTCCATCCCCGCACCCGCTGGGTATGTTGTGAATGTTTGTAATAGTTTGGAAGTTCTTCCTTGTGCTGTATCTTCACTATGGAGTTCAGAAAGTCTGCTTGAAATCCTGAACCAATTTAAATCGACCGACCACGCAAGGAACATGAATTGGGATTGAGGTGACCGAGACGATTGAAGTTACCGCCTGCGCTAAGCAAGGATATCTAGTCGAGTTGAGAGTCGCTTCTCTACGAGATTTGGACGATATTGGCTGCCTGGACTCCTATAATAGTTGGCTGTAATACGTGCTGCGAATTGGCTCCAAGTTCCCTTCAGTAGTTACATCATTGGCAGATTCGACACATCCGGTTCTTACATCTGCCGATGCTTCAAACAGTACTGGCTCTCTTCCCCTTTCTTTTTGAGGAGGGAGACATTGACGTGCTGTGTGCTTCTTAATTATGTACTCAAACGCATTCGATCATATCCGCACTGCAGCCGGGGCCGACGCAATGTGGCAAAATTTGTAGAGTTGGAAACTATTCTCCCAGACTGTCCACAGTTTTGAAGAGCTAGTGGCGACTATCGGGACAAGTGGTTCCACTAGCTCCACGAGCGAGTGCCACAGTCAGCAAACTATCAAGCAGCATGGGAAACGGGAAGTCGTAATTCTACAATTTTATTGTGTTCGAGTAAGGAGGACTTTCACATCCTTTCGCAGCTAGGTGAGGTTCAATTGATAAACTATAAATAGACTCCAGAAACTATGCCCGCATGGGACTAAAGTCGGTGTCTGAGGATCCCTTGTCAGGTGCAGCACCTACGAGCGGGGCCTGGTGGGCCAGCACGCGTGCGGGTTTTACATCTGAATTGAATTGGAGGTCACCTATAGAATGGATTATATTGTTTCGATACTGGCGGGTATTTGCTCGGCGCATTCAGAATGGAGAAGGAAATTGCACATGTGAAGATACAAAAAGGAGTTGGGAGCTTTGTAGCACATCTCATCGCAACGATATCGTTAGAACAGTCAGCCTTAGGATCTTTCTCTCCTCTTCACCTCATAATAGCTTAGATACCATGGTGTCGAGAATGTGTACCGCTGGTAACGTTAGGGACTGATGATTTCGGGACTGATGATTTCGAACAGTTCGACATTCGCAGACCTCGTTGTAGCGGTCGAGTAGCAGAAATCTCAGATGAACATGCTGCACATGTTCCGAGGAGACCGAATGGCGAGCTACAAAACGAATTATCATATTCGGCATAGTTATCAACCAGCCTATGTTTCTAGCAATCGTCGGAAGATATCTTGCGTGCAACCTTTCAGAAATTAGAAGTAGAAGCTGGTGGAATTTTTTCATTGGTTCCGTTCTTGTATTTATTGTTTCACGAACAGTGATCAAGCTGAATGCGTATCTACATTCGCGCCGATCTTCTCTGAGACTCAGACTATTATCGAACTTGACTCAGACGCTAGATAGATGAAGGTGACAAATTGATTTTGCGGCTTGAATTGTTTCGTTCTGATTGCACATCGCATGGCGCATATACATGTCTTATATGTATGTGCTAGAGCTCACTCAAAGTAATTTCTGCTTCTACACGTGAAGTGTCGATCCTTTGAAAACATATTCCGGTAAATAATACTGAGTACGCTTAAGCTCCCATATTCTTGGAATGCGCTGTCGGAGGTTGAATAAAAGGGTTCTGCACCTGCTAACTCTTGATGACATTTGAATATTGGCAAAGAACCCTGTAGGGAACCTGGAACCTCATGCAATATTAGCTTGAAGGATTCTTATCAATTTCATGTTTCCTGTTTGCCATCTCTGCAGTTCAGCGAGAAGCTTACGAGATAATTGCCACGGATCGAGAGCGAAAAATGGCTGAGCTAGCCTGGTTGACATCTTCGCCAGCAGCCAAAGTGACTTTGAATGCATCTTCTTCGTTTAGCAACTCGAACGAGAACCTTTTTGACCTGCTACAAGGTCGCTTGGGGAGTGGAGCGTTCGGGGGAGCAGCAATAGTAGATTCTTCATCGTTTTTCCGCACATCAGATCAGATGACGAATGTAACAGTAGCTTCGAATCATACGGAGTCCACTGTGTCGCTGATGAAGGCGGAGGACGGAAATAATCATATGCATTCGCCTCTTTGGGTAGCTGCCGGCGCTGCTGCTGTAGCAACAGATGGTATCTACAGCTCTACTGGTCCGGCAGCAGCTCATGTGCCATCCATTGATAGCACCCAATTGTCTTCTTACGTCAAGCCGCACGATCCTTCGCCGCAGCTTCAGGCTCTACGTGACTTCATGGCTTATGGGAGCAACGTTAACAACCATTCTATGTCGACAGCAGTGGATAATATCAACCTTGCGCCCGGACATCCAATGTTCCTGCACTTGGGTGAAGAATCTCCCGCTTCATTGCTCATTGGAATGCCTCACCACTCCAATCCCATATCTACTTCTCCTAGCAAAGGTCCGGATATGATGGCGTATAGAGCTCTATGTCAGGCCGAGCTTTTTGCGACAGAAAGGAGCCCACACAGAACGCAATTCCAACGAGAAAATCACATCCTTGCAGAGCGTCAGCGCAGGGAAGAAATGAACGAGAAGTTTTCGGCCTTAAGGGCAATGATACCCAAAGCAACCAAAGTACGTACCAGAACCAAAGTAACCCATTTCTTTCTGCACACAAGAGATTAATTTAGGCACTATCCTGACAGGATCCATGCTTTTTTGGTACACCGTATATCTTCTACTAATTTTAAGTCTTCCTGCAGGAAATTATCAGTCCTTTTTAGAATTCTGCGTATGAAATATTCGTGAGCAGAGACCGTTCCTCATGTTGCTGTTCGAAGAATCATCGGCAAGATTTTTGGCGATCGTAGTCACGTCTTAACTGAACGTTCATGATGGAAATAGTTACTAGCTGCAACGTATCGTGTCCATGTACGTTCTGAATATAACTGGCATGGAGATGACAAGTGCATTTCAAGGTCCACCACATGAAGTTCATTCACGTCAAATTGACGTGGATGAGACTTGAAGTTCAAACGACTCCAGATATAATTCAGAAACATGTGTTTGCATGCAAGCAGTTGTTTCTCATGTAGATTTGGCATCGAATTCTCGCATTAGATACCTTGTATGGAGAGCTTTAGAGCATTTTTCAGCCTGGTCTCTTGCTGTACTTCACTCTACAGCTAAATGATCGATTGTTGTCTGAACATCGTGTACGAGTGTTCGTCTGTTCAGTCGGAGAGGGTCACTTTTGGCTGATTCTACCTGTCAATACTGACAACGAATTATGTGTTATGTGCCATTTGACCAGAATCCTAAAGACCTCAGATGCGACAAATGAATACAATATAATGATATAAACTGTCAAAAAAGTAGTAACTTCTGCAGTTTTCTGTTTTCTTGTTTTAACGTGTTTTTTGAATGATAAGCGAAAGCCTCATTCTCAATCGCAGTTGTAATTCTCAGCTTTAGTAATTCGATTCGTGAAATTTCTTAGATCTGGTACTCTCGACCAAGAAGGATCGGGTTCTATTTTCCAGTTTCAAGTTTTAACTGCGACAGCAAAAATACTTTCAGCATAGAGATGAAGCACAGTTTCAATAGACTTCAAGCGGGTATAACCCCTCATGATTTTCCCTGACATTCATGGAATCTGTTTGCAGAAAGACAAGGCGTCCATTGTAGGAGATACAATCGCGTACGTGCTGGAGCTGGAGAAAACCCTAAAACAACTGAAGGCCTGCAAAGACAGTCGAAAGGGATTCAGCTTCAAGCTTCTAAAGAAGAAATCTTCTTCAAAAGTATTGGAAGACAACGACAGATCGACCTCAGACACAGCACCAGATACAGCTGCCCCAGAGGAAATGAAACCTGGTCCGGGATGTTCGAACTCAACAAGATTTGAAGACATTGTTTTAAAAGAGTGCAAAGAAAGAGAAGAGCCGACAATAAGTTCATCGGATAACATCAGTAGAGACTGCTCTCATAATCATCATGTAAATTCTTCTATCCCACCTGCGTAGACGTGCAACGCGATGTCATAGACGACGATGTGACTTCGTACTTGCTAGAAAAGCATGCTTAACTACTTAGATATGTTCAATAGCAATTAACCCTCGTTAGGGTAGGCACAGATCCCCGGGAGGTTTGTGCACGAAGGGATCCATGGTCGATGAATTTCTCCAGGCCTGGATTTCTTTGTTTCATCTAGGTCTTAATTCATGACTTCAAGACGTCGTTCCCTGCATACTGTATCATAGAGCGCGCTCTTGGTCCACAAGGACTTGCGTGGAGGAGCAACCAAAGTTTTGGACTAGTGAGCTAATCCCGTATGATCGCATGCATAGATTAAAAGTCTATTCTTCTACTTCACATGCAAACTCTAAAATTTGACTTTCGTAGCATTCTGATATCATCACTCTTACACAAGCGACACCTAACCCTTAGTAGAACTGAGTTCATGCACGTGGAACTTTAAAAGACTGTTATTAATTTTGCAGAAACCCATGGAGAAGGACAATCTTTTGGACATCGACATTAGTAGTAGCTCTCAGGTTGAGGTACAAAATCTAGGAGAGCAAGCCGTTATCAAGATAGTGTGCGCCCGCAGTCGTGGTCTTGTTCTTCGAATCATACAAGCTTTGGAGGAGTGCAAAACGGAAATTCTTCAGTCGAATGTAACAACAGTTTCTCAACATTCTGTACATTTTATCACTGTGCAGGTACAGTCATTTAGCCTTGAACCCTTTAGCTTGGAGTTGACTTTATCGGTCAATTTTCGCACATCAAATATGCACTAAAGGGTATAGACAATTTTTATCCAGCGTCTAATAGATACGGAATTAGTAATAAAGTTGCTCTCTCCTGTGGAAAGATGTCAAGAATTGTAGATATCTAAATGGCTATCCCGCTATTTGGTTTTAAGAATATCTGCCCACATCGATTTACCGTCACTCAGATTGCTCAAGACGCCAAGAGAATTTCAATTTGTAATTAACATTTTGTTGATAGCTTCTACTAGGTCTTTTTCTCTTTTTTGAAGAATCTTCCATATCTGAAATGTAAGTAGAAATAGATCAAGTCTTTGCATAGGAAGTATATGTATGCATGACTGCAACTTCAGAAAGGAGGCACCGGATCAATAGACGGCCTACAACGACGACCATACACTGTTTTGCCTTTTCTCACAAATAGGAGTATCAGTCAGAGTGACCAAACTTAGTCGCATACTGTAGTCACATAGCCTTCAAGTTACAACGTATTAATTGAGCTTTTATCTCACAGATCAATTCGGGGCTGAGCTGTTCAATAGAGCAGATGGTCCAAGCTCTTCTTAAAGCTTCAAATCCGAATCAGATTGCGGAGACATGACAACAGTTACGCCGCAGCGGAAGAGACCAAACAACTTTTAATAGCCGGCCAAGTCTAGATGCACCCAGTTGATGTAATGAGTTGACTCCTCAAATTCACTTGTTACTGCATGCAAAATTACCGGTGAGTGTATCGATCAATTTTGATCATGTAGTAATTCAAGTACAGTCTCCTTTAGAAAATCTTTGGGTAAAAGGATCCCCAATCCGACTCGGTACAGAAGAAATTTCTCTTTGTATTACAAGAACAGATATAGCACCCCCATCAACACTAGTCAGACTACTGAAGTAGCTCAGAGAAGTTGGAGAGGTAGATCACAACTTGTGGTGAGAATCCTCTCCACCGACATCTCAACAAATACTTACACTATCCCTCAAGCAACAAGGTCTAAAATGTCATAAACAGAGACCAGCACTGACTAAACTATATTCCCTACATTAGCTACGAAAGTAGTCAGTTCCACGATAACAAGGTAGGCTTTAGTCAAGTAGGGAGTTTGATTAGAGGATGAGATTTAGTTCATGTCTTTTCAGCATCCCTCAAGAAGATGTGAGGTGCTTCTGGTTCGACCTGGTAAAGTCCAATTTTCAAACCTCTCACTAGTTCTCCAATTGGCTTCCCAGTCCAGTCCAGAAGACATGTATCAATTGGTTGTTGAGCTTTACACATCCCAGTTTGCGGACTTATGTTAGTGCACTTACGTCCCATGGAGTTCGTTACCTTGACATCTGGCCCAAGATATCAAACTCAAGCTTGATGTTTCATGAAATTTCTCCAGGCAAGTAGCGACAATTTCCTTTCCTCCTATTAGACTACTCTTCGGACCCTACACCTTACTCACTGTGAACCACTGAACATTGATTGTCATAACTAAATGTGCTGCAATTCGGAAAAGTCTGCAGTCCGGTGCCGCTAAATTACATCCAAAAATGGCATTTTCGATCCAGAGATCAAAAGGACTCTGTTAGCGCATAATGCCACGAGATTGTGTATTGGATGTTGTTCAATATGTGAGAATATGTCGCATTCAGTTATGTTGCCTTGTATATACTTATAGCGCCACTTAGTTAAGTGGGATATGGGCACTTGCTGGTACACGGTGTAGAAAAGTGAAATCGGAATTTTTATTTTTCTAAGCTGGGGTTTACGACGAAGCTGAGGACTAAGCTAGGTGCGGAATCATAAAGAGTCATTGTCTACACCATAGTGGTTGCACTATCCTCGAGCTTAGAACCTGTACTGGCAATGTGCTATCTTGAGAAGTTTTTTTATAAGTCCAACGCAACGACAGGAAGTAAAGAGTTCTAGAAGGTTAAGGTAGAAGATTGAGAACAAACTCAAGCACGCATACAGAATCTGAAGATGATGCACGTCTTCACACGTGGACTTACGACTTATCATGGACCCATCATCGGTCATCAGCTTGGTGGACACCTGTGGACCAGCTGCACGTACTATGATTTTCTAGTATCGATCTAGGTACTCTGGTACGTGCTATATCAAATTTCCTGATTGGAGTTTCGGGAAGTGGTATTATCCGGTAAGTTTTAACGCACTTCTTTACTGCACTACGGTAGGCAGCACAGGTTTGACGGAAGATGAATAAACAAGAATTTGGATTAGAGCAACTCCGCCAAACACTTGGTATATATAGAACCATCGATGTTTTCTCTAATTAATTATTAGTTGTGTGTTTTGACTTCTTTTCGGAGAGTCTAATCTTCAATAGGACACAATCATGGTGCTACGTCCAAAGGCTTCGGAATTGTAGATGTCGTTCGAGAAGTCTTACTTCCCCTCGCATGCAAAAATCAGAGACAGGACACATTTTTTTTACCAGTACCATAATGAATGTCTGTAATATGTTGAAAGTTTGAAGTTTCTGCGAGTTTTTTACTGGTACTGGAAAATTTTAAGGTGACGACTTAGAAATTGCCAGTTCTGAAGGTGAATTGATGTTTGTTTCGATTCGCAGGTAAACATTTTTTCCAAAATCAAATTGAGACCGGCTGGACATAGAAGGTTTCAGAGTCCAAAATGTCCAAAATCTGTTTGTGAATCCAAGTACTTCTCCACTTATCAAGTTCCAACTCTTTACTAGAATTTCATGCACTTGGGAGATGCCGTGAAATGGAGTGTACTGTACTTGCCAATTAGAAGCCTTCACACCCCAGGCCCCTTAGCTTTCAGTACCCGAACCTGATCCACAATGATAAAAGGCACGCCCACCAGTAATGAATGCGGGCAAATTATGTGGAAAGCCCGAAATTCCGAGAGATGAATCATGACTGCAGGAGGAGGAGGAAGATTTGAGAAGATGCATTATGCCCGGTACGTAGCGTGGGAAACGTACTCTCAGTGGATCCACTGCAATCAAAGAGTCTGGATTGGTTTTGCTCACCGGTGTGATTGGAAGATGATAGATTTGAACTGTCTCAGCATGTACATAAGTACAGTAATCATCGAGGAAGACGAGTCTCGGAATAAGTATGTCACATAACGATGAATCAAGCGCAAATGTGGAATCTTGCGATTTGATAGCGCGAGCTTATTACAAAAGGACCCAACCGTCATGGACTTTGATCAGCCATGGCCACGTACATACACGTACAATTAGTTTGATGTAAAGCGCGTAAGTACTCCACAACTACTTGACGACCGTCCATGTCAGTGCAGTTCGTTCTGCCTGTCTCGTCTGTTAGAACATTTTCCGGTTCATATTCTCACAATTGTACTCCTTCCAGTTC

