Mapoly0029s0135



Description

(UnKnown)

Reference DB

Database ID Description
OrthoMCL OG5_243827
PANTHER PTHR16223 FAMILY NOT NAMED

Nomenclature

[Notice] The nomenclature site is currently operated as a Beta version for testing.

Gene symbol Product Transcript ID Status
MpBHLH33 transcription factor, bHLH Mapoly0029s0135.1 Public

Transcript models

Transcript ID Location Sequences Gene model
Mapoly0029s0135.1 scaffold_29:1433648..1435411  ( - strand ) Gene /  mRNA /  CDS /  Protein
GenBank format (with flanking bases)

Mapoly0029s0135.1  

Gene structure:

mRNA scaffold_29:1433648..1435411  ( - strand )
CDS scaffold_29:1433648..1435411  ( - strand )

Sequences:

Gene

>Mapoly0029s0135.1
ATGGCCCTCACAGCAAATCCTGTACCGACTTCGGTCCAAGACGCGAAGTTGCTTCCATTTCACAGCAACGGCAAGAACGAAAGCGATATGTGGGATTCATACGCCGACAATGTCTCTTCTCACGTGCATCATGGAGAAGACACATTGACGGGGACGCCGATGGGGACAGTGGATCACCAGCAGCAGCAGCAGCAGGACAAGCATTACCCTGCTTCGACTTCCGGACTCTCTCGGAATGCTTCGTTCGATTCTGTCACCTCTCATGATTCATGCACGGCATCTTTTTCGACTGGATCTCCGGTAACAGTGCTTCCGCCTCTACAATACACATGTAGCGGCACTGGCATGGACAATAGCCCATTGAACATGTCGACCCATGCTGGTGCCTGGCCCAACAGTTTTAACAGCTCCAACAAGAGATCTTCTCCTTCCGGGTTGGAGCCCTCGGAGCAGCAGCAGCAGCAACAACAACACCAGCAGCAGCAACATCAGGAGTCAATTGCAGTCGACAGTTTCTGGATCGGTCACGACCAGATGCTGTTGTCTGAGGACTGCGAACCACTTCTTCCGTCCCCGGTGGGAACCGGGACCTTGTCGTCAATGCTGAACGAATTTCCTTTCAGGTACGATGACCAGGCGTGTGCAAGCAATTGCAACGATTACACTTCGGTGAACGATTTGGAATGTCTGGTGCCATCGTCTCTCAGAACGAATGAGCCATCTCATGATCAGCAGCAGCAGCAAGTGGTCAAATCTCCTGAATCAGTCGGGAACAGCAATGCCCATAGCACCTCCCCTGGACAGCAGCAGCAGCAGCAGCAGTCCCAGCAAGATTTCTGTCAAGAGTTCCTCGTCGGAGGAAGCGAGGTGTATTCCGAGCACAATGCCAGGAGATCTGACGCTTCGCTCTTGTCTCCGCCAGCAGCTCGCCGCCGTCTCAGCTGGTCCGAGTACCAGGTGCCCGAGCCACAACGACATCTAGCGACGTCGGAGGGCCTGCACTTCGCTGGCTTCGGCTCGCAAGCCTACGACCACCAGCAGCACTTCGTGCCGCTGGGCGACAGCAATGCCATGGCGCCGCTCCTGCCCTTCCGCGGCAGCAGCTGCACCGTGCAAGACTCGGGGGTGGGCGCAAGCGTCGGAGGCCTCAAGCGCCCGTACTCGGCGATGATGATGCAGCCGCAGCAGCAGCAGCCAGCGTCGACTTGCAGCATTTCGTCGTCGGCGCCGACGCTGAGCCACAATTCGTATCTGAGCAAATTTCCCAGCGTCGGGCCCGCGGCTCCCAAGAGCGCCATGAGCAACATGGCGCCCATTCTGAGCGCCTCGCACGGCAGCCACCACCACCAGGACGCGGCGGCGCTAAGCGCGCTGCTGTACAAGACGCAGGGCAGCAGCGAGATGATGCAGCAGCTGCAGCAGCAGCAGGGCCAAGGCACCAGCAGCTCGGATTCGGCAGCCCGGCAGCTGCCGCCTCCCAAGCTGCGCCGGCGCCACGGCACGGCCACGGATCCGCAGAGCATCGCCGCGCGCACGCGGCGCGAGAGATTCAGCGACCGCATCCGAATTCTGCAGAGCCTGGTGCCCAACGGCGAGCGCCTCGACACCGTGTCCATGCTGGGCCACACTCTGGAGTACGTGCGCTTCCTGCAACATCAAGTGTGGCAGTTGTACAATGGCAACGACGAGCCGGCCGTGTCGGCCGATTCCGAGTCCCGCGAGAAGTGGAAGGAGTTCCTCGACGCTCAGACCGTGGTCGCTTGA