mRNA

>Mapoly0029s0130.1
CGGAAGGTTGCAGGCACTGCGGCGGGAAAGGGTAGAATGTAGGGAGTGGTGTACACGTCAACGAGGAGGAGCGTAATGCAGCAGAGTAGATGATGAGCGAGGAGAGGAGAGGAGAGGTGATAATGCGAGCGCAGGCGTGACTAGCCGAGACGTCGAGTGTTGGTTGAGGATGGTACTCGTCGGATGGGATGGCGATCTGGAGCCAGAAACGCGAAGATTTGATGTGATTCCAGATAGTTGAGAGGCGAGACGCGAGTTGTTGTGAGCGTGTACATTTTACTGCCGACCTTACGTTCGTTCGGCAGGATAGACAGACGGGCTGAGCTTCTCGGAACCTCATGTAGACGTATTAGGTAGGGCTTGCCGCTTGCCATGGAGTTGCAGCGACCTCCTCGTCCTCGTCCTCTTTTTCCTCGTCCTGTACATGTGACTCCGAATGCTTGGTTCCTCGTCCTATCCATACAGCTTCCTTCCTTTTGCTTCGAATGCCCGAATGGGCCGAACGAACTCCTCTAGAATGATGCAATCATTAGGCACGTCAAGTCTACCTCACTCTGCCGGTGCGGATTTCGGCTCCCTGCGTGACTGAGTCGAGGGCCAAAATCCAATCCCCATCATCTCGCCCTTGCGCTGTCGAAAGGATATCGAAGGTCGATCGAGGGGTCCATCCCCGCACCCGCTGGGTATGTTGTGAATGTTTGTAATAGTTTGGAAGTTCTTCCTTGTGCTGTATCTTCACTATGGAGTTCAGAAAGTCTGCTTGAAATCCTGAACCAATTTAAATCGACCGACCACGCAAGGAACATGAATTGGGATTGAGGTGACCGAGACGATTGAAGTTACCGCCTGCGCTAAGCAAGGATATCTAGTCGAGTTGAGAGTCGCTTCTCTACGAGATTTGGACGATATTGGCTGCCTGGACTCCTATAATAGTTGGCTGTAATACGTGCTGCGAATTGGCTCCAAGTTCCCTTCAGTAGTTACATCATTGGCAGATTCGACACATCCGGTTCTTACATCTGCCGATGCTTCAAACAGTACTGGCTCTCTTCCCCTTTCTTTTTGAGGAGGGAGACATTGACGTGCTGTGTGCTTCTTAATTATGTACTCAAACGCATTCGATCATATCCGCACTGCAGCCGGGGCCGACGCAATGTGGCAAAATTTGTAGAGTTGGAAACTATTCTCCCAGACTGTCCACAGTTTTGAAGAGCTAGTGGCGACTATCGGGACAAGTGGTTCCACTAGCTCCACGAGCGAGTGCCACAGTCAGCAAACTATCAAGCAGCATGGGAAACGGGAAGTCGTAATTCTACAATTTTATTGTGTTCGAGTAAGGAGGACTTTCACATCCTTTCGCAGCTAGGTGAGGTTCAATTGATAAACTATAAATAGACTCCAGAAACTATGCCCGCATGGGACTAAAGTCGGTGTCTGAGGATCCCTTGTCAGGTGCAGCACCTACGAGCGGGGCCTGGTGGGCCAGCACGCGTGCGGGTTTTACATCTGAATTGAATTGGAGGTCACCTATAGAATGGATTATATTGTTTCGATACTGGCGGGTATTTGCTCGGCGCATTCAGAATGGAGAAGGAAATTGCACATGTGAAGATACAAAAAGGAGTTGGGAGCTTTGTAGCACATCTCATCGCAACGATATCGTTAGAACAGTCAGCCTTAGGATCTTTCTCTCCTCTTCACCTCATAATAGCTTAGATACCATGGTGTCGAGAATGTGTACCGCTGGTAACGTTAGGGACTGATGATTTCGGGACTGATGATTTCGAACAGTTCGACATTCGCAGACCTCGTTGTAGCGGTCGAGTAGCAGAAATCTCAGATGAACATGCTGCACATGTTCCGAGGAGACCGAATGGCGAGCTACAAAACGAATTATCATATTCGGCATAGTTATCAACCAGCCTATGTTTCTAGCAATCGTCGGAAGATATCTTGCGTGCAACCTTTCAGAAATTAGAAGTAGAAGCTGGTGGAATTTTTTCATTGGTTCCGTTCTTGTATTTATTGTTTCACGAACAGTGATCAAGCTGAATGCGTATCTACATTCGCGCCGATCTTCTCTGAGACTCAGACTATTATCGAACTTGACTCAGACGCTAGATAGATGAAGTTCAGCGAGAAGCTTACGAGATAATTGCCACGGATCGAGAGCGAAAAATGGCTGAGCTAGCCTGGTTGACATCTTCGCCAGCAGCCAAAGTGACTTTGAATGCATCTTCTTCGTTTAGCAACTCGAACGAGAACCTTTTTGACCTGCTACAAGGTCGCTTGGGGAGTGGAGCGTTCGGGGGAGCAGCAATAGTAGATTCTTCATCGTTTTTCCGCACATCAGATCAGATGACGAATGTAACAGTAGCTTCGAATCATACGGAGTCCACTGTGTCGCTGATGAAGGCGGAGGACGGAAATAATCATATGCATTCGCCTCTTTGGGTAGCTGCCGGCGCTGCTGCTGTAGCAACAGATGGTATCTACAGCTCTACTGGTCCGGCAGCAGCTCATGTGCCATCCATTGATAGCACCCAATTGTCTTCTTACGTCAAGCCGCACGATCCTTCGCCGCAGCTTCAGGCTCTACGTGACTTCATGGCTTATGGGAGCAACGTTAACAACCATTCTATGTCGACAGCAGTGGATAATATCAACCTTGCGCCCGGACATCCAATGTTCCTGCACTTGGGTGAAGAATCTCCCGCTTCATTGCTCATTGGAATGCCTCACCACTCCAATCCCATATCTACTTCTCCTAGCAAAGGTCCGGATATGATGGCGTATAGAGCTCTATGTCAGGCCGAGCTTTTTGCGACAGAAAGGAGCCCACACAGAACGCAATTCCAACGAGAAAATCACATCCTTGCAGAGCGTCAGCGCAGGGAAGAAATGAACGAGAAGTTTTCGGCCTTAAGGGCAATGATACCCAAAGCAACCAAAAAAGACAAGGCGTCCATTGTAGGAGATACAATCGCGTACGTGCTGGAGCTGGAGAAAACCCTAAAACAACTGAAGGCCTGCAAAGACAGTCGAAAGGGATTCAGCTTCAAGCTTCTAAAGAAGAAATCTTCTTCAAAAGTATTGGAAGACAACGACAGATCGACCTCAGACACAGCACCAGATACAGCTGCCCCAGAGGAAATGAAACCTGGTCCGGGATGTTCGAACTCAACAAGATTTGAAGACATTGTTTTAAAAGAGTGCAAAGAAAGAGAAGAGCCGACAATAAGTTCATCGGATAACATCAGTAGAGACTGCTCTCATAATCATCATAAACCCATGGAGAAGGACAATCTTTTGGACATCGACATTAGTAGTAGCTCTCAGGTTGAGGTACAAAATCTAGGAGAGCAAGCCGTTATCAAGATAGTGTGCGCCCGCAGTCGTGGTCTTGTTCTTCGAATCATACAAGCTTTGGAGGAGTGCAAAACGGAAATTCTTCAGTCGAATGTAACAACAGTTTCTCAACATTCTGTACATTTTATCACTGTGCAGATCAATTCGGGGCTGAGCTGTTCAATAGAGCAGATGGTCCAAGCTCTTCTTAAAGCTTCAAATCCGAATCAGATTGCGGAGACATGACAACAGTTACGCCGCAGCGGAAGAGACCAAACAACTTTTAATAGCCGGCCAAGTCTAGATGCACCCAGTTGATGTAATGAGTTGACTCCTCAAATTCACTTGTTACTGCATGCAAAATTACCGGTGAGTGTATCGATCAATTTTGATCATGTAGTAATTCAAGTACAGTCTCCTTTAGAAAATCTTTGGGTAAAAGGATCCCCAATCCGACTCGGTACAGAAGAAATTTCTCTTTGTATTACAAGAACAGATATAGCACCCCCATCAACACTAGTCAGACTACTGAAGTAGCTCAGAGAAGTTGGAGAGGTAGATCACAACTTGTGGTGAGAATCCTCTCCACCGACATCTCAACAAATACTTACACTATCCCTCAAGCAACAAGGTCTAAAATGTCATAAACAGAGACCAGCACTGACTAAACTATATTCCCTACATTAGCTACGAAAGTAGTCAGTTCCACGATAACAAGGTAGGCTTTAGTCAAGTAGGGAGTTTGATTAGAGGATGAGATTTAGTTCATGTCTTTTCAGCATCCCTCAAGAAGATGTGAGGTGCTTCTGGTTCGACCTGGTAAAGTCCAATTTTCAAACCTCTCACTAGTTCTCCAATTGGCTTCCCAGTCCAGTCCAGAAGACATGTATCAATTGGTTGTTGAGCTTTACACATCCCAGTTTGCGGACTTATGTTAGTGCACTTACGTCCCATGGAGTTCGTTACCTTGACATCTGGCCCAAGATATCAAACTCAAGCTTGATGTTTCATGAAATTTCTCCAGGCAAGTAGCGACAATTTCCTTTCCTCCTATTAGACTACTCTTCGGACCCTACACCTTACTCACTGTGAACCACTGAACATTGATTGTCATAACTAAATGTGCTGCAATTCGGAAAAGTCTGCAGTCCGGTGCCGCTAAATTACATCCAAAAATGGCATTTTCGATCCAGAGATCAAAAGGACTCTGTTAGCGCATAATGCCACGAGATTGTGTATTGGATGTTGTTCAATATGTGAGAATATGTCGCATTCAGTTATGTTGCCTTGTATATACTTATAGCGCCACTTAGTTAAGTGGGATATGGGCACTTGCTGGTACACGGTGTAGAAAAGTGAAATCGGAATTTTTATTTTTCTAAGCTGGGGTTTACGACGAAGCTGAGGACTAAGCTAGGTGCGGAATCATAAAGAGTCATTGTCTACACCATAGTGGTTGCACTATCCTCGAGCTTAGAACCTGTACTGGCAATGTGCTATCTTGAGAAGTTTTTTTATAAGTCCAACGCAACGACAGGAAGTAAAGAGTTCTAGAAGGTTAAGGTAGAAGATTGAGAACAAACTCAAGCACGCATACAGAATCTGAAGATGATGCACGTCTTCACACGTGGACTTACGACTTATCATGGACCCATCATCGGTCATCAGCTTGGTGGACACCTGTGGACCAGCTGCACGTACTATGATTTTCTAGTATCGATCTAGGTACTCTGGTACGTGCTATATCAAATTTCCTGATTGGAGTTTCGGGAAGTGGTATTATCCGGTAAACATTTTTTCCAAAATCAAATTGAGACCGGCTGGACATAGAAGGTTTCAGAGTCCAAAATGTCCAAAATCTGTTTGTGAATCCAAGTACTTCTCCACTTATCAAGTTCCAACTCTTTACTAGAATTTCATGCACTTGGGAGATGCCGTGAAATGGAGTGTACTGTACTTGCCAATTAGAAGCCTTCACACCCCAGGCCCCTTAGCTTTCAGTACCCGAACCTGATCCACAATGATAAAAGGCACGCCCACCAGTAATGAATGCGGGCAAATTATGTGGAAAGCCCGAAATTCCGAGAGATGAATCATGACTGCAGGAGGAGGAGGAAGATTTGAGAAGATGCATTATGCCCGGTACGTAGCGTGGGAAACGTACTCTCAGTGGATCCACTGCAATCAAAGAGTCTGGATTGGTTTTGCTCACCGGTGTGATTGGAAGATGATAGATTTGAACTGTCTCAGCATGTACATAAGTACAGTAATCATCGAGGAAGACGAGTCTCGGAATAAGTATGTCACATAACGATGAATCAAGCGCAAATGTGGAATCTTGCGATTTGATAGCGCGAGCTTATTACAAAAGGACCCAACCGTCATGGACTTTGATCAGCCATGGCCACGTACATACACGTACAATTAGTTTGATGTAAAGCGCGTAAGTACTCCACAACTACTTGACGACCGTCCATGTCAGTGCAGTTCGTTCTGCCTGTCTCGTCTGTTAGAACATTTTCCGGTTCATATTCTCACAATTGTACTCCTTCCAGTTC

CDS

>Mapoly0029s0130.1
ATGGCTGAGCTAGCCTGGTTGACATCTTCGCCAGCAGCCAAAGTGACTTTGAATGCATCTTCTTCGTTTAGCAACTCGAACGAGAACCTTTTTGACCTGCTACAAGGTCGCTTGGGGAGTGGAGCGTTCGGGGGAGCAGCAATAGTAGATTCTTCATCGTTTTTCCGCACATCAGATCAGATGACGAATGTAACAGTAGCTTCGAATCATACGGAGTCCACTGTGTCGCTGATGAAGGCGGAGGACGGAAATAATCATATGCATTCGCCTCTTTGGGTAGCTGCCGGCGCTGCTGCTGTAGCAACAGATGGTATCTACAGCTCTACTGGTCCGGCAGCAGCTCATGTGCCATCCATTGATAGCACCCAATTGTCTTCTTACGTCAAGCCGCACGATCCTTCGCCGCAGCTTCAGGCTCTACGTGACTTCATGGCTTATGGGAGCAACGTTAACAACCATTCTATGTCGACAGCAGTGGATAATATCAACCTTGCGCCCGGACATCCAATGTTCCTGCACTTGGGTGAAGAATCTCCCGCTTCATTGCTCATTGGAATGCCTCACCACTCCAATCCCATATCTACTTCTCCTAGCAAAGGTCCGGATATGATGGCGTATAGAGCTCTATGTCAGGCCGAGCTTTTTGCGACAGAAAGGAGCCCACACAGAACGCAATTCCAACGAGAAAATCACATCCTTGCAGAGCGTCAGCGCAGGGAAGAAATGAACGAGAAGTTTTCGGCCTTAAGGGCAATGATACCCAAAGCAACCAAAAAAGACAAGGCGTCCATTGTAGGAGATACAATCGCGTACGTGCTGGAGCTGGAGAAAACCCTAAAACAACTGAAGGCCTGCAAAGACAGTCGAAAGGGATTCAGCTTCAAGCTTCTAAAGAAGAAATCTTCTTCAAAAGTATTGGAAGACAACGACAGATCGACCTCAGACACAGCACCAGATACAGCTGCCCCAGAGGAAATGAAACCTGGTCCGGGATGTTCGAACTCAACAAGATTTGAAGACATTGTTTTAAAAGAGTGCAAAGAAAGAGAAGAGCCGACAATAAGTTCATCGGATAACATCAGTAGAGACTGCTCTCATAATCATCATAAACCCATGGAGAAGGACAATCTTTTGGACATCGACATTAGTAGTAGCTCTCAGGTTGAGGTACAAAATCTAGGAGAGCAAGCCGTTATCAAGATAGTGTGCGCCCGCAGTCGTGGTCTTGTTCTTCGAATCATACAAGCTTTGGAGGAGTGCAAAACGGAAATTCTTCAGTCGAATGTAACAACAGTTTCTCAACATTCTGTACATTTTATCACTGTGCAGATCAATTCGGGGCTGAGCTGTTCAATAGAGCAGATGGTCCAAGCTCTTCTTAAAGCTTCAAATCCGAATCAGATTGCGGAGACATGA