mRNA

>Mapoly0029s0135.1
ATGGCCCTCACAGCAAATCCTGTACCGACTTCGGTCCAAGACGCGAAGTTGCTTCCATTTCACAGCAACGGCAAGAACGAAAGCGATATGTGGGATTCATACGCCGACAATGTCTCTTCTCACGTGCATCATGGAGAAGACACATTGACGGGGACGCCGATGGGGACAGTGGATCACCAGCAGCAGCAGCAGCAGGACAAGCATTACCCTGCTTCGACTTCCGGACTCTCTCGGAATGCTTCGTTCGATTCTGTCACCTCTCATGATTCATGCACGGCATCTTTTTCGACTGGATCTCCGGTAACAGTGCTTCCGCCTCTACAATACACATGTAGCGGCACTGGCATGGACAATAGCCCATTGAACATGTCGACCCATGCTGGTGCCTGGCCCAACAGTTTTAACAGCTCCAACAAGAGATCTTCTCCTTCCGGGTTGGAGCCCTCGGAGCAGCAGCAGCAGCAACAACAACACCAGCAGCAGCAACATCAGGAGTCAATTGCAGTCGACAGTTTCTGGATCGGTCACGACCAGATGCTGTTGTCTGAGGACTGCGAACCACTTCTTCCGTCCCCGGTGGGAACCGGGACCTTGTCGTCAATGCTGAACGAATTTCCTTTCAGGTACGATGACCAGGCGTGTGCAAGCAATTGCAACGATTACACTTCGGTGAACGATTTGGAATGTCTGGTGCCATCGTCTCTCAGAACGAATGAGCCATCTCATGATCAGCAGCAGCAGCAAGTGGTCAAATCTCCTGAATCAGTCGGGAACAGCAATGCCCATAGCACCTCCCCTGGACAGCAGCAGCAGCAGCAGCAGTCCCAGCAAGATTTCTGTCAAGAGTTCCTCGTCGGAGGAAGCGAGGTGTATTCCGAGCACAATGCCAGGAGATCTGACGCTTCGCTCTTGTCTCCGCCAGCAGCTCGCCGCCGTCTCAGCTGGTCCGAGTACCAGGTGCCCGAGCCACAACGACATCTAGCGACGTCGGAGGGCCTGCACTTCGCTGGCTTCGGCTCGCAAGCCTACGACCACCAGCAGCACTTCGTGCCGCTGGGCGACAGCAATGCCATGGCGCCGCTCCTGCCCTTCCGCGGCAGCAGCTGCACCGTGCAAGACTCGGGGGTGGGCGCAAGCGTCGGAGGCCTCAAGCGCCCGTACTCGGCGATGATGATGCAGCCGCAGCAGCAGCAGCCAGCGTCGACTTGCAGCATTTCGTCGTCGGCGCCGACGCTGAGCCACAATTCGTATCTGAGCAAATTTCCCAGCGTCGGGCCCGCGGCTCCCAAGAGCGCCATGAGCAACATGGCGCCCATTCTGAGCGCCTCGCACGGCAGCCACCACCACCAGGACGCGGCGGCGCTAAGCGCGCTGCTGTACAAGACGCAGGGCAGCAGCGAGATGATGCAGCAGCTGCAGCAGCAGCAGGGCCAAGGCACCAGCAGCTCGGATTCGGCAGCCCGGCAGCTGCCGCCTCCCAAGCTGCGCCGGCGCCACGGCACGGCCACGGATCCGCAGAGCATCGCCGCGCGCACGCGGCGCGAGAGATTCAGCGACCGCATCCGAATTCTGCAGAGCCTGGTGCCCAACGGCGAGCGCCTCGACACCGTGTCCATGCTGGGCCACACTCTGGAGTACGTGCGCTTCCTGCAACATCAAGTGTGGCAGTTGTACAATGGCAACGACGAGCCGGCCGTGTCGGCCGATTCCGAGTCCCGCGAGAAGTGGAAGGAGTTCCTCGACGCTCAGACCGTGGTCGCTTGA