Protein

>Mapoly0029s0130.1
MAELAWLTSSPAAKVTLNASSSFSNSNENLFDLLQGRLGSGAFGGAAIVDSSSFFRTSDQMTNVTVASNHTESTVSLMKAEDGNNHMHSPLWVAAGAAAVATDGIYSSTGPAAAHVPSIDSTQLSSYVKPHDPSPQLQALRDFMAYGSNVNNHSMSTAVDNINLAPGHPMFLHLGEESPASLLIGMPHHSNPISTSPSKGPDMMAYRALCQAELFATERSPHRTQFQRENHILAERQRREEMNEKFSALRAMIPKATKKDKASIVGDTIAYVLELEKTLKQLKACKDSRKGFSFKLLKKKSSSKVLEDNDRSTSDTAPDTAAPEEMKPGPGCSNSTRFEDIVLKECKEREEPTISSSDNISRDCSHNHHKPMEKDNLLDIDISSSSQVEVQNLGEQAVIKIVCARSRGLVLRIIQALEECKTEILQSNVTTVSQHSVHFITVQINSGLSCSIEQMVQALLKASNPNQIAET

Mapoly0029s0130.2  

Gene structure:

mRNA scaffold_29:1352929..1361707  ( - strand )
three_prime_UTR scaffold_29:1352929..1353700  ( - strand )
three_prime_UTR scaffold_29:1354136..1355675  ( - strand )
CDS scaffold_29:1355676..1355762  ( - strand )
CDS scaffold_29:1356325..1356546  ( - strand )
CDS scaffold_29:1357051..1357383  ( - strand )
CDS scaffold_29:1358415..1359188  ( - strand )
five_prime_UTR scaffold_29:1359189..1359235  ( - strand )
five_prime_UTR scaffold_29:1361362..1361707  ( - strand )

Sequences:

Gene

>Mapoly0029s0130.2
TTGCAGGCACTGCGGCGGGAAAGGGTAGAATGTAGGGAGTGGTGTACACGTCAACGAGGAGGAGCGTAATGCAGCAGAGTAGATGATGAGCGAGGAGAGGAGAGGAGAGGTGATAATGCGAGCGCAGGCGTGACTAGCCGAGACGTCGAGTGTTGGTTGAGGATGGTACTCGTCGGATGGGATGGCGATCTGGAGCCAGAAACGCGAAGATTTGATGTGATTCCAGATAGTTGAGAGGCGAGACGCGAGTTGTTGTGAGCGTGTACATTTTACTGCCGACCTTACGTTCGTTCGGCAGGATAGACAGACGGGCTGAGCTTCTCGGAACCTCATGTAGACGTATTAGGTAGGGCTTGCCGCTTGCCATGGAGTTGCAGCGACCTCCTCGTCCTCGTCCTCTTTTTCCTCGTCCTGTACATGTGACTCCGAATGCTTGGTTCCTCGTCCTATCCATACAGCTTCCTTCCTTTTGCTTCGAATGCCCGAATGGGCCGAACGAACTCCTCTAGAATGATGCAATCATTAGGCACGTCAAGTCTACCTCACTCTGCCGGTGCGGATTTCGGCTCCCTGCGTGACTGAGTCGAGGGCCAAAATCCAATCCCCATCATCTCGCCCTTGCGCTGTCGAAAGGATATCGAAGGTCGATCGAGGGGTCCATCCCCGCACCCGCTGGGTATGTTGTGAATGTTTGTAATAGTTTGGAAGTTCTTCCTTGTGCTGTATCTTCACTATGGAGTTCAGAAAGTCTGCTTGAAATCCTGAACCAATTTAAATCGACCGACCACGCAAGGAACATGAATTGGGATTGAGGTGACCGAGACGATTGAAGTTACCGCCTGCGCTAAGCAAGGATATCTAGTCGAGTTGAGAGTCGCTTCTCTACGAGATTTGGACGATATTGGCTGCCTGGACTCCTATAATAGTTGGCTGTAATACGTGCTGCGAATTGGCTCCAAGTTCCCTTCAGTAGTTACATCATTGGCAGATTCGACACATCCGGTTCTTACATCTGCCGATGCTTCAAACAGTACTGGCTCTCTTCCCCTTTCTTTTTGAGGAGGGAGACATTGACGTGCTGTGTGCTTCTTAATTATGTACTCAAACGCATTCGATCATATCCGCACTGCAGCCGGGGCCGACGCAATGTGGCAAAATTTGTAGAGTTGGAAACTATTCTCCCAGACTGTCCACAGTTTTGAAGAGCTAGTGGCGACTATCGGGACAAGTGGTTCCACTAGCTCCACGAGCGAGTGCCACAGTCAGCAAACTATCAAGCAGCATGGGAAACGGGAAGTCGTAATTCTACAATTTTATTGTGTTCGAGTAAGGAGGACTTTCACATCCTTTCGCAGCTAGGTGAGGTTCAATTGATAAACTATAAATAGACTCCAGAAACTATGCCCGCATGGGACTAAAGTCGGTGTCTGAGGATCCCTTGTCAGGTGCAGCACCTACGAGCGGGGCCTGGTGGGCCAGCACGCGTGCGGGTTTTACATCTGAATTGAATTGGAGGTCACCTATAGAATGGATTATATTGTTTCGATACTGGCGGGTATTTGCTCGGCGCATTCAGAATGGAGAAGGAAATTGCACATGTGAAGATACAAAAAGGAGTTGGGAGCTTTGTAGCACATCTCATCGCAACGATATCGTTAGAACAGTCAGCCTTAGGATCTTTCTCTCCTCTTCACCTCATAATAGCTTAGATACCATGGTGTCGAGAATGTGTACCGCTGGTAACGTTAGGGACTGATGATTTCGGGACTGATGATTTCGAACAGTTCGACATTCGCAGACCTCGTTGTAGCGGTCGAGTAGCAGAAATCTCAGATGAACATGCTGCACATGTTCCGAGGAGACCGAATGGCGAGCTACAAAACGAATTATCATATTCGGCATAGTTATCAACCAGCCTATGTTTCTAGCAATCGTCGGAAGATATCTTGCGTGCAACCTTTCAGAAATTAGAAGTAGAAGCTGGTGGAATTTTTTCATTGGTTCCGTTCTTGTATTTATTGTTTCACGAACAGTGATCAAGCTGAATGCGTATCTACATTCGCGCCGATCTTCTCTGAGACTCAGACTATTATCGAACTTGACTCAGACGCTAGATAGATGAAGGTGACAAATTGATTTTGCGGCTTGAATTGTTTCGTTCTGATTGCACATCGCATGGCGCATATACATGTCTTATATGTATGTGCTAGAGCTCACTCAAAGTAATTTCTGCTTCTACACGTGAAGTGTCGATCCTTTGAAAACATATTCCGGTAAATAATACTGAGTACGCTTAAGCTCCCATATTCTTGGAATGCGCTGTCGGAGGTTGAATAAAAGGGTTCTGCACCTGCTAACTCTTGATGACATTTGAATATTGGCAAAGAACCCTGTAGGGAACCTGGAACCTCATGCAATATTAGCTTGAAGGATTCTTATCAATTTCATGTTTCCTGTTTGCCATCTCTGCAGTTCAGCGAGAAGCTTACGAGATAATTGCCACGGATCGAGAGCGAAAAATGGCTGAGCTAGCCTGGTTGACATCTTCGCCAGCAGCCAAAGTGACTTTGAATGCATCTTCTTCGTTTAGCAACTCGAACGAGAACCTTTTTGACCTGCTACAAGGTCGCTTGGGGAGTGGAGCGTTCGGGGGAGCAGCAATAGTAGATTCTTCATCGTTTTTCCGCACATCAGATCAGATGACGAATGTAACAGTAGCTTCGAATCATACGGAGTCCACTGTGTCGCTGATGAAGGCGGAGGACGGAAATAATCATATGCATTCGCCTCTTTGGGTAGCTGCCGGCGCTGCTGCTGTAGCAACAGATGGTATCTACAGCTCTACTGGTCCGGCAGCAGCTCATGTGCCATCCATTGATAGCACCCAATTGTCTTCTTACGTCAAGCCGCACGATCCTTCGCCGCAGCTTCAGGCTCTACGTGACTTCATGGCTTATGGGAGCAACGTTAACAACCATTCTATGTCGACAGCAGTGGATAATATCAACCTTGCGCCCGGACATCCAATGTTCCTGCACTTGGGTGAAGAATCTCCCGCTTCATTGCTCATTGGAATGCCTCACCACTCCAATCCCATATCTACTTCTCCTAGCAAAGGTCCGGATATGATGGCGTATAGAGCTCTATGTCAGGCCGAGCTTTTTGCGACAGAAAGGAGCCCACACAGAACGCAATTCCAACGAGAAAATCACATCCTTGCAGAGCGTCAGCGCAGGGAAGAAATGAACGAGAAGTTTTCGGCCTTAAGGGCAATGATACCCAAAGCAACCAAAGTACGTACCAGAACCAAAGTAACCCATTTCTTTCTGCACACAAGAGATTAATTTAGGCACTATCCTGACAGGATCCATGCTTTTTTGGTACACCGTATATCTTCTACTAATTTTAAGTCTTCCTGCAGGAAATTATCAGTCCTTTTTAGAATTCTGCGTATGAAATATTCGTGAGCAGAGACCGTTCCTCATGTTGCTGTTCGAAGAATCATCGGCAAGATTTTTGGCGATCGTAGTCACGTCTTAACTGAACGTTCATGATGGAAATAGTTACTAGCTGCAACGTATCGTGTCCATGTACGTTCTGAATATAACTGGCATGGAGATGACAAGTGCATTTCAAGGTCCACCACATGAAGTTCATTCACGTCAAATTGACGTGGATGAGACTTGAAGTTCAAACGACTCCAGATATAATTCAGAAACATGTGTTTGCATGCAAGCAGTTGTTTCTCATGTAGATTTGGCATCGAATTCTCGCATTAGATACCTTGTATGGAGAGCTTTAGAGCATTTTTCAGCCTGGTCTCTTGCTGTACTTCACTCTACAGCTAAATGATCGATTGTTGTCTGAACATCGTGTACGAGTGTTCGTCTGTTCAGTCGGAGAGGGTCACTTTTGGCTGATTCTACCTGTCAATACTGACAACGAATTATGTGTTATGTGCCATTTGACCAGAATCCTAAAGACCTCAGATGCGACAAATGAATACAATATAATGATATAAACTGTCAAAAAAGTAGTAACTTCTGCAGTTTTCTGTTTTCTTGTTTTAACGTGTTTTTTGAATGATAAGCGAAAGCCTCATTCTCAATCGCAGTTGTAATTCTCAGCTTTAGTAATTCGATTCGTGAAATTTCTTAGATCTGGTACTCTCGACCAAGAAGGATCGGGTTCTATTTTCCAGTTTCAAGTTTTAACTGCGACAGCAAAAATACTTTCAGCATAGAGATGAAGCACAGTTTCAATAGACTTCAAGCGGGTATAACCCCTCATGATTTTCCCTGACATTCATGGAATCTGTTTGCAGAAAGACAAGGCGTCCATTGTAGGAGATACAATCGCGTACGTGCTGGAGCTGGAGAAAACCCTAAAACAACTGAAGGCCTGCAAAGACAGTCGAAAGGGATTCAGCTTCAAGCTTCTAAAGAAGAAATCTTCTTCAAAAGTATTGGAAGACAACGACAGATCGACCTCAGACACAGCACCAGATACAGCTGCCCCAGAGGAAATGAAACCTGGTCCGGGATGTTCGAACTCAACAAGATTTGAAGACATTGTTTTAAAAGAGTGCAAAGAAAGAGAAGAGCCGACAATAAGTTCATCGGATAACATCAGTAGAGACTGCTCTCATAATCATCATGTAAATTCTTCTATCCCACCTGCGTAGACGTGCAACGCGATGTCATAGACGACGATGTGACTTCGTACTTGCTAGAAAAGCATGCTTAACTACTTAGATATGTTCAATAGCAATTAACCCTCGTTAGGGTAGGCACAGATCCCCGGGAGGTTTGTGCACGAAGGGATCCATGGTCGATGAATTTCTCCAGGCCTGGATTTCTTTGTTTCATCTAGGTCTTAATTCATGACTTCAAGACGTCGTTCCCTGCATACTGTATCATAGAGCGCGCTCTTGGTCCACAAGGACTTGCGTGGAGGAGCAACCAAAGTTTTGGACTAGTGAGCTAATCCCGTATGATCGCATGCATAGATTAAAAGTCTATTCTTCTACTTCACATGCAAACTCTAAAATTTGACTTTCGTAGCATTCTGATATCATCACTCTTACACAAGCGACACCTAACCCTTAGTAGAACTGAGTTCATGCACGTGGAACTTTAAAAGACTGTTATTAATTTTGCAGAAACCCATGGAGAAGGACAATCTTTTGGACATCGACATTAGTAGTAGCTCTCAGGTTGAGGTACAAAATCTAGGAGAGCAAGCCGTTATCAAGATAGTGTGCGCCCGCAGTCGTGGTCTTGTTCTTCGAATCATACAAGCTTTGGAGGAGTGCAAAACGGAAATTCTTCAGTCGAATGTAACAACAGTTTCTCAACATTCTGTACATTTTATCACTGTGCAGGTACAGTCATTTAGCCTTGAACCCTTTAGCTTGGAGTTGACTTTATCGGTCAATTTTCGCACATCAAATATGCACTAAAGGGTATAGACAATTTTTATCCAGCGTCTAATAGATACGGAATTAGTAATAAAGTTGCTCTCTCCTGTGGAAAGATGTCAAGAATTGTAGATATCTAAATGGCTATCCCGCTATTTGGTTTTAAGAATATCTGCCCACATCGATTTACCGTCACTCAGATTGCTCAAGACGCCAAGAGAATTTCAATTTGTAATTAACATTTTGTTGATAGCTTCTACTAGGTCTTTTTCTCTTTTTTGAAGAATCTTCCATATCTGAAATGTAAGTAGAAATAGATCAAGTCTTTGCATAGGAAGTATATGTATGCATGACTGCAACTTCAGAAAGGAGGCACCGGATCAATAGACGGCCTACAACGACGACCATACACTGTTTTGCCTTTTCTCACAAATAGGAGTATCAGTCAGAGTGACCAAACTTAGTCGCATACTGTAGTCACATAGCCTTCAAGTTACAACGTATTAATTGAGCTTTTATCTCACAGATCAATTCGGGGCTGAGCTGTTCAATAGAGCAGATGGTCCAAGCTCTTCTTAAAGCTTCAAATCCGAATCAGATTGCGGAGACATGACAACAGTTACGCCGCAGCGGAAGAGACCAAACAACTTTTAATAGCCGGCCAAGTCTAGATGCACCCAGTTGATGTAATGAGTTGACTCCTCAAATTCACTTGTTACTGCATGCAAAATTACCGGTGAGTGTATCGATCAATTTTGATCATGTAGTAATTCAAGTACAGTCTCCTTTAGAAAATCTTTGGGTAAAAGGATCCCCAATCCGACTCGGTACAGAAGAAATTTCTCTTTGTATTACAAGAACAGATATAGCACCCCCATCAACACTAGTCAGACTACTGAAGTAGCTCAGAGAAGTTGGAGAGGTAGATCACAACTTGTGGTGAGAATCCTCTCCACCGACATCTCAACAAATACTTACACTATCCCTCAAGCAACAAGGTCTAAAATGTCATAAACAGAGACCAGCACTGACTAAACTATATTCCCTACATTAGCTACGAAAGTAGTCAGTTCCACGATAACAAGGTAGGCTTTAGTCAAGTAGGGAGTTTGATTAGAGGATGAGATTTAGTTCATGTCTTTTCAGCATCCCTCAAGAAGATGTGAGGTGCTTCTGGTTCGACCTGGTAAAGTCCAATTTTCAAACCTCTCACTAGTTCTCCAATTGGCTTCCCAGTCCAGTCCAGAAGACATGTATCAATTGGTTGTTGAGCTTTACACATCCCAGTTTGCGGACTTATGTTAGTGCACTTACGTCCCATGGAGTTCGTTACCTTGACATCTGGCCCAAGATATCAAACTCAAGCTTGATGTTTCATGAAATTTCTCCAGGCAAGTAGCGACAATTTCCTTTCCTCCTATTAGACTACTCTTCGGACCCTACACCTTACTCACTGTGAACCACTGAACATTGATTGTCATAACTAAATGTGCTGCAATTCGGAAAAGTCTGCAGTCCGGTGCCGCTAAATTACATCCAAAAATGGCATTTTCGATCCAGAGATCAAAAGGACTCTGTTAGCGCATAATGCCACGAGATTGTGTATTGGATGTTGTTCAATATGTGAGAATATGTCGCATTCAGTTATGTTGCCTTGTATATACTTATAGCGCCACTTAGTTAAGTGGGATATGGGCACTTGCTGGTACACGGTGTAGAAAAGTGAAATCGGAATTTTTATTTTTCTAAGCTGGGGTTTACGACGAAGCTGAGGACTAAGCTAGGTGCGGAATCATAAAGAGTCATTGTCTACACCATAGTGGTTGCACTATCCTCGAGCTTAGAACCTGTACTGGCAATGTGCTATCTTGAGAAGTTTTTTTATAAGTCCAACGCAACGACAGGAAGTAAAGAGTTCTAGAAGGTTAAGGTAGAAGATTGAGAACAAACTCAAGCACGCATACAGAATCTGAAGATGATGCACGTCTTCACACGTGGACTTACGACTTATCATGGACCCATCATCGGTCATCAGCTTGGTGGACACCTGTGGACCAGCTGCACGTACTATGATTTTCTAGTATCGATCTAGGTACTCTGGTACGTGCTATATCAAATTTCCTGATTGGAGTTTCGGGAAGTGGTATTATCCGGTAAGTTTTAACGCACTTCTTTACTGCACTACGGTAGGCAGCACAGGTTTGACGGAAGATGAATAAACAAGAATTTGGATTAGAGCAACTCCGCCAAACACTTGGTATATATAGAACCATCGATGTTTTCTCTAATTAATTATTAGTTGTGTGTTTTGACTTCTTTTCGGAGAGTCTAATCTTCAATAGGACACAATCATGGTGCTACGTCCAAAGGCTTCGGAATTGTAGATGTCGTTCGAGAAGTCTTACTTCCCCTCGCATGCAAAAATCAGAGACAGGACACATTTTTTTTACCAGTACCATAATGAATGTCTGTAATATGTTGAAAGTTTGAAGTTTCTGCGAGTTTTTTACTGGTACTGGAAAATTTTAAGGTGACGACTTAGAAATTGCCAGTTCTGAAGGTGAATTGATGTTTGTTTCGATTCGCAGGTAAACATTTTTTCCAAAATCAAATTGAGACCGGCTGGACATAGAAGGTTTCAGAGTCCAAAATGTCCAAAATCTGTTTGTGAATCCAAGTACTTCTCCACTTATCAAGTTCCAACTCTTTACTAGAATTTCATGCACTTGGGAGATGCCGTGAAATGGAGTGTACTGTACTTGCCAATTAGAAGCCTTCACACCCCAGGCCCCTTAGCTTTCAGTACCCGAACCTGATCCACAATGATAAAAGGCACGCCCACCAGTAATGAATGCGGGCAAATTATGTGGAAAGCCCGAAATTCCGAGAGATGAATCATGACTGCAGGAGGAGGAGGAAGATTTGAGAAGATGCATTATGCCCGGTACGTAGCGTGGGAAACGTACTCTCAGTGGATCCACTGCAATCAAAGAGTCTGGATTGGTTTTGCTCACCGGTGTGATTGGAAGATGATAGATTTGAACTGTCTCAGCATGTACATAAGTACAGTAATCATCGAGGAAGACGAGTCTCGGAATAAGTATGTCACATAACGATGAATCAAGCGCAAATGTGGAATCTTGCGATTTGATAGCGCGAGCTTATTACAAAAGGACCCAACCGTCATGGACTTTGATCAGCCATGGCCACGTACATACACGTACAATTAGTTTGATGTAAAGCGCGTAAGTACTCCACAACTACTTGACGACCGTCCATGTCAGTGCAGTTCGTTCTGCCTGTCTCGTCTGTTAGAACATTTTCCGGTTCATATTCTCACAATTGTACTCCTTCCAGTTC