CDS

>Mapoly0029s0135.1
ATGGCCCTCACAGCAAATCCTGTACCGACTTCGGTCCAAGACGCGAAGTTGCTTCCATTTCACAGCAACGGCAAGAACGAAAGCGATATGTGGGATTCATACGCCGACAATGTCTCTTCTCACGTGCATCATGGAGAAGACACATTGACGGGGACGCCGATGGGGACAGTGGATCACCAGCAGCAGCAGCAGCAGGACAAGCATTACCCTGCTTCGACTTCCGGACTCTCTCGGAATGCTTCGTTCGATTCTGTCACCTCTCATGATTCATGCACGGCATCTTTTTCGACTGGATCTCCGGTAACAGTGCTTCCGCCTCTACAATACACATGTAGCGGCACTGGCATGGACAATAGCCCATTGAACATGTCGACCCATGCTGGTGCCTGGCCCAACAGTTTTAACAGCTCCAACAAGAGATCTTCTCCTTCCGGGTTGGAGCCCTCGGAGCAGCAGCAGCAGCAACAACAACACCAGCAGCAGCAACATCAGGAGTCAATTGCAGTCGACAGTTTCTGGATCGGTCACGACCAGATGCTGTTGTCTGAGGACTGCGAACCACTTCTTCCGTCCCCGGTGGGAACCGGGACCTTGTCGTCAATGCTGAACGAATTTCCTTTCAGGTACGATGACCAGGCGTGTGCAAGCAATTGCAACGATTACACTTCGGTGAACGATTTGGAATGTCTGGTGCCATCGTCTCTCAGAACGAATGAGCCATCTCATGATCAGCAGCAGCAGCAAGTGGTCAAATCTCCTGAATCAGTCGGGAACAGCAATGCCCATAGCACCTCCCCTGGACAGCAGCAGCAGCAGCAGCAGTCCCAGCAAGATTTCTGTCAAGAGTTCCTCGTCGGAGGAAGCGAGGTGTATTCCGAGCACAATGCCAGGAGATCTGACGCTTCGCTCTTGTCTCCGCCAGCAGCTCGCCGCCGTCTCAGCTGGTCCGAGTACCAGGTGCCCGAGCCACAACGACATCTAGCGACGTCGGAGGGCCTGCACTTCGCTGGCTTCGGCTCGCAAGCCTACGACCACCAGCAGCACTTCGTGCCGCTGGGCGACAGCAATGCCATGGCGCCGCTCCTGCCCTTCCGCGGCAGCAGCTGCACCGTGCAAGACTCGGGGGTGGGCGCAAGCGTCGGAGGCCTCAAGCGCCCGTACTCGGCGATGATGATGCAGCCGCAGCAGCAGCAGCCAGCGTCGACTTGCAGCATTTCGTCGTCGGCGCCGACGCTGAGCCACAATTCGTATCTGAGCAAATTTCCCAGCGTCGGGCCCGCGGCTCCCAAGAGCGCCATGAGCAACATGGCGCCCATTCTGAGCGCCTCGCACGGCAGCCACCACCACCAGGACGCGGCGGCGCTAAGCGCGCTGCTGTACAAGACGCAGGGCAGCAGCGAGATGATGCAGCAGCTGCAGCAGCAGCAGGGCCAAGGCACCAGCAGCTCGGATTCGGCAGCCCGGCAGCTGCCGCCTCCCAAGCTGCGCCGGCGCCACGGCACGGCCACGGATCCGCAGAGCATCGCCGCGCGCACGCGGCGCGAGAGATTCAGCGACCGCATCCGAATTCTGCAGAGCCTGGTGCCCAACGGCGAGCGCCTCGACACCGTGTCCATGCTGGGCCACACTCTGGAGTACGTGCGCTTCCTGCAACATCAAGTGTGGCAGTTGTACAATGGCAACGACGAGCCGGCCGTGTCGGCCGATTCCGAGTCCCGCGAGAAGTGGAAGGAGTTCCTCGACGCTCAGACCGTGGTCGCTTGA

Protein

>Mapoly0029s0135.1
MALTANPVPTSVQDAKLLPFHSNGKNESDMWDSYADNVSSHVHHGEDTLTGTPMGTVDHQQQQQQDKHYPASTSGLSRNASFDSVTSHDSCTASFSTGSPVTVLPPLQYTCSGTGMDNSPLNMSTHAGAWPNSFNSSNKRSSPSGLEPSEQQQQQQQHQQQQHQESIAVDSFWIGHDQMLLSEDCEPLLPSPVGTGTLSSMLNEFPFRYDDQACASNCNDYTSVNDLECLVPSSLRTNEPSHDQQQQQVVKSPESVGNSNAHSTSPGQQQQQQQSQQDFCQEFLVGGSEVYSEHNARRSDASLLSPPAARRRLSWSEYQVPEPQRHLATSEGLHFAGFGSQAYDHQQHFVPLGDSNAMAPLLPFRGSSCTVQDSGVGASVGGLKRPYSAMMMQPQQQQPASTCSISSSAPTLSHNSYLSKFPSVGPAAPKSAMSNMAPILSASHGSHHHQDAAALSALLYKTQGSSEMMQQLQQQQGQGTSSSDSAARQLPPPKLRRRHGTATDPQSIAARTRRERFSDRIRILQSLVPNGERLDTVSMLGHTLEYVRFLQHQVWQLYNGNDEPAVSADSESREKWKEFLDAQTVVA

MarpolBase: Marchantia Genome Database / Genome Informatics Laboratory, NIG. <mpgdb'@'ynlab.info>