mRNA

>Mapoly0029s0130.2
TTGCAGGCACTGCGGCGGGAAAGGGTAGAATGTAGGGAGTGGTGTACACGTCAACGAGGAGGAGCGTAATGCAGCAGAGTAGATGATGAGCGAGGAGAGGAGAGGAGAGGTGATAATGCGAGCGCAGGCGTGACTAGCCGAGACGTCGAGTGTTGGTTGAGGATGGTACTCGTCGGATGGGATGGCGATCTGGAGCCAGAAACGCGAAGATTTGATGTGATTCCAGATAGTTGAGAGGCGAGACGCGAGTTGTTGTGAGCGTGTACATTTTACTGCCGACCTTACGTTCGTTCGGCAGGATAGACAGACGGGCTGAGCTTCTCGGAACCTCATGTAGACGTATTAGTTCAGCGAGAAGCTTACGAGATAATTGCCACGGATCGAGAGCGAAAAATGGCTGAGCTAGCCTGGTTGACATCTTCGCCAGCAGCCAAAGTGACTTTGAATGCATCTTCTTCGTTTAGCAACTCGAACGAGAACCTTTTTGACCTGCTACAAGGTCGCTTGGGGAGTGGAGCGTTCGGGGGAGCAGCAATAGTAGATTCTTCATCGTTTTTCCGCACATCAGATCAGATGACGAATGTAACAGTAGCTTCGAATCATACGGAGTCCACTGTGTCGCTGATGAAGGCGGAGGACGGAAATAATCATATGCATTCGCCTCTTTGGGTAGCTGCCGGCGCTGCTGCTGTAGCAACAGATGGTATCTACAGCTCTACTGGTCCGGCAGCAGCTCATGTGCCATCCATTGATAGCACCCAATTGTCTTCTTACGTCAAGCCGCACGATCCTTCGCCGCAGCTTCAGGCTCTACGTGACTTCATGGCTTATGGGAGCAACGTTAACAACCATTCTATGTCGACAGCAGTGGATAATATCAACCTTGCGCCCGGACATCCAATGTTCCTGCACTTGGGTGAAGAATCTCCCGCTTCATTGCTCATTGGAATGCCTCACCACTCCAATCCCATATCTACTTCTCCTAGCAAAGGTCCGGATATGATGGCGTATAGAGCTCTATGTCAGGCCGAGCTTTTTGCGACAGAAAGGAGCCCACACAGAACGCAATTCCAACGAGAAAATCACATCCTTGCAGAGCGTCAGCGCAGGGAAGAAATGAACGAGAAGTTTTCGGCCTTAAGGGCAATGATACCCAAAGCAACCAAAAAAGACAAGGCGTCCATTGTAGGAGATACAATCGCGTACGTGCTGGAGCTGGAGAAAACCCTAAAACAACTGAAGGCCTGCAAAGACAGTCGAAAGGGATTCAGCTTCAAGCTTCTAAAGAAGAAATCTTCTTCAAAAGTATTGGAAGACAACGACAGATCGACCTCAGACACAGCACCAGATACAGCTGCCCCAGAGGAAATGAAACCTGGTCCGGGATGTTCGAACTCAACAAGATTTGAAGACATTGTTTTAAAAGAGTGCAAAGAAAGAGAAGAGCCGACAATAAGTTCATCGGATAACATCAGTAGAGACTGCTCTCATAATCATCATAAACCCATGGAGAAGGACAATCTTTTGGACATCGACATTAGTAGTAGCTCTCAGGTTGAGGTACAAAATCTAGGAGAGCAAGCCGTTATCAAGATAGTGTGCGCCCGCAGTCGTGGTCTTGTTCTTCGAATCATACAAGCTTTGGAGGAGTGCAAAACGGAAATTCTTCAGTCGAATGTAACAACAGTTTCTCAACATTCTGTACATTTTATCACTGTGCAGATCAATTCGGGGCTGAGCTGTTCAATAGAGCAGATGGTCCAAGCTCTTCTTAAAGCTTCAAATCCGAATCAGATTGCGGAGACATGACAACAGTTACGCCGCAGCGGAAGAGACCAAACAACTTTTAATAGCCGGCCAAGTCTAGATGCACCCAGTTGATGTAATGAGTTGACTCCTCAAATTCACTTGTTACTGCATGCAAAATTACCGGTGAGTGTATCGATCAATTTTGATCATGTAGTAATTCAAGTACAGTCTCCTTTAGAAAATCTTTGGGTAAAAGGATCCCCAATCCGACTCGGTACAGAAGAAATTTCTCTTTGTATTACAAGAACAGATATAGCACCCCCATCAACACTAGTCAGACTACTGAAGTAGCTCAGAGAAGTTGGAGAGGTAGATCACAACTTGTGGTGAGAATCCTCTCCACCGACATCTCAACAAATACTTACACTATCCCTCAAGCAACAAGGTCTAAAATGTCATAAACAGAGACCAGCACTGACTAAACTATATTCCCTACATTAGCTACGAAAGTAGTCAGTTCCACGATAACAAGGTAGGCTTTAGTCAAGTAGGGAGTTTGATTAGAGGATGAGATTTAGTTCATGTCTTTTCAGCATCCCTCAAGAAGATGTGAGGTGCTTCTGGTTCGACCTGGTAAAGTCCAATTTTCAAACCTCTCACTAGTTCTCCAATTGGCTTCCCAGTCCAGTCCAGAAGACATGTATCAATTGGTTGTTGAGCTTTACACATCCCAGTTTGCGGACTTATGTTAGTGCACTTACGTCCCATGGAGTTCGTTACCTTGACATCTGGCCCAAGATATCAAACTCAAGCTTGATGTTTCATGAAATTTCTCCAGGCAAGTAGCGACAATTTCCTTTCCTCCTATTAGACTACTCTTCGGACCCTACACCTTACTCACTGTGAACCACTGAACATTGATTGTCATAACTAAATGTGCTGCAATTCGGAAAAGTCTGCAGTCCGGTGCCGCTAAATTACATCCAAAAATGGCATTTTCGATCCAGAGATCAAAAGGACTCTGTTAGCGCATAATGCCACGAGATTGTGTATTGGATGTTGTTCAATATGTGAGAATATGTCGCATTCAGTTATGTTGCCTTGTATATACTTATAGCGCCACTTAGTTAAGTGGGATATGGGCACTTGCTGGTACACGGTGTAGAAAAGTGAAATCGGAATTTTTATTTTTCTAAGCTGGGGTTTACGACGAAGCTGAGGACTAAGCTAGGTGCGGAATCATAAAGAGTCATTGTCTACACCATAGTGGTTGCACTATCCTCGAGCTTAGAACCTGTACTGGCAATGTGCTATCTTGAGAAGTTTTTTTATAAGTCCAACGCAACGACAGGAAGTAAAGAGTTCTAGAAGGTTAAGGTAGAAGATTGAGAACAAACTCAAGCACGCATACAGAATCTGAAGATGATGCACGTCTTCACACGTGGACTTACGACTTATCATGGACCCATCATCGGTCATCAGCTTGGTGGACACCTGTGGACCAGCTGCACGTACTATGATTTTCTAGTATCGATCTAGGTACTCTGGTACGTGCTATATCAAATTTCCTGATTGGAGTTTCGGGAAGTGGTATTATCCGGTAAACATTTTTTCCAAAATCAAATTGAGACCGGCTGGACATAGAAGGTTTCAGAGTCCAAAATGTCCAAAATCTGTTTGTGAATCCAAGTACTTCTCCACTTATCAAGTTCCAACTCTTTACTAGAATTTCATGCACTTGGGAGATGCCGTGAAATGGAGTGTACTGTACTTGCCAATTAGAAGCCTTCACACCCCAGGCCCCTTAGCTTTCAGTACCCGAACCTGATCCACAATGATAAAAGGCACGCCCACCAGTAATGAATGCGGGCAAATTATGTGGAAAGCCCGAAATTCCGAGAGATGAATCATGACTGCAGGAGGAGGAGGAAGATTTGAGAAGATGCATTATGCCCGGTACGTAGCGTGGGAAACGTACTCTCAGTGGATCCACTGCAATCAAAGAGTCTGGATTGGTTTTGCTCACCGGTGTGATTGGAAGATGATAGATTTGAACTGTCTCAGCATGTACATAAGTACAGTAATCATCGAGGAAGACGAGTCTCGGAATAAGTATGTCACATAACGATGAATCAAGCGCAAATGTGGAATCTTGCGATTTGATAGCGCGAGCTTATTACAAAAGGACCCAACCGTCATGGACTTTGATCAGCCATGGCCACGTACATACACGTACAATTAGTTTGATGTAAAGCGCGTAAGTACTCCACAACTACTTGACGACCGTCCATGTCAGTGCAGTTCGTTCTGCCTGTCTCGTCTGTTAGAACATTTTCCGGTTCATATTCTCACAATTGTACTCCTTCCAGTTC

CDS

>Mapoly0029s0130.2
ATGGCTGAGCTAGCCTGGTTGACATCTTCGCCAGCAGCCAAAGTGACTTTGAATGCATCTTCTTCGTTTAGCAACTCGAACGAGAACCTTTTTGACCTGCTACAAGGTCGCTTGGGGAGTGGAGCGTTCGGGGGAGCAGCAATAGTAGATTCTTCATCGTTTTTCCGCACATCAGATCAGATGACGAATGTAACAGTAGCTTCGAATCATACGGAGTCCACTGTGTCGCTGATGAAGGCGGAGGACGGAAATAATCATATGCATTCGCCTCTTTGGGTAGCTGCCGGCGCTGCTGCTGTAGCAACAGATGGTATCTACAGCTCTACTGGTCCGGCAGCAGCTCATGTGCCATCCATTGATAGCACCCAATTGTCTTCTTACGTCAAGCCGCACGATCCTTCGCCGCAGCTTCAGGCTCTACGTGACTTCATGGCTTATGGGAGCAACGTTAACAACCATTCTATGTCGACAGCAGTGGATAATATCAACCTTGCGCCCGGACATCCAATGTTCCTGCACTTGGGTGAAGAATCTCCCGCTTCATTGCTCATTGGAATGCCTCACCACTCCAATCCCATATCTACTTCTCCTAGCAAAGGTCCGGATATGATGGCGTATAGAGCTCTATGTCAGGCCGAGCTTTTTGCGACAGAAAGGAGCCCACACAGAACGCAATTCCAACGAGAAAATCACATCCTTGCAGAGCGTCAGCGCAGGGAAGAAATGAACGAGAAGTTTTCGGCCTTAAGGGCAATGATACCCAAAGCAACCAAAAAAGACAAGGCGTCCATTGTAGGAGATACAATCGCGTACGTGCTGGAGCTGGAGAAAACCCTAAAACAACTGAAGGCCTGCAAAGACAGTCGAAAGGGATTCAGCTTCAAGCTTCTAAAGAAGAAATCTTCTTCAAAAGTATTGGAAGACAACGACAGATCGACCTCAGACACAGCACCAGATACAGCTGCCCCAGAGGAAATGAAACCTGGTCCGGGATGTTCGAACTCAACAAGATTTGAAGACATTGTTTTAAAAGAGTGCAAAGAAAGAGAAGAGCCGACAATAAGTTCATCGGATAACATCAGTAGAGACTGCTCTCATAATCATCATAAACCCATGGAGAAGGACAATCTTTTGGACATCGACATTAGTAGTAGCTCTCAGGTTGAGGTACAAAATCTAGGAGAGCAAGCCGTTATCAAGATAGTGTGCGCCCGCAGTCGTGGTCTTGTTCTTCGAATCATACAAGCTTTGGAGGAGTGCAAAACGGAAATTCTTCAGTCGAATGTAACAACAGTTTCTCAACATTCTGTACATTTTATCACTGTGCAGATCAATTCGGGGCTGAGCTGTTCAATAGAGCAGATGGTCCAAGCTCTTCTTAAAGCTTCAAATCCGAATCAGATTGCGGAGACATGA

Protein

>Mapoly0029s0130.2
MAELAWLTSSPAAKVTLNASSSFSNSNENLFDLLQGRLGSGAFGGAAIVDSSSFFRTSDQMTNVTVASNHTESTVSLMKAEDGNNHMHSPLWVAAGAAAVATDGIYSSTGPAAAHVPSIDSTQLSSYVKPHDPSPQLQALRDFMAYGSNVNNHSMSTAVDNINLAPGHPMFLHLGEESPASLLIGMPHHSNPISTSPSKGPDMMAYRALCQAELFATERSPHRTQFQRENHILAERQRREEMNEKFSALRAMIPKATKKDKASIVGDTIAYVLELEKTLKQLKACKDSRKGFSFKLLKKKSSSKVLEDNDRSTSDTAPDTAAPEEMKPGPGCSNSTRFEDIVLKECKEREEPTISSSDNISRDCSHNHHKPMEKDNLLDIDISSSSQVEVQNLGEQAVIKIVCARSRGLVLRIIQALEECKTEILQSNVTTVSQHSVHFITVQINSGLSCSIEQMVQALLKASNPNQIAET

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>